Preparation and application of reconstructed blastocyst based on trophoblast cell replacement

Abstract

A somatic cell nucleus transfer technology (SCNT) has already been used for cloning of macaca fascicularis, but the cloning efficiency is very low, and the cloning of other non-human primate species still needs to be realized. Histological examinations of the present inventors show severe calcification of the SCNT fetal placenta. Therefore, the inventor develops a trophoblast replacement (TR) method, and the placenta derived from the fertilized ova is endowed with the SCNT fetus, so that the cloning efficiency of the rhesus monkey is improved. The TR method is combined with epigenetic modification factor treatment to obtain the healthy somatic cell cloned rhesus monkey. Therefore, trophoblast substitution provides a useful method for rhesus monkey cloning.

Description

Technical Field

[0001] The present invention relates to the fields of biology and medicine, and more specifically to the preparation and application of a reconstructed blastocyst based on trophoblast cell replacement. Background Art

[0002] Somatic cell nuclear transfer (SCNT) technology has been widely used to clone mammalian species, including sheep (Wilmut et al., 1997), cattle (Kato et al., 1998), mice (Wakayama et al., 1998), pigs (Polejaeva et al., 2000), goats (Baguisi et al., 1999), rabbits (Chesné et al., 2002), and dogs (Lee et al., 2005). Recently, by optimizing the somatic cell nuclear transfer protocol and applying epigenetic regulatory factors (including histone demethylase Kdm4d and histone deacetylase inhibitor trichostatin A (TSA)), wild-type and gene-edited cynomolgus monkeys (Macaca fascicularis) were cloned using SCNT, with live birth rates of 1.5% and 2.5%, respectively (Liu et al., 2019b; Liu et al., 2018). However, this cloning efficiency was much lower than that of normal fertilized non-human primate (NHP) embryos (27.6%) previously reported by the present inventors (Sun et al., 2008).

[0003] Traditionally, almost all cloned mammalian species have shown extremely low birth rates, ranging from 1-3% in most species to 5-20% in cattle (Rodriguez-Osorio et al., 2012; Yang et al., 2007). Consistent with such low survival rates, embryonic developmental abnormalities, especially in extraembryonic lineages, have been reported in somatic cell cloned animals (Yang et al., 2007). The villous density and extravillous cytotrophoblast thickness of piglet SCNT placentas were much lower than those of artificially inseminated placentas (Ao et al., 2017). Fetal losses due to defects in placental group formation, volume density, and placental architecture have been observed in bovine and ovine SCNT embryos (Chavatte-Palmer et al., 2012; Fletcher et al., 2007). In mouse cloning, the spongiotrophoblast and labyrinth layer were abnormally distributed in enlarged SCNT placentas (Matoba et al., 2018; Ogura, 2020). Genetically, imprinted genes have been reported to be aberrantly expressed in placenta or trophoblast stem cells of cloned mice obtained by somatic cell nuclear transfer (Hirose et al., 2018; Kim et al., 2016; Matoba et al., 2018). Although pathological studies on cloned nonhuman primates are limited, a recent study reported that several internal organs were deficient in cloned rhesus monkeys due to uterine hypoxia (Kang et al., 2022).

[0004] On the other hand, embryo defects are also common in cloned animals. Excessive birth weight or old offspring syndrome has been observed in SCNT-derived cattle and mice (CLKeefer et al., 1994; JM Wilson et al., 1995; SMWilladsen et al., 1991; Wakayama et al., 2006; Yang et al., 2007). Other symptoms such as low birth weight, respiratory dysfunction, and abnormal organ development are also common abnormalities of SCNT fetuses (Ao et al., 2017; Yang et al., 2007). Interestingly, when combined with tetraploid complementation, the live birth rate obtained by mouse SCNT embryonic stem cells is much higher than that of SCNT embryos alone (20-30% vs. 1-2%), indicating that defects in the trophectoderm of cloned embryos are the main cause of embryonic development failure (Wakayama et al., 2006; Yang et al., 2007).

[0005] Previous studies have demonstrated the feasibility of obtaining live births using inner cell mass (ICM) or trophoblast exchange (TE) techniques (Loi et al., 2018), although this approach has failed to improve cloning efficiency in cattle (Murakami et al., 2006).

[0006] In summary, the field is currently in urgent need of methods and products that can significantly improve the success rate of cloned embryo development. Summary of the invention

[0007] The purpose of the present invention is to provide a method for preparing and applying a reconstructed blastocyst based on trophoblast cell replacement.

[0008] The first aspect of the present invention provides a method for preparing blastocyst stage embryonic trophoblast cells, comprising the following steps:

[0009] (a) providing a first embryo, wherein the first embryo is a non-human primate embryo in the blastocyst stage, and performing laser drilling on the zona pellucida of the first embryo, wherein the drilling position is the position of the inner cell mass (ICM) of the first embryo, thereby obtaining the first embryo processed by laser drilling;

[0010] (b) culturing the first embryo, wherein the inner cell mass of the first embryo is automatically discharged from the laser-punched position, thereby obtaining an empty blastocyst of the first embryo without the inner cell mass in the cavity;

[0011] (c) providing an inner cell mass separated from a second embryo, wherein the second embryo is a non-human primate embryo in the blastocyst stage, and introducing the inner cell mass separated from the second embryo into the empty blastocyst of the first embryo obtained in step (b) whose cavity does not contain the inner cell mass; wherein before, during, or after the introducing step, the inner cell mass of the first embryo is separated and removed from the empty blastocyst; thereby obtaining a reconstructed blastocyst;

[0012] In another preferred embodiment, all micromanipulations in all the steps are performed in a micromanipulation system with a heating stage.

[0013] In another preferred embodiment, the embryo is a non-human primate embryo.

[0014] In another preferred embodiment, the embryo is a living embryo.

[0015] In another preferred embodiment, in step (a), the first embryo is in the middle to late blastocyst stage.

[0016] In another preferred embodiment, in step (a), the second embryo is in the middle to late blastocyst stage.

[0017] In another preferred embodiment, in step (b), the obtained first embryo empty blastocyst without inner cell mass in the cavity may be the inner cell mass of the first embryo with outward discharge, or the inner cell mass of the first embryo with outward discharge has been separated and removed.

[0018] In another preferred embodiment, the method further comprises regenerating the reconstructed blastocyst into a non-human mammal.

[0019] In another preferred embodiment, the embryo is an embryo obtained by intracytoplasmic sperm injection into a mature oocyte.

[0020] In another preferred embodiment, the embryo is a cloned embryo obtained by nuclear transplantation into an oocyte.

[0021] In another preferred embodiment, the parameters of the laser in step (a) are Power: 100%, Pulse: 100-200 μs, and multiple holes may be punched at the punching position to ensure the rupture of the transparent band.

[0022] In another preferred embodiment, the time for continuing culturing in step (b) is 4 to 8 hours, more preferably, 5 to 7 hours, and most preferably, 6 hours.

[0023] In another preferred embodiment, the separation and acquisition of the inner cell mass of the second embryo in step (c) occurs 4 to 5 hours after the laser drilling in step (b) and 1 to 2 hours before the trophoblast cell replacement in step (c).

[0024] In another preferred embodiment, the separation and acquisition of the inner cell mass of the second embryo in step (c) is achieved by conventional immunosurgery.

[0025] In another preferred embodiment, the immunosurgery method includes antibody incubation for 0.5 hour and complement incubation for 0.5 hour, for a total of about 1 hour.

[0026] In another preferred embodiment, step (c) further comprises: after separating and obtaining the inner cell mass of the second embryo, washing the inner cell mass with fresh culture medium.

[0027] In another preferred embodiment, the step (c) of injecting the inner cell mass of the second embryo into the empty blastocyst of the first embryo without the inner cell mass in the cavity obtained in step (b) comprises the steps of:

[0028] (c1) placing the inner cell mass of the second embryo and the empty blastocyst of the first embryo without the inner cell mass in the cavity obtained in step (b) on a micromanipulation table;

[0029] (c2) Using an egg holding needle with a diameter of about 120 μm, fix the first embryo empty blastocyst without inner cell mass in the cavity obtained in step (b) under the visual field on the left side, and adjust its direction to avoid, as far as possible, making the inner cell mass of the first embryo that is hatched and still adhered to the outside of the first embryo empty blastocyst without inner cell mass in the cavity obtained in step (b) face the right side of the visual field;

[0030] (c3) on the right, use an oblique injection needle with a diameter of about 45 μm to aspirate the inner cell mass of the second embryo (repeatedly blow and aspirate to remove lysed trophoblast cells);

[0031] (c4) adjusting the laser parameters to Power: 100%, Pulse: 800-1000 μs; using a high-intensity laser to create a ruptured hole in the zona pellucida and trophectoderm of the first embryo empty blastocyst without inner cell mass in the cavity obtained in step (b) under the visual field, and then quickly injecting the inner cell mass of the second embryo in the right injection needle into the first embryo empty blastocyst without inner cell mass in the cavity obtained in step (b) fixed by the egg holding needle on the left;

[0032] (c5) After completing the injection in (c4), the oblique injection needle on the right is replaced with a flat injection needle with a diameter of 20-30 μm, and it is tightly adsorbed on the zona pellucida of the empty blastocyst of the first embryo without inner cell mass in the cavity obtained in step (b) in which the inner cell mass of the second embryo is injected; then the egg holding needle on the left is tightly adsorbed on the inner cell mass of the first embryo that is ejected from the small hole on the zona pellucida of the first embryo in step (b) by itself, and while pulling the empty blastocyst of the first embryo without inner cell mass in the cavity obtained in step (b) in which the inner cell mass of the second embryo is injected left and right, the inner cell mass of the first embryo is removed from the reconstructed embryo with a high-intensity laser; the reconstructed blastocyst after complete trophectoderm replacement can be obtained.

[0033] In another preferred embodiment, the order of steps (c4) and (c5) can be interchanged.

[0034] In another preferred embodiment, the method is non-diagnostic.

[0035] In another preferred embodiment, the method is non-therapeutic.

[0036] The second aspect of the present invention provides a reconstructed blastocyst, wherein the reconstructed blastocyst is prepared by the method described in the first aspect of the present invention.

[0037] In another preferred embodiment, the inner cell mass of the reconstructed blastocyst comes from the second embryo, and the other parts come from the first embryo.

[0038] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 To demonstrate live births of cloned rhesus macaques via trophoblast replacement

[0040] (A) Alizarin red-stained cross-sections of ICSI and SCNT placentas. ICSI-f, term ICSI placenta. SCNT-f, term SCNT placenta. SCNT-a, aborted SCNT placenta. High-resolution image (right) was extracted from the blue box (3.1 mm x 3.1 mm) in the overview image (left). Calcification areas are outlined and marked in the high-resolution image. Scale bar for overview images, 1 mm. Scale bar for high-magnification images, 200 μm. Fetal-maternal direction is indicated. Image background was adjusted using ImageJ with Light background.

[0041] (B) Schematic diagram of the trophoblast replacement method.

[0042] (C) Ultrasound of a reconstructed rhesus SCNT fetus at 60 days of gestation.

[0043] (D) SCNT-TR image of a 17-month-old rhesus monkey.

[0044] (E) Representation of the STR loci of cloned rhesus monkeys.

[0045] (F) Three representative SNP alleles showing the mtDNA origin of cloned rhesus macaques.

[0046] (G) A representative X chromosome SNP (SNP1) in cloned monkeys, donor cell lines, oocyte donors, sperm donors, and rhesus monkey TR placentas.

[0047] (H) Locus-specific deep sequencing of one of the two X-chromosome SNPs (SNP1) using peripheral blood, skin, and ear tissues from cloned rhesus macaques. More than 10,000 reads were obtained for each sample. Yellow arrows indicate the SNP loci.

[0048] (I) Serial cross-sections of a cloned rhesus monkey placenta. High-resolution images (right) were extracted from the blue box (3.1 mm x 3.1 mm) in the overview image (left). Calcified areas are outlined and labeled in the high-resolution image. Scale bar for overview images, 1 mm. Scale bar for high-magnification images, 200 μm. Fetal-maternal orientation is indicated. Image background was adjusted using ImageJ with Light background.

[0049] Figure 2 To show the morphological defects and correction of monkey SCNT placenta

[0050] (A) Ultrasound images of late ICSI (day 145) and SCNT (day 130) placentas. The yellow dashed line indicates the thickness of the placenta.

[0051] (B) Ultrasound-induced placental thickness in ICSI (n=5) and SCNT (n=5).

[0052] (C) Thickness of each ICSI-F (n=4), SCNT-F (n=5), SCNT-A (n=3), and SCNT-TR (n=1) placenta using serial placental sections. Each point in the mean±SEM graph represents one thin section of the corresponding placenta.

[0053] (D) Calcification index (CCI, percentage of calcified area) of ICSI-F (n=4), SCNT-F (n=5), SCNT-A (n=4), and SCNT-TR (n=1) placentas. Each point in the mean±SEM graph represents a thin section of the corresponding placenta.

[0054] (E) Average calcification point / cloud number (CCN) of ICSI-F (n=4), SCNT-F (n=5), SCNT-A (n=4), and SCNT-TR (n=1) placentas. Each point in the mean±SEM graph represents a thin section of the corresponding placenta.

[0055] Figure 3 To show the pre-implantation and post-implantation development of monkey 2-cell electrofusion embryos

[0056] (A) A, 2-cell embryo. b, Electrofused 2-cell embryo, each embryo has one blastomere. c, Electrofused embryo at blastocyst stage. d, Blastocyst of normal ICSI embryo without electrofusion. Scale bar, 100 μm.

[0057] (B) Ultrasound image of a 2-cell fusion embryo on day 26 after implantation.

[0058] (C) Image of one of the two monkeys derived from two-cell fusion embryos.

[0059] (D) Karyotype analysis of two monkeys derived from viable 2-cell fusion embryos. Scale bar, 20 μm.

[0060] Figure 4 To show SCNT-TR chimerism in rhesus monkeys

[0061] (A) Images showing the trophoblast replacement process. a, ICSI blastocyst with expanded blastocoel. ICM hatched in one of the blastocysts (red arrow). b, ICSI blastocoel with removal of ICMs. c, Immunosurgery to obtain one SCNT-ICM. d, Three reconstructed SCNT-TR embryos (red arrows). Scale bars in a and b are 100 μm. Scale bars in c and d are 50 μm.

[0062] (B) A representative X chromosome SNP (SNP1) in cloned monkeys, donor cell lines, oocyte donors, sperm donors, and rhesus monkey TR placentas.

[0063] (C) Locus-specific deep sequencing of one of the two X-chromosome SNPs (SNP1) was performed using peripheral blood, skin, and ear tissues from cloned rhesus macaques. More than 10,000 reads were obtained for each sample. Yellow arrows indicate the SNP loci.

[0064] (D) X chromosome SNPs of cloned monkeys, donor cell lines, oocyte donors, sperm donors, and rhesus monkey TR placentas. The double peaks (C / T) in the placenta indicate that its X chromosome comes from the egg donor and sperm donor.

[0065] Figure 5 To show the gestational sac with or without a fetus

[0066] (A) Ultrasound of a gestational sac (day 28) without a fetus. This sac was created by transferring the blastocyst cavity removed by ICSI-ICM into the uterus of a surrogate mother.

[0067] (B) Ultrasound of a gestational sac carrying a fetus (28 days). This pregnancy is the result of transferring an intact, unmanipulated ICSI embryo into the uterus of a surrogate mother. DETAILED DESCRIPTION

[0068] After extensive and in-depth research, the inventors unexpectedly discovered for the first time a method for preparing and applying a reconstructed blastocyst based on trophoblast cell replacement.

[0069] Specifically, the inventors optimized the trophoblast exchange (TE) method and established a trophoblast replacement (TR) method, in which SCNT-derived ICMs were injected into the blastocoel of non-human primate embryos from which intracytoplasmic sperm injection (ICSI) sources and ICMs were previously removed, called the SCNT-TR method (somatic cell nuclear transfer embryo trophoblast replacement).

[0070] The inventors explored the feasibility of improving the cloning efficiency of rhesus macaques (Macaca Mulatta) by using SCNT-TR and treating the epigenetic regulatory factors Kdm4d and TSA. During the preparation of this study for publication, the inventors obtained a healthy live birth and cloned rhesus macaque that has survived for more than 2 years. Site-specific deep sequencing of the ectoderm and mesoderm derivatives of this SCNT-TR monkey showed that there was no chimerism in the trophoblast donor embryo.

[0071] The use of the method of the present invention to construct a reconstructed blastocyst can significantly improve the development success rate of cloned embryos. On this basis, the present invention was completed.

[0072] the term

[0073] As used herein, the terms "somatic cell nuclear transfer (SCNT)" and "somatic cell cloning" are used interchangeably and refer to a technique in which a terminally differentiated somatic cell nucleus is injected into an enucleated oocyte to form a recombinant embryo that ultimately develops into an individual.

[0074] Trophoblast cells (TE) refer to a circle of cells in the blastocyst cavity formed by the continuous division and differentiation of the peripheral blastomeres along the zona pellucida after the mammalian embryo develops to the morula stage. They will mainly develop into the placenta in the future.

[0075] The inner cell mass (ICM) refers to a group of totipotent cells in the inner layer of the mammalian embryo after it develops to the morula, which develops into the main body of the embryo (including various organs, trunk, skin, reproductive system, nervous system, etc.) as the embryo develops.

[0076] The main advantages of the present invention include:

[0077] (a) Compared with previous reports, this technique more completely preserves the original structure and morphology of the blastocyst, including the trophoblast cells and zona pellucida, and can minimize the impact of the operation itself on the subsequent development of the reconstructed embryo;

[0078] (b) This technology was established in primate embryos for the first time;

[0079] (c) This technology can replace the diseased placenta with a normal placenta, thereby ensuring the healthy development of the fetus in the middle and late stages of pregnancy.

[0080] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0081] Materials and Methods

[0082] Experimental methods

[0083] ethics

[0084] The monkeys used in this study were obtained from the Nonhuman Primate Facility of Shanghai Center for Excellence in Brain Science and Intelligence Technology, China. All animal operations followed the guidelines of the Animal Use and Care Committee of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Institute of Neuroscience, Center for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences. The project approved by the committee was "Study on the Construction of Macaque Animal Model by Somatic Cell Nuclear Transfer" (ION-2018002R01).

[0085] Method details

[0086] Construction of linearized donor

[0087] Constructing mice

[0088] Tild homologous templates of Actb / Dppa5 / Cfl1 / H3.3b / Cdx2 / H2afZ / Cdk4 / Lmna / Dppa3 / Gata6 / Tubb5 genes and monkey Cdx2 / H3.3b genes. The inventors take the mouse Actb gene as an example to develop a detailed description. The Tild homologous template of the Actb gene (transgenic DNA clamped by homologous arms of different lengths) was obtained by PCR amplification. The template used for PCR contains the Actb-HR-vector of (~800bp)HAL-p2A-mCherry-(~800)HAR. Afterwards, the PCR product was purified using a PCR extraction kit (Magen, D2121-03).

[0089] Construction of mouse Calcr / Lyypd1 gene Tild homology template. The inventors take mouse Calcr gene as an example to describe in detail. The Calcr-HR template vector containing (~800 bp) HAL-P2A-Cre-(~800) Har was amplified by PCR, and the PCR product was purified as described above.

[0090] Construct the Tild donor of mouse Mllt3 gene.

[0091] The Mllt3-HR template vector of HAL-LoxP-exon3-LoxP-(~800)HAR was amplified by PCR, and the PCR product was purified as described above.

[0092] Superovulation and oocyte collection

[0093] The procedures for superovulation and oocyte collection followed those reported previously (Liu et al., 2019b; Liu et al., 2018). Briefly, after priming with human follitropin and chorionic gonadotropin, oocytes were aspirated into prewarmed HEPES-buffered Tyrode's lactate medium (TH3) containing heparin and cultured in pre-equilibrated 1066 medium for further in vitro maturation (Zheng, 2007; Zheng et al., 2003).

[0094] Isolation and culture of primary primate fibroblasts

[0095] The preparation process of primary fibroblasts as donor cells was as described previously (Liu et al., 2019b; Liu et al., 2018). Briefly, the skin tissue of aborted rhesus monkey fetus at 62 days was cut into small pieces with sterile scissors and then digested in DMEM containing DNase (1 mg / ml), type IV collagenase (0.5 mg / ml), 100 iu / ml penicillin, streptomycin, 10% FBS, 1% non-essential amino acids and 1% glutamine for 4 hours. The isolated fibroblasts proliferated for 10 to 20 hours at 37 ° C and 5% CO2 until they were fused in the culture dish. The cultured fibroblasts were placed in a medium containing 10% dimethyl sulfoxide and 90% fetal bovine serum and frozen for later use. The thawed fibroblasts were further cultured for several days before nuclear transplantation.

[0096] For the culture of monkey fibroblasts derived from electrofused embryos, the skin was removed, rinsed three times with PBS containing 1% penicillin-streptomycin, cut into small pieces and implanted in a culture dish. 1 ml of fibroblast culture medium was added to a 6 cm culture dish and then implanted into the skin tissue. After implantation, the culture dish was placed at 37°C, 5% CO2, 1 ml of culture medium was added every other day, and the fibroblasts were observed (about 1 week). Passaging and cryopreservation were as described above.

[0097] Monkey somatic cell nuclear transfer and intrasperm injection

[0098] The procedures for monkey SCNT and ICSI followed those reported previously (Liu et al., 2019b; Liu et al., 2018). Briefly, metaphase II-arrested oocytes were selected for SCNT and ICSI. SCNT was placed in TH3 medium containing 5 mg / ml cytochalasin B (CB) for 10-20 mii in a glass-bottomed culture dish. The spindle-chromosome complex of the oocyte was removed, and donor fibroblasts treated with HVJ-E virus were injected into the follicle surrounding the enucleated oocyte. 1-2 h after fibroblast-oocyte fusion, the generated SCNT embryos were activated with ionomycin and 6-dimethylaminopurine, injected with human Kdm4d 5-6 h after activation, and treated with trichostatin A 10 h after activation. For ICSI, a single sperm was injected into the cytoplasm of the MII oocyte, and two pronuclei appeared about 6 h later, confirming the fertilization of the oocyte. During trophoblast replacement, ICSI and SCNT are performed on the same oocytes collected on the same day to synchronize the development of the two embryos.

[0099] Electrofusion of two-cell monkey embryos

[0100] The protocol for the creation of monkey tetraploid embryos was performed as described previously (Andras Nagy et al., 2006). 2-cell stage monkey ICSI embryos were washed three times with preheated TH3 and then washed three times with 0.3 mol / L d-mannitol (Sigma, M4125). The embryos were placed in d-mannitol and cell fusion was induced by electric pulses (30 V, 40 s, 2 times) using the Eppendorf Multiporator 4308 electroporation system. Then, the embryos were incubated at 37°C for 2 hours in 5% CO2 to allow cell fusion.

[0101] To detect nuclear fusion, H2B-EGFP (Addgene, 53744) mRNA was injected into 1-cell embryos and waited for the embryos to express at the 2-cell stage. After electrofusion, the first mitosis and the first cell division of the embryos were observed under a confocal imaging system (FV10i, Olympus).

[0102] Karyotype analysis of fetal monkey fibroblasts from electrofused embryos

[0103] Karyotype analysis was performed as described above with slight modifications (Liu et al., 2019b). Fibroblasts were first treated with Colcemid (100 ng / ml, APExBio, A3342) for 12 h, and then washed and dissociated with 0.25% trypsin-EDTA. The cells were treated with preheated hypotonic solution at 37 °C for 30 min. 2-3 ml of precooled fixative was gently added to the mixture of cells and hypotonic solution, and the cells were precooled and fixed at room temperature for 10 min. After centrifugation and resuspension, the cells were fixed three times with fresh precooled fixative. The cells were placed on a slide and stained with Giemsa (Sigma, GS500). The slides were observed and visualized with VS120 (Olympus).

[0104] Trophoblast replacement

[0105] First, a small incision was made on the zona pellucida at the polar side of the ICSI blastocyst using laser ablation technology. After about 6 hours of culture, the ICSI-ICM specifically hatched out of the zona pellucida through the slit, while the blastocyst cavity remained expanded. About 5 hours after laser ablation of the ICSI blastocyst, SCNT-ICM was obtained by immunosurgery. Then, the separated SCNT-ICM was immediately injected into the ICSI blastocyst cavity, forming another slit. Finally, the hatched endogenous ICSI-ICM was removed by laser irradiation. Usually, the ratio of SCNT-ICM to ICSI trophoblast cavity is 1 / 1, but in some cases, 2 to 3 SCNT-ICM are injected into one cavity. It is worth noting that the cloned monkeys in this study were the result of 1 injection.

[0106] Immunoprocedure was performed as described previously with minor modifications (Tachibana et al., 2012). Briefly, the zona pellucida of SCNT blastocysts was dissolved with preheated acid Tyrode's solution (Sigma, T1788) and then washed three times with H9 medium. The blastocysts were incubated in rabbit anti-monkey IgG whole serum (Bioss, bs-0335Rs) for 30 min, washed three times in H9 medium, and then transferred to guinea pig complement serum (Fitzgerald, 32R-CP004) for 30 min. Intact SCNT-ICMs were isolated by gently pipetting in TH3 medium using a beveled pipette with a diameter of approximately 50 μm. SCNT-ICMs were injected into the ICSI blastocoel and isolated immediately.

[0107] Monkey embryo culture and embryo transplantation

[0108] Monkey embryos were cultured in serum-free H9 medium at 37°C, 5% CO2 until the 8-cell stage (day 3 after fertilization), and then transferred to H9 medium containing 5% embryonic stem cell grade FBS (ES-FBS). The medium was changed every two days until the embryos entered the blastocyst stage.

[0109] Within 2 hours of reconstruction, the reconstructed embryos were transferred into the surrogate oviduct with fresh stigma visible on the ovary.

[0110] STR analysis

[0111] Ear tissues of cloned rhesus macaques, fibroblasts from donors, and peripheral blood samples from oocyte donors, sperm donors, and surrogate mothers were collected for short tandem repeat analysis. PCR amplification was performed in batches using site-specific primers (FAM / HEX / TMR) each containing a fluorescent dye. FAM-, HEX-, or TMR-labeled STR amplicons were diluted and mixed with internal standard ROX500 and deionized formamide, and then subjected to capillary electrophoresis on an ABIPRISM 3730 genetic analyzer to obtain raw data. The raw data generated by the sequencer were analyzed using the Gene Marker 2.2.0 program, which generates wave plots, Excel documents (including information such as size and genotype), and DNA maps.

[0112] mtDNA testing

[0113] Total genomic DNA was extracted from ear tissue or blood samples of cloned monkeys, surrogate mothers, sperm donors, egg donors, and DNA from donor cells using a genomic DNA extraction kit according to the manufacturer's instructions (Tiangen, DP304-03). Thirteen pairs of primers were used to amplify the full sequence of mtDNA and identify the SNPs in the samples.

[0114] (278F: catgcagttgttgatcgcaccta (SEQ ID NO. 1);

[0115] 278R:ggtttggcaagagtgggtt (SEQ ID NO. 2);

[0116] 4061f: acaaccacaatcttcctaggcaca (SEQ ID NO.3);

[0117] 4061r:ggggaatgctggagaattgcg (SEQ ID NO.4);

[0118] 4591f:cctgagaatccaaacttctccgtg (SEQ ID NO.5);

[0119] 4591r:agcatcctgatagtaggttgttgg(SEQ ID NO.6);

[0120] 5803f:ctgcaaacacctactctgcatcaa(SEQ ID NO.7);

[0121] 5803r:ggctcagggcagtgcctatga(SEQ ID NO.8);

[0122] 6040f:tcataggcactgccctgagcc(SEQ ID NO.9);

[0123] 6040r:gcggctaggactggtagagag(SEQ ID NO.10);

[0124] 6988f:ataatcattgcaatccccaccggt(SEQ ID NO.11);

[0125] 6988r:gatggtgaaggatgggtcgttg(SEQ ID NO.12);

[0126] 8680f:acccctttctcaaccccaacaatc(SEQ ID NO.13);

[0127] 8680r:tggtaggaggtgggctagggag(SEQ ID NO.14);

[0128] 9543f:catagttaaacccagtccctggcc(SEQ ID NO.15);

[0129] 9543r:tcggagatggtgaagggtgcttc(SEQ ID NO.16);

[0130] 10051f:accacaggcttccacggac(SEQ ID NO.17);

[0131] 10051r:gggaggtttgttgtttgaatggct(SEQ ID NO.18);

[0132] 11530f:gagaccactctcattcctacct(SEQ ID NO.19);

[0133] 11530r:tgttttctcgtgtgaagggggg(SEQ ID NO.20);

[0134] 13628f:cccttcctcacaggcttctactcc (SEQ ID NO. 21);

[0135] 13628r:gttagtggtgtggttggttgtgtg(SEQ ID NO.22);

[0136] 15129f:ggactccaaccataactaacggca (SEQ ID NO. 23);

[0137] 15129r:gctgtcaatggcgtatcctcctc(SEQ ID NO.24);

[0138] 16038f: cactatcggccaagtagcatccat (SEQ ID NO. 25);

[0139] 16038r:gcatccgtggtgaggaggattat (SEQ ID NO. 26)).

[0140] DNA amplification was performed for 35 cycles, 95°C for 30 s, 57°C for 30 s, 72°C for 1-1.5 min, and 72°C for 5 min. PCR products were sequenced and the results were used for SNP analysis.

[0141] Fetal monkey chimerism detection

[0142] Chimerism was checked as described previously (Liu et al., 2019a). The genomes of cloned monkeys, donor cells, oocyte donors for ICSI and SCNT, placentas, sperm donors, and surrogates were first amplified and sequenced for SNP detection. After SNP detection, the genome was amplified with site-specific deep sequencing primers (with barcoded primers added). PCR products were purified using the Monarch PCR & DNA Cleanup Kit (New England Biolabs), and data analysis was performed using the Hi-TOM platform with a filtering threshold of 1% and more than 10,000 reads per sample (China National Rice Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou).

[0143] The primers for detecting cloned live rhesus monkey SNPs are:

[0144] X9-F,TGGTTTCCTGAGATTACCGCAA(SEQ ID NO.27);

[0145] X9-R TTATGGTGCCCCCATCAGTTAC (SEQ ID NO. 28);

[0146] X15-F GGTCCATCTGTGTCCTTGAACT(SEQ ID NO.29);

[0147] X15-RATTTGCAGCGAGGAAAGACAAC (SEQ ID NO. 30).

[0148] The primers for deep sequencing of cloned SNPs in living rhesus monkeys are as follows:

[0149] deepseq-X9-F,ggagtgagtacggtgtgcGTCACCCTTGCCATTTTGTTCC(SEQ ID NO.31);

[0150] deepseq-X9-R gagttggatgctggatggAGTTTAATGCTGACTCTGCTGG (SEQ ID NO.32);

[0151] deepseq-X15-F ggagtgagtacggtgtgcCATGGAATTCAATACACCCCAATG(SEQ IDNO.33);

[0152] deepseq-X15-R gagttggatgctggatggATTTGCAGCGAGGAAAGACAAC (SEQ ID NO. 34).

[0153] In vitro transcription of Kdm4d

[0154] The CDS of human Kdm4d gene was cloned from the cDNA plasmid provided by Dr. Han Jianhua of Xiamen University, and the Kdm4d gene was transcribed in vitro. The T7 promoter (F:

[0155] TTAATACGACTCACTATAGGGATGGAAACTATGAAGTCTAAGGCCAACT(SEQ ID NO.35)

[0156] R: ATATAAAGACAGCCCGTGGACTTAGG (SEQ ID NO. 36). The T7-kdm4d PCR product was purified and used as an in vitro transcription template using the mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies, AM1345). The RNA product was purified using the MEGA kit (Life Technologies, AM1908) and eluted with RNase-free water.

[0157] Alizarin red staining

[0158] The whole placenta was fixed in 4% paraformaldehyde for 1 month and then sectioned. Because the placenta is usually very large and difficult to section completely, the placenta was diced and the tissue was embedded in pre-melted paraffin. After 3 paraffin baths, the tissue was placed in a paraffin block mold. After cooling, the tissue was cut into 5μm thick slices, floated on clean water at room temperature, and stretched in a 45°C water bath. The slices were gently placed on a glass slide, dried for 1 to 2 hours, and then placed in an oven at 60°C for 30 minutes to melt the wax. The resulting slides were dewaxed in xylene, the ethanol concentration gradient was reduced (100%, 90%, 80%, 70%), and AR staining was performed after gently rinsing with water.

[0159] Alizarin red staining was performed according to the manufacturer's instructions (Servicebio, G1038). Briefly, slides were incubated in alizarin red solution for 5 min and then washed three times. After drying at 60 °C for 4 h, slides were incubated in xylene to clear and finally mounted with synthetic resin. Slides were dried at room temperature for 3 days and then imaged under bright field using VS120 (Olympus).

[0160] Morphometry of placental calcification

[0161] Calcification was observed using Alizarin red staining. The calcification area and total area of ​​each placenta were obtained by ImageJ. Each slide was restored to 8-bit color mode, and then the "Yellow" and "Yen" methods were selected to analyze the particles, respectively, to obtain the total area and calcification area. It is worth noting that particles with a size less than 0.0003 mm2 were filtered out, and all slides were analyzed using default parameters. Particle analysis uses the color difference between the calcification area and the surrounding area and is not affected by the particle threshold.

[0162] The calculation formula of calcification index (CCI) is:

[0163]

[0164] The average calcification number (CCN) is calculated as:

[0165]

[0166] ImageJ was used to measure the average thickness of each placenta. Briefly, the thickness of each slide was measured and the average thickness of each placenta was calculated as:

[0167]

[0168] Example 1: Morphological examination of monkey SCNT placenta

[0169] Abnormal placental development has been reported in many mammalian cloning studies (Ao et al., 2017; Chavatt-Palmer et al., 2012; Lin et al., 2011; Yang et al., 2007). The inventors' ultrasound examination showed that the placenta of monkey SCNT placenta was much thicker than that of comparison ICSI placenta ( Figure 2 A and 1B). Abnormal deposition of calcium salts was also observed in cloned placentas. Using Alizarin Red (AR) staining, the inventors found that the placentas of late-term aborted SCNT (SCNT-a, more than 120 days, Table 2) fetuses did show heavier calcification levels than full-term ICSI (ICSI-f) and SCNT (SCNT-f) placentas ( Figure 1 The calcification index per placenta (CCI, percentage area showing calcification, see Methods) of SCNT-A placentas was 3.050.82% (mean SEM, n = 4,737 sections / placenta), while the calcification index of placentas from ICSI-F and SCNT-F fetuses was 1.130.45% and 0.490.07%, respectively ( Figure 2 D, Table 2). The inventors then counted the calcification points / clouds of each placenta. The higher the average number of calcification points per mm2 of cloned placenta (CCN, see Methods), the higher the inventors' observations ( Figure 2 E and Table 2).

[0170] In addition, the present inventors also found that the average thickness of SCNT-A (n=3) and SCNT-F (n=5) placentas was more than 1.5 times that of IF placentas (n=4). Figure 1 A and 2C, Table 2). However, whether this hyperplasia impedes embryonic development is unclear, because live births of full-term fetuses following SCNT are unknown.

[0171] Table 2 Statistics of placenta samples used in this study

[0172]

[0173] *The data was not available due to the improper sample preparation.

[0174] Example 2 Full-term development of two-cell fusion monkey embryos

[0175] In mice, tetraploid complementation has been shown to be an effective method to correct placental defects and promote the full-term live birth rate of SCNT embryos. The generation of tetraploid embryos has also been seen in domestic animals such as rabbits, cattle, and pigs (Ozil and Modlinski, 1986; Prochazka et al., 2004; S. Iwasaki et al., 1989; Wang and Song, 2016). However, whether tetraploid complementation can improve the efficiency of monkey SCNT remains to be answered.

[0176] Here, the inventors used an electrofusion method similar to the creation of mouse tetraploids to study the developmental potential of monkey tetraploid embryos before and after implantation. Before implantation, the final ICMs ( Figure 3 A). 49 2-cell fused monkey embryos were transplanted into the uterus of 16 surrogate mothers, of which 8 were confirmed to be pregnant, with 16 implantation sites (Table 3). Among the implanted embryos, 8 were confirmed to carry fetuses ( Figure 3 B), while the others were just gestational sacs. Finally, 3 of the 8 fetuses were born alive, and 2 were born alive ( Figure 3 C and Table 3). Karyotype analysis of these monkeys showed normal chromosome numbers ( Figure 3 D).

[0177] The mechanism of this controlled ploidy stability in non-human primates needs further investigation, and long-term imaging systems will help further research.

[0178] Table 3 Post-implantation development of monkey hypothetical tetraploid embryos

[0179]

[0180] ＊ Data were calculated based on embryos transferred.

[0181] Example 3: Trophoblast replacement (TR) method for cloning rhesus monkeys

[0182] Next, the inventors developed a trophoblast replacement method to replace the trophoblasts of SCNT embryos with the trophoblasts of ICSI embryos ( Figure 1 B). The inner cell mass (ICM) of the SCNT blastocyst was obtained by immunosurgery to remove its trophoblast and injected into the ICSI blastocyst. The ICM was removed by micromanipulation immediately after the introduction of the SCNT-ICM ( Figure 1 A and 4A, Figure 2 ).

[0183] Detailed steps:

[0184] (i) taking oocytes from different egg donors and performing sperm injection and somatic cell nuclear transfer on them simultaneously;

[0185] (ii) In vitro culture of sperm injection embryos and somatic cell nuclear transfer embryos: the day of oocyte retrieval is considered as day 1, and the in vitro culture lasts until day 7;

[0186] (iii) At about 9:00 a.m. on the 7th day, the zona pellucida of the sperm injection embryos that have developed to the blastocyst stage is laser-punched. The laser parameters are Power: 100%, Pulse: 100-200 μs. Multiple punches can be made at the same location to ensure that the zona pellucida is ruptured. The punched zona pellucida should be located at the location of the inner cell mass to ensure that the inner cell mass can be successfully hatched out of the small hole. After the zona pellucida is punched, the embryos are re-placed in the culture medium for culture. After about 6 hours, the inner cell mass can be seen hatching out of the small hole on the zona pellucida, while the entire blastocyst cavity remains in a well-developed state.

[0187] (iv) about 1.5 hours before trophectoderm replacement (about 4.5 hours after embryo punching for sperm injection), immunosurgery is performed on somatic cell nuclear transfer embryos that have developed to the blastocyst stage to obtain the inner cell mass; immunosurgery is a commonly used method for obtaining the inner cell mass, including antibody incubation for 0.5 hours, complement incubation for 0.5 hours, a total of about 1 hour, and finally washing several times in fresh culture medium;

[0188] (v) At about 15:00 in the afternoon of the same day, after obtaining the inner cell mass of the somatic cell nuclear transfer embryo (hereinafter referred to as the nuclear transfer inner cell mass), it was placed together with the embryo obtained in (iii) on the microscope operation table; under the field of view, the blastocyst stage single sperm cytoplasmic injection embryo was fixed under the field of view on the left side with an egg holding needle with a diameter of about 120 μm, and the direction of the embryo was adjusted to avoid the hatched inner cell mass facing the right side of the field of view as much as possible; on the right side, the nuclear transfer inner cell mass was sucked out with an oblique injection needle with a diameter of about 45 μm (it can be repeatedly blown and sucked to remove the lysed trophoblast cells);

[0189] (vi) Adjust the laser parameters to Power: 100%, Pulse: 800-1000 μs; use a high-intensity laser to create a ruptured hole in the zona pellucida and trophectoderm of the sperm cytoplasmic injected embryo at the blastocyst stage under the visual field, and then quickly inject the nuclear transplanted inner cell mass in the right injection needle into the blastocyst cavity fixed by the egg holding needle on the left side;

[0190] (vii) After completing the injection in (vi), replace the oblique injection needle on the right with a flat injection needle with a diameter of 20-30 μm, and firmly attach it to the zona pellucida of the blastocyst cavity injected with the nuclear transplanted inner cell mass; then, firmly attach the egg-holding needle on the left to the inner cell mass incubated from the small hole on the zona pellucida in (iii), and remove the inner cell mass of the sperm cytoplasmic injection embryo from the reconstructed embryo with a high-intensity laser while pulling the reconstructed embryo left and right; finally, a reconstructed embryo with intact trophectoderm replacement can be obtained.

[0191] (viii) All the above micromanipulations need to be performed in a micromanipulation system with a heating stage.

[0192] Somatic cell cloning of rhesus macaques is an important NHP species that is widely used in basic and clinical research (Banks and Negus, 2017; Chang and Platt, 2014; Kang et al., 2022; Meng et al., 1997; Sparman et al., 2010), but has not yet been achieved. The present inventors have been trying rhesus macaque SCNT for more than 2 years, using a previously reported cynomolgus rat cloning protocol (Liu et al., 2019b; Liu et al., 2018). After a total of 484 SCNT embryos were transplanted into the fallopian tubes of surrogate mothers, only one live fetus was obtained (0.2% or 1 / 484 live birth rate), which is lower than the previous report of Kang et al. (1 / 154) (Kang et al., 2022). The only cloned rhesus macaque in the present inventors' study survived no more than 23 hours (Table 1).

[0193] Through the combination of Kdm4d, TSA and TR, the inventors explored the potential of TR in improving the live birth rate of cloned monkeys. The inventors transplanted 11 reconstructed embryos from 113 activated rhesus SCNT embryos from 7 surrogates (Table 1). Ultrasound examination showed that two surrogate pregnancies ( Figure 1 C and Table 1), one of which was carrying twins. The twins were aborted on gestational day 106, and no obvious fetal tissue was collected, while a male singleton was born healthy on gestational day 157 ( Figure 1 D and Table 1). The genomic origin was determined by short tandem repeat analysis. The nuclear genome of the cloned monkey was identical to that of the fibroblast cell line at all 29 loci ( Figure 1 E and Table 4). The mitochondrial origin of the cloned monkey was confirmed by SNP identification with the mitochondrial DNA of the oocyte donor monkey ( Figure 1 F).

[0194] Although the full-term birth rate of rhesus macaque clones is still much lower than that of cynomolgus macaque clones, the inventors observed that the full-term birth rate was improved compared with rhesus macaque clones without TR (0.9% vs 0.2%, Table 2). In addition, through Kdm4d, TSA and trophoblast replacement, the inventors were able to achieve long-term survival of somatic cell cloned rhesus macaques, which are still healthy (more than 2 years after birth).

[0195] Table 1

[0196]

[0197] * Data were calculated based on the number of embryos used for SCNT

[0198] Table 4 STR analysis of surviving SCNT-TR rhesus monkeys

[0199]

[0200] Example 4 SCNT-TR monkey chimerism test

[0201] Another concern regarding TR-derived SCNT monkeys is the potential mosaicism caused by ICSI-ICMs. Since a male donor cell line (rhMKEF180502-1) was used as the nuclear donor, X-chromosome single nucleotide polymorphisms (SNPs) were used to test for mosaicism. The intact SCNT-ICM origin of the fetal tissue and the ICSI embryonic origin of the TR-derived placenta were confirmed by Sanger sequencing of the 2 identified X-chromosome SNPs ( Figure 1 G and 4B). Further site-specific deep sequencing of the corresponding genomes of ear tissue, skin, and peripheral blood from ectoderm and mesoderm confirmed that ICSI-ICM had no effect on fetal development ( Figure 1 H and 4C). In addition, the inventors found that the rhesus macaque tr-placenta inherited the X chromosome used for ICSI from both the oocyte donor and the sperm donor, while only one copy of the X chromosome was detected in the ectoderm and mesoderm derivatives of the rhesus macaque SCNT-TR monkey ( Figure 4 D) However, the inventors note that the placenta of this cloned rhesus monkey is composed of cells from both ICSI and SCNT embryos ( Figure 1 C and Table 4), indicating that the injected SCNT-icm partially promoted the placenta reconstruction of the embryos.

[0202] To further verify whether there was any ICM residue leading to fetal development, a total of 83 blastocysts (ICM removed ICSI blastocysts) were transferred into the uterus (Table 5). Of the 83 embryos transferred, 10 were implanted, and ultrasound examination showed that none of the embryos carried a baby ( Figure 5 These results indicate that our TR method is a reliable method for creating non-chimeric SCNT monkeys.

[0203] Table 5 Post-implantation developmental potential of ICSI blastocysts with ICM removed

[0204]

[0205] ＊ Data were calculated based on the number of blastocoele cavitiestransferred.

[0206] Example 5 Correction of clonal placental defects

[0207] The inventors compared the CCI and CCN of SCNT-A, SCNT-F, ICSI-F and SCNT-TR placentas to explore whether trophoblast replacement methods can help prevent placental defects. Both CCI and CCN showed that the calcification level of SCNT-tr placentas was indeed significantly lower than that of SCNT placentas ( Figure 2 D and E, Table 2). Since the calcification levels of SCNT-F and SCNT-TR placentas were similar to those of ICSI-F, the inventors concluded that correction of premature calcification could improve postimplantation development of cloned fetuses. However, for unknown reasons, the thickness of SCNT-tr placentas remained similar to that of SCNT placentas ( Figure 1 I and Figure 2 C, Table 2). In conclusion, the present inventors' research results indicate that trophoblast replacement partially prevents the abnormal placental phenotype of monkey SCNT embryos and successfully obtains the world's first rhesus monkey cloned alive by SCNT.

[0208] discuss

[0209] In our NHP clones, we initially discovered abnormal development of the SCNT placenta, especially severe calcification in SCNT-as. Although the detailed mechanisms of this aberration and whether they lead to embryonic development failure have not yet been determined, a recent study using cloned rhesus monkey placentas revealed abnormal expression of imprinted genes (such as DNMT1 and RHOBTB3) in monkey SCNT placentas (Chu et al., 2021). Further molecular studies will help us understand the obstacles that hinder the development of SCNT embryos.

[0210] Although tetraploid embryo complementation improves the efficiency of mouse SCNT (Lin et al., 2011), no similar findings were observed when fused 2-cell stage NHP embryos were implanted and developed to term. In future studies, the present inventors will further explore the mechanism of karyotype stability of NHP early embryos.

[0211] By modifying previous reports on the transfer of exogenous ICMs into intact blastocysts of sheep, cows, and monkeys, a trophoblast replacement method was developed (Loi et al., 2018; Murakami et al., 2006; Tachibana et al., 2012). By combining the previous SCNT protocol (Liu et al., 2019b; Liu et al., 2018), the inventors successfully cloned a rhesus monkey that survived for more than 2 years through the trophoblast replacement method. Although trophoblast replacement is a method suitable for SCNT cloning of non-human primates, whether this method is applicable to improving the full-term live birth rate of other cloned NHPs remains to be further studied.

[0212] Nevertheless, the implantation rate of rhesus SCNT-TR embryos was increased to over 27% compared with non-TR SCNT embryos (7.2%, Table 1). This implantation rate is also higher than previously reported monkey SCNT without TR (6 / 79 and 16 / 325) (Liu et al., 2019b; Liu et al., 2018). On the other hand, the difference in embryo implantation rate and live birth rate may suggest harmful defects in monkey SCNT embryos. In addition, this trophoblast replacement method may cause physical damage to the injected ICMs and impaired bonding between trophoblasts and ICMs. This speculation will require a detailed comparison of ICSI-tr and unmanipulated ICSI embryos. Taken together, all these effects may lead to a decrease in the live birth rate of SCNT-TR embryos.

[0213] Injected exogenous macaque ICMs formed individual fetuses and were not easily integrated into the embryonic development of endogenous ICMs (Tachibana et al., 2012). Similarly, exogenous SCNT-ICMs independently developed into fetuses after ICSI-ICMs were physically removed. The contribution of exogenous SCNT-ICMs to the TR placenta is expected because the chorionic mesoderm and amniotic epithelium are derived from the ectoderm and extraembryonic mesoderm, respectively.

[0214] In conclusion, the inventors report here the first rhesus monkey to survive for more than 2 years after SCNT.

[0215] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A method for preparing blastocyst stage embryonic trophoblast cells, characterized in that: The following steps are involved: (a) providing a first embryo, wherein the first embryo is a non-human primate embryo in the blastocyst stage, and performing laser drilling on the zona pellucida of the first embryo, wherein the drilling position is the position of the inner cell mass (ICM) of the first embryo, thereby obtaining the first embryo processed by laser drilling; (b) culturing the first embryo, wherein the inner cell mass of the first embryo is automatically discharged from the laser-punched position, thereby obtaining an empty blastocyst of the first embryo without the inner cell mass in the cavity; (c) providing an inner cell mass separated from a second embryo, wherein the second embryo is a non-human primate embryo in the blastocyst stage, and introducing the inner cell mass separated from the second embryo into the empty blastocyst of the first embryo obtained in step (b), the cavity of which does not contain an inner cell mass; wherein before, during, or after the introducing step, the inner cell mass of the first embryo is separated and removed from the empty blastocyst; thereby obtaining a reconstructed blastocyst.

2. The method according to claim 1, characterized in that: All micromanipulations in all the steps described were performed in a micromanipulation system with a heating stage.

3. The method according to claim 1, characterized in that: The embryo is a non-human primate embryo.

4. The method according to claim 1, characterized in that: The embryos are embryos in a viable state.

5. The method according to claim 1, characterized in that: In step (a), the first embryo is in the middle to late blastocyst stage.

6. The method according to claim 1, characterized in that: In step (a), the second embryo is in the middle to late blastocyst stage.

7. The method according to claim 1, characterized in that: In step (b), the obtained first embryo empty blastocyst without inner cell mass in the cavity may be the inner cell mass of the first embryo with outward discharge, or the inner cell mass of the first embryo with outward discharge has been separated and removed.

8. The method according to claim 1, characterized in that: The method further comprises regenerating the reconstructed blastocyst into a non-human mammal.

9. A reconstructed blastocyst, characterized in that: The reconstructed blastocyst is prepared by the method according to claim 1.

10. The reconstructed blastocyst according to claim 2, characterized in that: The inner cell mass of the reconstructed blastocyst comes from the second embryo, and the other parts come from the first embryo.

Images