Construction method and application of VIGS silencing system for plant gene function identification

Abstract

The invention discloses an establishment method and application of a VIGS silencing system for plant gene function identification. The method comprises the following steps: firstly, obtaining a CHLH tracing gene, then constructing a TRV2-CHLH visual vector by utilizing a tobacco brittle rupture virus (TRV2), then constructing a TRV2-CHLH target gene interference tracing vector, transforming the obtained TRV2-CHLH target gene interference tracing vector into agrobacterium, and performing injection infection on cotyledons of a target plant to construct the VIGS silencing system. The system can identify the function of a target gene and screen the target gene, so that the expression of the target gene is enhanced, the content of effective components is increased, and genetic engineering beneficial to improving the quality of medicinal materials is constructed.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a construction method and application of a VIGS silencing system for identifying plant gene functions. Background Art

[0002] Virus-induced gene silencing (VIGS) is a rapid and simple forward and reverse genetics method for identifying gene function by inhibiting the expression of endogenous plant genes through virus infection, thereby causing corresponding changes in the phenotype or physiological shape of the plant. VIGS gene silencing technology has the advantages of low cost, short experimental cycle, high-efficiency expression, simple operation steps, fast phenotype appearance and high throughput. It is a commonly used technology to study the function of plant genes. The efficiency of VIGS is affected by environmental factors, viral vectors, inserted gene fragments and other factors. It is necessary to further optimize the VIGS conditions to improve the VIGS silencing efficiency and expand the application of VIGS.

[0003] Tobacco Rattle Virus (TRV) has the advantages of high viral infection rate, long silencing time, no typical viral traits, and easy transformation. It is currently the most widely used and effective VIGS viral vector in plants. Magnesium ion chelate (CHLH) is involved in the synthesis of plant chlorophyll, and yellowing will occur when this gene is silenced. Therefore, this gene is widely used as a reporter gene and is widely used in the VIGS silencing system.

[0004] Elsholtzia is the dried aerial part of Mosla chinensis Maxim. or Moslachinensis'Jiangxiangru', a plant of the genus Mosla in the Lamiaceae family. It is slightly warm in nature, pungent in taste, and enters the lung and stomach meridians. It can induce sweating and relieve the symptoms, and dispel dampness and harmonize the middle. It is used for summer-heat cold, aversion to cold and fever, headache without sweating, abdominal pain, vomiting and diarrhea, edema, and urinary difficulty. In order to improve the quality and yield of Elsholtzia chinensis, it is necessary to clarify the biosynthesis pathway of phenolic monoterpenes from the perspective of molecular biology. Therefore, it is urgent to develop a system for studying the function of genes in Elsholtzia chinensis and its construction method. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to obtain a method for establishing and applying a VIGS silencing system for plant gene function identification with low cost, short test cycle and high expression efficiency. The present invention first forms a TRV2-CHLH visualization vector, then constructs a TRV2-CHLH-target gene interference tracer vector, transforms the obtained TRV2-CHLH-target gene interference tracer vector into Agrobacterium, and then injects and infects the cotyledons of the target plant to construct a VIGS silencing system. The system of the present invention can identify the function of the target gene, can screen the target gene to improve the quality and yield of medicinal materials such as Elsholtzia elata, thereby enhancing the expression of the target gene, increasing the content of the effective ingredient, and constructing a genetic engineering that is beneficial to improving the quality of medicinal materials.

[0006] Technical solution: To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A method for constructing a VIGS silencing system for identifying plant gene function, characterized in that it comprises the following steps:

[0008] Construction of interference tracer vector TRV2-CHLH-target gene:

[0009] Using the cDNA of the genus Astragalus as a template, PCR amplification was performed using nucleotide sequences such as CHLH-F1 and CHLH-R1 as primers to obtain a fragment of the key gene CHLH for chlorophyll synthesis. The nucleotide sequence of the CHLH gene is shown in SEQ ID NO.1.

[0010] The amplified gene CHLH fragment was inserted into the EcoRI and BamHI sites of the TRV2 plasmid to form a TRV2-CHLH visualization vector;

[0011] Using the cDNA of the genus Ligusticum as a template, using nucleotide sequences such as CHLH-F2, CHLH-R2 and SDR-F1, SDR-R1 as primers to amplify the target gene, inserting the target gene fragment to be traced into the EcoR I and BamH I restriction sites of the TRV2 vector to obtain the TRV2-CHLH-target gene expression vector, i.e., the interference tracer vector;

[0012] After the obtained TRV2-CHLH-target gene expression vector was transformed into Agrobacterium, the cotyledons of the target plants were injected and infected to construct a VIGS silencing system.

[0013] As a preferred embodiment, in the method for constructing the VIGS silencing system for identifying plant gene function, the plant of the genus Elsholtzia is Elsholtzia jiangruo.

[0014] As a preferred embodiment, the target gene includes but is not limited to any gene of the SDR gene of the genus Lathyrus.

[0015] As a preferred embodiment, in the method for constructing the VIGS silencing system for identifying plant gene function, the injection infection site is the back side of the cotyledon of the plant seedling.

[0016] An interference tracing vector, wherein the interference tracing vector is a TRV2-CHLH-target gene expression vector;

[0017] The target gene is selected from any gene of the plant of the genus Ligusticum. As a more preferred solution, the target gene is the SDR gene, and the interference tracer vector is TRV2-CHLH-SDR.

[0018] A method for constructing an interference tracer vector TRV2-CHLH-SDR, the construction steps of which are as follows:

[0019] Using Elsholtzia jiangensis cDNA as a template, PCR amplification was performed using primers with nucleotide sequences such as CHLH-F1 and CHLH-R1 to obtain the target fragment CHLH; the nucleotide sequence of the CHLH gene is shown in SEQ ID NO.1;

[0020] The amplified gene CHLH fragment was inserted into the EcoRI and BamHI sites of the TRV2 plasmid to form a TRV2-CHLH visualization vector;

[0021] Using Elsholtzia cDNA as a template and nucleotide sequences such as CHLH-F2, CHLH-R2 and SDR-F1, SDR-R1 as primers, PCR amplification is performed to obtain the target gene SDR, and the target gene SDR fragment to be traced is inserted into the EcoR I and BamH I restriction sites of the TRV2 vector to obtain the TRV2-CHLH-SDR vector, i.e., the interference tracer vector.

[0022] The present invention also provides application of the interference tracer vector in the construction of Elsholtzia crusgalli VIGS silencing system, and the Elsholtzia crusgalli VIGS silencing system is used for the identification of plant gene functions.

[0023] The present invention also provides the application of CHLH tracer gene in the study of gene function of Leptospermum plant, wherein the CHLH tracer gene is used to indicate the scope of gene silencing.

[0024] Beneficial effects:

[0025] The present invention establishes a method for establishing a VIGS silencing system for plant gene function identification with low cost, short test cycle and high efficiency expression. The present invention first obtains a CHLH tracer gene, then constructs a TRV2-CHLH visualization vector, and then constructs a TRV2-CHLH-target gene interference tracer vector. After the obtained TRV2-CHLH-target gene interference tracer vector is transformed into Agrobacterium, the cotyledons of the target plant are injected and infected to construct a VIGS silencing system. The system of the present invention can identify the function of the target gene and screen out the target gene, which can provide a scientific basis for improving the quality of medicinal materials such as Elsholtzia jiangensis and the content of effective ingredients. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The following are the results of cloning the specific fragments of each gene. A is the TRV2-CHLH single fragment clone, B is the TRV2-CHLH-SDR double fragment clone; 1: CHLH fragment; 2: SDR fragment.

[0027] Figure 2 These are pictures of plants infected with Elsholtzia jiangensis. A: Yellowing phenotype of seedlings 10 days after infection; B: Yellowing phenotype of plants 21 days after infection.

[0028] Figure 3 For the expression analysis of related genes, the control group was (TRV2-CHLH) and the experimental group was (TRV2-CHLH-SDR). *p<=0.05, **p<=0.01, ***p<=0.001

[0029] Figure 4 This is to detect the changes in leaf phenotypes and the expression levels of genes related to the metabolism of phenolic monoterpenoid pathways after SDR gene silencing. The control group was (TRV2-CHLH) and the experimental group was (TRV2-CHLH-SDR). DETAILED DESCRIPTION

[0030] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0031] The target gene used in the embodiment of the present invention is: Elsholtzia crusgalli short-chain dehydrogenase gene (SDR gene).

[0032] Example 1 A method for constructing a VIGS silencing system for identifying plant gene function, comprising the following steps:

[0033] (1) Using Elsholtzia cDNA as a template and CHLH-F1 and CHLH-R1 as primers, amplify the CHLH fragment; the CHLH fragment is SEQ ID NO.1.

[0034] CHLH-F1 primer: 5'-gtgagtaaggttaccgaattcTCGAATGCAAACGACTTTCGG-3';

[0035] CHLH-R1 primer: 5'-cgtgagctcggtaccggatccGGATGATTGGAGTTAGGCCAGTA-3';

[0036] PCR reaction, 10 μL reaction system: ddH2O (3.2 μL), CHLH-F1, CHLH-R1 (0.4 μL), 2×Rapid TaqMaster Mix (5 μL), cDNA (1 μL). Reaction procedure: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 1 min, 30 cycles, 72°C extension for 5 min, 4°C storage. The obtained CHLH fragment was inserted into the EcoR I and BamH I sites of the TRV2 plasmid by homologous recombination to form the TRV2-CHLH expression vector.

[0037] (2) The obtained CHLH fragment was inserted into the EcoR I and BamH I restriction sites of the tobacco rattle virus TRV2 vector to obtain the TRV2-CHLH vector, forming a TRV2-CHLH visualization vector, which was used as an indicator gene and as a control.

[0038] DNA seamless cloning technology reaction, 20μL system: TRV2 linearized plasmid (5.36μL), CHLH fragment (1.12μL), 2×ClonExpress Mix (10μL), ddH2O (3.52μL). Gently pipette to mix, centrifuge briefly, react at 50℃ in a dry thermostat for 20min, and immediately put on ice to stop the reaction to obtain the recombinant product.

[0039] (3) Construction of TRV2-CHLH-SDR vector (interference tracer vector)

[0040] Using Elsholtzia cDNA as a template, nucleotide sequences such as CHLH-F2, CHLH-R2 and SDR-F1, SDR-R1 as primers, PCR amplification was performed to obtain the target gene SDR, and the SDR fragment was the portion of SEQ ID NO. 2. The target gene SDR fragment to be traced was inserted into the EcoR I and BamH I restriction sites of the TRV2 vector to obtain the TRV2-CHLH-SDR vector, i.e., the interference tracer vector.

[0041] CHLH-F2 Primers:

[0042] 5'-gtgagtaaggttaccgaattcTCGAATGCAAACGACTTTCGG-3';

[0043] CHLH-R2 Primers:

[0044] 5'-ggccataatctcttcgttGGATGATTGGAGTTAGGCCAGTA-3';

[0045] SDR-F1 Primer:

[0046] 5'-ccAACGAAGAGATTATGGCCACTCA-3';

[0047] SDR-R1 Primer:

[0048] 5'-cgtgagctcggtaccggatccTTCGGTGGGGTCGCCACG-3';

[0049] PCR reaction, 10μ reaction system: ddH2O (3.2μL), CHLH-F2, CHLH-R2 (0.4μL), 2×Rapid TaqMaster Mix (5μL), cDNA (1μL). Reaction procedure: 95℃ pre-denaturation for 3min, 95℃ denaturation for 15s, 60℃ annealing for 15s, 72℃ extension for 1min, 30 cycles, 72℃ extension for 5min, 4℃ storage. The obtained CHLH and SDR fragments were inserted into the EcoR I and BamH I sites of the TRV2 plasmid by homologous recombination to form the TRV2-CHLH-SDR expression vector.

[0050] DNA seamless cloning technology reaction, 20μL system: TRV2 linearized plasmid (6.75μL), CHLH fragment (1.09μL), SDR fragment (1.16μL), 2×ClonExpress Mix (10μL), ddH2O (1μL). Gently blow to mix, centrifuge briefly, react at 50℃ in a dry thermostat for 20min, and immediately put on ice to stop the reaction to obtain the recombinant product.

[0051] (4) Transform the obtained TRV2-CHLH-SDR expression vector into Agrobacterium

[0052] Pick a single colony of Agrobacterium containing pTRV1, pTRV2, pTRV2-CHLH, and pTRV2-CHLH-SDR into 5 mL LB liquid medium (add 5 μL Kan and 5 μL Rif at the same time), and shake and culture at 28°C and 180 rpm / min overnight. Pipette 400 μL pTRV1, pTRV2, pTRV2-CHLH, and pTRV2-CHLH-SDR into 30 mL LB liquid medium (add 30 μL Kan and 30 μL Rif at the same time), and continue shaking and culture at 28°C and 200 rpm / min until OD600 = about 1.0.

[0053] (5) Infection of plants

[0054] Mix the resuspensions of pTRV1 and pTRV2-CHLH, and pTRV1 and pTRV2-CHLH-SDR in a ratio of 1:1, wrap in tin foil, add 20 μL 100 mmol / L AS, mix well, and let stand at 25°C for 2-3 hours. When the Elsholtzia jiangensis seedlings grow a pair of cotyledons, use the syringe infiltration method to complete the transformation of Elsholtzia jiangensis with the silencing vector mediated by Agrobacterium. Aim the 1 mL sterile syringe with the needle removed at the back of the cotyledon leaf of Elsholtzia jiangensis, push the infection solution into the leaf through the gap between the leaf veins until the entire leaf is infiltrated, and inject a pair of cotyledons for each seedling. The injected Elsholtzia jiangensis seedlings are first cultured in a dark environment at 25°C for about 24 hours, and then placed in a light incubator for continuous culture, such as Figure 2 .

[0055] The relative expression levels of terpene synthase gene TPS-38477, short-chain dehydrogenase gene SDR-27577, and plant cytochrome P450 gene (CYP-14738) related to the metabolism of phenolic monoterpene pathway were detected by qRT-PCR. The components of leaves of different groups of Elsholtzia jiangensis were extracted by tissue grinding, and the changes of main monoterpene components were detected by GC-MS.

[0056] TPS qPCR primers, CYP qPCR primers, SDR qPCR primers, and qPCR primers with Actin as the internal reference gene are as follows:

[0057] TPS upstream primer:

[0058] GTATGGCTCCAACATGAGGC;

[0059] TPS downstream primer:

[0060] CGGCTGATTGTCCGTTTTCC;

[0061] CYP upstream primers:

[0062] TCCCATCAGAAAGGACGAGC;

[0063] CYP downstream primers:

[0064] CAGCTTTGTCCTTGCACACC;

[0065] SDR upstream primer:

[0066] GACCATCAATTTCGGCGAGC;

[0067] SDR downstream primer:

[0068] CGTGGAAATGATGGAGCCAC;

[0069] Actin upstream primer:

[0070] GCTGACAGGATGAGCAAGGA;

[0071] Actin downstream primers:

[0072] CCGGATTCGTCGTACTCAGC;

[0073] The qPCR reaction system was 5 μL of 2×ChamQ Universal STBR qPCR Master Mix, 0.2 μL of upstream and downstream primers, 1 μL of cDNA, and 3.6 μL of RNase-free ddH2O. The reaction procedure was as follows: pre-denaturation: 95°C for 5 min; cycle reaction: 95°C for 10 s, 60°C for 30 s, 40 cycles, and melting curve analysis after amplification, the procedure was as follows: 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. The experimental data were analyzed by 2 -△△CT The relative expression of genes was analyzed by calculation method.

[0074] GC-MS conditions: A GC-MS system (Agilent 7890B-7000C) with an Agilent 19091S-433HP-5ms (30m×250μm×0.25μm) column was used to analyze the enzyme activity products. Gas phase conditions: carrier gas was He gas, constant flow mode was used, 1mL / min; injection volume was 1μL, no split; injection port temperature was 220℃; program temperature conditions: initial temperature was 50℃, maintained for 3min, increased to 90℃ at a rate of 3℃ / min, then increased to 150℃ at a rate of 5℃ / min, and then increased to 220℃ at a rate of 10℃ / min, maintained for 5min, and then operated at 220℃ for 5min. Mass spectrometry conditions: ionization mode: EI; ionization energy: 70eV; ion source temperature: 230℃; mass range: 50-500amu; acquisition frequency 50Hz.

[0075] like Figure 3 As shown in the figure, the results of qRT-PCR experiments show that compared with the negative control group, after the gene SDR-27577 was effectively silenced, the relative expression level of the TPS-38477 gene increased significantly, and the expression level of the gene CYP-14738 increased but not significantly, indicating that in the SDR-27577 gene silenced plants, the genes on the synthesis pathway were affected to a certain extent, and SDR-27577 was active in this synthesis pathway.

[0076] if Figure 4 As shown, the contents of γ-terpenes and p-cymene in the experimental group increased significantly, while the contents of thymol and carvacrol decreased significantly, indicating that after silencing the SDR-27577 gene in Elsholtzia jiangsu, although the expected substrate cyclohexadienol was not detected, its unstable product p-cymene accumulated to a certain extent, which also prevented the biosynthesis of the final products thymol and carvacrol, further proving the activity of SDR-27577 in this synthetic pathway.

[0077] This indicates that in the SDR-27577 gene silenced plants, the transcription process of these genes is affected to a certain extent, resulting in changes in mRNA abundance. Therefore, this tracing system can be widely used in the detection of target gene functions in Elsholtzia elata, and the target gene is not limited to SDR-27577.

[0078] The above description is only a preferred embodiment of the present invention, which is only illustrative and not restrictive of the present invention. Those skilled in the art understand that many changes, modifications, and even equivalents may be made to the present invention within the spirit and scope defined by the claims of the present invention, but all of them will fall within the scope of protection of the present invention.

Claims

1. A method for constructing a VIGS silencing system for plant gene function identification, characterized in that: The steps include: (1) Using cDNA of a plant of the genus C. serrata as a template and using nucleotide sequences such as CHLH-F1 and CHLH-R1 as primers, PCR amplification was performed to obtain a fragment of the key gene CHLH for chlorophyll synthesis, wherein the nucleotide sequence of the CHLH gene is shown in SEQ ID NO. 1; (2) inserting the amplified gene CHLH fragment into the EcoRI and BamHI sites of the TRV2 plasmid to form a TRV2-CHLH visualization vector; (3) Using the cDNA of the genus Astragalus as a template, using nucleotide sequences such as CHLH-F2, CHLH-R2 and SDR-F1, SDR-R1 as primers to amplify the target gene, and then inserting the target gene fragment to be traced into the EcoR I and BamH I restriction sites of the TRV2 vector to obtain the TRV2-CHLH-target gene expression vector, i.e., the interference tracer vector; (4) After the obtained TRV2-CHLH-target gene expression vector is transformed into Agrobacterium, the cotyledons of the target plant are injected and infected to construct a VIGS silencing system.

2. The method for constructing a VIGS silencing system for plant gene function identification according to claim 1, characterized in that: The plant of the genus Elsholtzia is Elsholtzia jiangnai.

3. The method for constructing a VIGS silencing system for plant gene function identification according to claim 2, characterized in that: The target gene includes but is not limited to any gene of the SDR gene of the genus Laetrile.

4. The method for constructing a VIGS silencing system for identifying plant gene function according to claim 3, characterized in that: The injection infection site is the back of the cotyledons of the plant seedlings.

5. An interference tracer carrier, characterized in that: The interference tracer vector is the TRV2-CHLH-target gene expression vector described in claim 1; The target gene is selected from any gene of the plant of the genus Lathyrus.

6. The interference tracer carrier according to claim 5, characterized in that: The target gene is the SDR gene, and the interference tracer vector is TRV2-CHLH-SDR.

7. The method for constructing the interference tracer vector according to claim 6, characterized in that: When the interference tracer vector is TRV2-CHLH-SDR, the construction steps are as follows: (1) Using Elsholtzia elata cDNA as a template, PCR amplification was performed using primers with nucleotide sequences such as CHLH-F1 and CHLH-R1 to obtain the target fragment CHLH; the nucleotide sequence of the CHLH gene is shown in SEQ ID NO.1; (2) inserting the amplified gene CHLH fragment into the EcoRI and BamHI sites of the TRV2 plasmid to form a TRV2-CHLH visualization vector; (3) Using Elsholtzia cDNA as a template and nucleotide sequences such as CHLH-F2, CHLH-R2 and SDR-F1, SDR-R1 as primers, PCR amplification is performed to obtain the target gene SDR, whose SDR nucleotide sequence is such as SEQ ID NO.

2. The target gene SDR fragment to be traced is inserted into the EcoR I and BamH I restriction sites of the TRV2 vector to obtain the TRV2-CHLH-SDR vector, i.e., the interference tracer vector.

8. Use of the interference tracer vector according to claim 7 in the construction of the Elsholtzia jiangsu VIGS silencing system, characterized in that: The Elsholtzia jiangsu VIGS silencing system is used for plant gene screening and function identification.

9. The application of CHLH tracer gene in the study of gene function in Elsholtzia jiangensis plants is characterized by: The CHLH tracer gene is the CHLH gene described in claim 1, the nucleotide sequence of the gene is shown in SEQ ID NO.1, and the CHLH tracer gene is used to indicate the range of gene silencing.

10. Use of the VIGS silencing system constructed by the method of any one of claims 1 to 4 in screening and identifying gene functions in plants.

Images