Kit for counting human B lymphocytes based on gene methylation detection
By detecting the methylation status of specific differential methylated regions on the PARP1 gene, and using fluorescence quantitative PCR technology to calculate the relative proportion of B lymphocytes in white blood cells, the existing flow cytometry counting problems are solved, and higher counting accuracy and sensitivity are achieved.
Patent Information
- Application Number
- CN202411917670.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-24
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2044-12-24
AI Technical Summary
The existing flow cytometry used for B lymphocyte counting has problems such as high sample requirements, limited applicability, inaccurate counting and difficult standardization.
By detecting the methylation status of specific differentially methylated regions on the PARP1 gene, the relative proportion of B lymphocytes in white blood cells was calculated using fluorescence quantitative PCR technique.
The accuracy and sensitivity of B lymphocyte counts are improved, the sample requirements are reduced, suitable for various types of samples, and can be automated, reducing operational variability.
Smart Images

Figure CN119372296B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biology, and particularly to a kit for counting human B lymphocytes based on gene methylation detection. Background Art
[0002] Lymphocytes are important cellular components of the human body's defense against diseases and immune response functions. They express differentiation antigens, namely CD molecules, during the process of differentiation and maturation. According to the different CD molecules expressed, lymphocyte subsets mainly include T lymphocytes, B lymphocytes, and NK cells. B lymphocytes have traditionally been defined as "a cell population that expresses clonally diverse cell surface immunoglobulin (Ig) receptors and recognizes specific antigen epitopes". They originate from hematopoietic stem cells in the bone marrow, and characteristic markers include CD19, CD20, and the B lymphocyte antigen receptor (BCR). B lymphocytes can be divided into two lineages, T cell-independent B1 cells and T cell-dependent B2 cells. B lymphocytes that mature in the bone marrow migrate to peripheral lymphoid organs via the blood. After being stimulated by antigens, they differentiate and proliferate into plasma cells, synthesize antibodies, play the function of humoral immunity, and play an important role in the pathogenesis of various human diseases.
[0003] The proportion, quantity, and function of different lymphocyte subsets directly affect the immune state of the body. "Lymphocyte subset" detection is an important indicator for evaluating the current immune function and balance state of the body, especially for patients with immune function deficiencies, and is an essential diagnostic item. Under normal circumstances, each lymphocyte subset maintains a certain proportion and quantity, working together to maintain the body's homeostasis. During the course of diseases, the proportion and quantity of immune cells will undergo pathological changes, leading to immune function disorders. The application scenarios of lymphocyte counting are extensive, mainly including the early screening of abnormal total lymphocyte subsets in patients with infections and malignancies, verification after primary immunodeficiency screening, the auxiliary diagnosis of chronic lymphocytic leukemia (CLL), detection and monitoring after treatment of HIV-positive patients, immune and immune reconstitution monitoring, such as the evaluation of immune reconstitution after immunosuppressive therapy for transplantation, autoimmune diseases, and other immune conditions, as well as after hematopoietic stem cell transplantation.
[0004] Currently, flow cytometry (FCM) is the standard method for lymphocyte subset or B lymphocyte counting. It uses different monoclonal antibodies to bind to the CD antigens on the surface of lymphocytes, and combines with multi-color fluorescent dyes to simultaneously detect the surface antigens of several lymphocytes, separating B lymphocytes from white blood cells, thereby obtaining the number and relative proportion of B lymphocytes. There are the following limitations in using flow cytometry for B lymphocyte counting: First, the requirements for samples are relatively high. The cells to be detected must be intact, and the blood samples are required to be "fresh", generally requiring detection within 8 hours. Second, since flow cytometry for B lymphocytes requires a relatively large amount of samples, it poses a greater problem for blood collection in some application scenarios such as infants and young children. Third, flow cytometry detects the fluorescence signal of the complex after the fluorescently labeled antibody binds to the antigen on the cell surface, and it is necessary to determine the threshold between positive and negative complexes. However, for the surface antigens of different cell subsets, their expression is not a process of presence or absence, but different expression levels of low, medium, and high. Therefore, the B lymphocyte subset may have inaccurate counting due to inaccurate determination of the threshold. Fourth, due to differences in samples, immunological detection techniques, and operation processes, there are significant differences in the detection results among laboratories. Standardization of flow cytometry for B lymphocyte counting remains a challenge, and a standardization scheme remains to be established.
[0005] During the differentiation and development of B lymphocytes, DNA methylation modification plays an important role. By regulating gene expression and inactivation, it provides specific methylation markers for B lymphocytes. For example, the promoter regions of some genes involved in B lymphocyte differentiation and development are completely unmethylated in B lymphocytes, but highly methylated in other cell subsets outside B lymphocytes, such as T lymphocytes, NK cells, and non-lymphocytes such as granulocytes and monocytes. These unmethylated CpG sites can serve as specific differentially methylated regions (DMRs), that is, as biomarkers, to identify B lymphocytes and to quantify B lymphocytes in peripheral blood. This characteristic of B lymphocytes, through epigenetic means rather than cell morphology or surface markers, is expected to overcome the limitations of the above-mentioned flow cytometry detection methods.
[0006] At present, there are few reports on DNA methylation biomarkers based on epigenetics as a method for lymphocyte counting. Patent CN 108026578 A reports the identification and quantification of B lymphocytes based on the demethylation or lack of methylation status of at least one CpG position in the gene region of low-density lipoprotein receptor-related protein 5 (LRP5), and differentiates it from all other cells in complex samples (such as other blood cells or immune cells). However, the verification of LRP5 as a B lymphocyte-specific biomarker in this patent is not sufficient, and only cell type specificity is demonstrated by plasmid DNA. In addition, the description and data of implementing the method on whole blood and / or tissues without trypsin digestion are unclear. Summary of the Invention
[0007] To overcome the above problems, the present invention provides a kit for counting human B lymphocytes based on gene methylation detection, and the kit is a kit for detecting the methylation of PARP1 gene in a sample.
[0008] In one embodiment, the kit is a kit for detecting a fragment in the differentially methylated region hg38chr1: 226372321-226371196 on the PARP1 gene.
[0009] In one embodiment, the kit is a kit for detecting the differentially methylated region hg38chr1: 226371363-226371254 on the PARP1 gene.
[0010] In one embodiment, the kit is a kit for detecting a gene region containing at least one of the differentially methylated sites hg38 chr1: 226371196, hg38 chr1: 226371228, hg38 chr1: 226371279 and hg38 chr1:226371333 on the PARP1 gene.
[0011] In one embodiment, the kit calculates the proportion of human B lymphocytes in human white blood cells by detecting the copy numbers of the reference gene and the PARP1 gene.
[0012] In one embodiment, the reference gene is the RPP30 gene.
[0013] In one embodiment, the kit is a sequencing kit, a quantitative PCR kit or a digital PCR kit.
[0014] In one embodiment, the kit includes: primers and probes for detecting the methylation status of CpG sites in the region of hg38 chr1: 226371363-226371254, and primers and probes for detecting the copy number of a reference gene.
[0015] In one embodiment, the kit includes: upstream primer SEQ ID No. 13: GGAAGTGTTGGATATGTAGAAATGG, downstream primer SEQ ID No. 14: CCCACACTCTATATCCTAAAACATCA, and probe SEQ ID No. 15: AGGTGTAGTTATGGGTT.
[0016] In one embodiment, the sample is selected from a peripheral blood sample, a capillary blood sample, or venous blood.
[0017] Based on the above situation, in order to overcome the current technical limitations of cytology-based B lymphocyte counting and expand its applicability, the present invention first proposes that the unmethylated gene region of the PARP1 gene can be used as a biomarker for B lymphocyte identification.
[0018] The β value of the CpG site in the methylation chip represents the degree of methylation. Comparing the β difference (Δβ value) of the corresponding CpG points among groups of samples can screen for differentially methylated sites. The larger the absolute value of the Δβ value, the greater the difference in methylation degree at this site and the stronger the specificity of the site. When the present invention screens for differentially methylated CpG sites of B lymphocytes according to the above principle, another screening condition is creatively set: the Δβ values of 4-5 adjacent CpG sites in the methylation chip are all as large as possible, and these several sites are continuous and as dense as possible, so as to ensure that the gene fragment composed of these 4-5 methylation sites has the greatest specificity, thus meeting the needs of potential biological markers. According to this screening condition, the present invention finally determines 4 differentially methylated sites with relatively large and dense Δβ values on the PARP1 gene: cg08247449 (hg38 chr1:226371196), cg00278472 (hg38 chr1: 226371228), cg09201889 (hg38 chr1: 226371279), and cg06184361 (hg38 chr1: 226371333).
[0019] Since it is a gene sequence that plays a regulatory role in genes or is used for methylation detection, a differentially methylated region must be determined from the differentially methylated sites screened above and used as a specific marker to distinguish B lymphocytes. At the same time, the CpG sites covered by the probes in the methylation chip are also not continuous. Based on the 4 screened differentially methylated sites, the methylation status of 22 CpG sites contained in the sequence approximately 1130bp upstream and downstream of the gene was verified by Sanger sequencing after bisulfite conversion and PCR amplification. These sites are all in an unmethylated state in B lymphocytes, while in other subsets these CpG sites are all in a methylated state, which is exactly the same as the methylation status of the 4 screened differentially methylated sites. Thus, a differentially methylated region approximately 1130bp composed of 22 methylated sites (hg38chr1: 226372321-226371196) was determined as the specific unmethylated region of B lymphocytes.
[0020] In the approximately 1130bp differentially methylated region verified above, multiple amplicon detection fragments with relatively concentrated CpG sites and covering different methylated sites were selected, such as AMP2269, AMP2110, AMP1948, AMP1787, and AMP1333. Primers and probes for the corresponding fragments after methylation conversion were designed, and the ΔCt values (Ct 阴性 -Ct 阳性 ) of the candidate amplicons were compared through the results of fluorescence quantitative PCR (qPCR). The higher the ΔCt value, the better the specificity for B lymphocytes. Thus, a 110bp differentially methylated region (hg38 chr1: 226371363-226371254) corresponding to the amplicon AMP1333 on the PARP1 gene was selected, which has good specificity and sensitivity and can be used as a biomarker for B lymphocyte identification.
[0021] The technical solution adopted in the present invention is as follows: First, the gDNA of the sample to be tested is extracted, and the extracted gDNA is used as a DNA template after bisulfite conversion. Then, primers and probes specific for the amplicons of the PARP1 target gene and primers and probes specific for the internal reference gene RPP30 are used for dual qPCR amplification. The amplification reaction is run on a qPCR instrument, and the amplification results are given in the form of fluorescence curves. Purified B lymphocytes are selected as the reference system, and based on the amplification curves and 2 -ΔΔCtThe method can be used to calculate the relative content of B lymphocytes in white blood cells. In addition, a digital PCR detection platform can also be adopted to directly detect the copy numbers of the PARP1 target gene and the RPP30 reference gene, and according to the corresponding relationship between the copy number of the reference gene and the number of cells (the copy number of RPP30: the number of cells = 2:1), using the formula: the relative content of B lymphocytes (%) = the copy number of the PARP1 target gene / the copy number of the reference gene × 100, the relative content of B lymphocytes in white blood cells can be calculated. The detected fragment of the RPP30 reference gene selected in the present invention is stably expressed in all white blood cells, and all cytosines in the sequence are in an unmethylated state.
[0022] The target detected in the present invention is the methylation level of white blood cell DNA in a sample, which can be applied to various types of samples, including fresh or frozen blood, isolated PBMC cells, dried blood spots, etc. The requirements for the sample are greatly reduced, and there is no requirement for the preservation state of the sample; secondly, the DNA amplification detection requires a small amount of sample, and trace DNA can meet the detection requirements; furthermore, the detection signals obtained by PCR are digital, and they represent a positive or negative value for each cell, rather than an arbitrarily defined "positive" threshold as in the flow cytometry method; finally, the epigenetic qPCR can be carried out in an automated and operator-independent manner and reduce the sensitivity to reagent variability. The kit of the present invention is not only a beneficial supplement to the traditional flow cytometry detection, but the method provided by the present invention can significantly distinguish children with X-linked agammaglobulinemia (XLA) from normal neonates, and can serve the screening of neonatal primary immunodeficiency diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required to be used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For those of ordinary skill in the art, other drawings can be obtained according to these drawings without creative efforts.
[0024] Figure 1 is the DMR sequence of the PARP1 gene for identifying B lymphocytes;
[0025] Figure 2 is the DMR sequence after bisulfite conversion of the PARP1 gene for identifying B lymphocytes;
[0026] Figure 3 is the PCR amplification curve result diagram for verifying the specificity of TPG with plasmid DNA;
[0027] Figure 4It is the PCR amplification curve result graph for verifying the specificity of CPG of plasmid DNA;
[0028] Figure 5 It is the PCR amplification curve graph for verifying the specificity of TPG of methylation standard;
[0029] Figure 6 It is the PCR amplification curve graph for verifying the specificity of CPG of methylation standard;
[0030] Figure 7 It is the bar graph for verifying the specificity of PCR system of gradient methylation standard;
[0031] Figure 8 It is the line graph for verifying the specificity of PCR system of gradient methylation standard;
[0032] Figure 9 It is the digital PCR result graph for verifying the specificity of marker of purified cells. Detailed implementation manners
[0033] In order to enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of this application. In the following embodiments, unless otherwise specified, all are conventional methods.
[0034] For the experimental methods without specific conditions noted in the following embodiments, they are usually in accordance with conventional conditions or the conditions recommended by the manufacturer. All kinds of chemical reagents used in the embodiments are commercially available products.
[0035] Example 1 Discovery of differential genes and differentially methylated regions
[0036] To find the DNA methylation regions specific to B lymphocytes, the present invention first analyzed the 450K and 850K methylation chip data from Illumina, and obtained methylation β values through operations such as probe filtering. Then, the thresholds of β were set to 0.2 and 0.8. After processing and analysis in the confirmation dataset and validation dataset, by comparing the overall methylation levels of different lymphocyte subsets and performing data quality control and standardization operations, differential sites were obtained, and the difference of the sites was measured by the Δβ value. The larger the absolute value of the Δβ value, the more obvious the difference between groups. According to the absolute value of the Δβ value being greater than 0.5 and the Q value being less than 0.01 (Q < 0.01 represents significant difference). Based on this, the present invention preferably selected the differential gene PARP1 with more differential sites (the results are shown in Table 1 in detail). PARP1 (poly ADP-ribose polymerase 1) mainly participates in various biological processes in cells, including DNA damage repair, gene transcription regulation, cell differentiation, proliferation, and tumor transformation. On the basis of obtaining the differential gene, the present invention set another screening condition: the Δβ values of 4-5 adjacent CpG sites in the methylation chip were as large as possible, and these sites were continuous and as dense as possible, so as to ensure that the gene fragment composed of these 4-5 methylation sites had the greatest specificity, thus meeting the needs of potential biological markers. The present invention screened 4 differential methylation sites with relatively large and dense Δβ values on the differential gene PARP1: cg08247449, cg00278472, cg09201889, and cg06184361, which corresponded to the specific positions on the PARP1 gene as hg38 chr1: 226371196, hg38 chr1: 226371228, hg38 chr1: 226371279, and hg38 chr1: 226371333.
[0037] Table 1 Situations of screened differential sites and differential genes
[0038]
[0039] Next, the present invention confirmed the differential sites by experimental methods. Using the gDNA after bisulfite conversion from purified B lymphocytes derived from fresh peripheral blood as the positive template and the gDNA after bisulfite conversion from non-B lymphocytes of the same source as the negative template, Sanger sequencing and pyrosequencing verification were carried out after qPCR amplification. As can be seen from the verification results shown in Table 2, the 4 differential methylation sites (cg08247449, cg00278472, cg09201889, and cg06184361) on the PARP1 gene were indeed differential methylation sites.
[0040] Since it is a gene sequence that plays a regulatory role in genes or is used for methylation detection, a DMR must be determined from the differentially methylated sites screened above and used as a specific marker to distinguish B lymphocytes. At the same time, the CpG sites covered by the probes in the methylation chip are also not continuous. Based on the 4 differentially methylated sites determined and screened above, the present invention expands the possible range of the differential sites in the sequence about 900 bp upstream of the gene (there are no CG points in the downstream gene sequence about 200 bp of the 4 differential sites), and then searches for possible differentially methylated regions DMR. The gDNA from purified B lymphocytes is bisulfite-converted, and multiple target gene fragments where multiple possible differentially methylated sites are located are amplified by designing multiple pairs of universal primers, and then Sanger sequencing is performed. As can be seen from the sequencing results shown in Table 3, when each site to be tested is amplified with the positive template, the sequencing result shows "T" (unmethylated state), and when amplified with the negative template, the sequencing result shows "C" (methylated state), which is completely consistent with the methylation state of the 4 differentially methylated sites screened. Accordingly, the present invention determines a DMR (hg38 chr1: 226372321-226371196) composed of the above 22 differentially methylated sites, and the DMR is distributed in the promoter region of the PARP1 gene.
[0041] Table 2 Verification results of Sanger sequencing and pyrosequencing of 4 differentially methylated sites on the PARP1 gene.
[0042]
[0043] Table 3 Sanger sequencing results of each site to be tested
[0044]
[0045] In particular, Figure 1 shows the DNA sequence, CpG site analysis of the DMR of the PARP1 gene for identifying B lymphocytes, and the specific gene localization of 4 differentially methylated sites, Figure 1 in which the 4 differentially methylated sites are in bold and underlined.
[0046] Amplicons and specific primer probes determined in Example 2
[0047] Figure 2 shows the DNA sequence of the determined DMR region after bisulfite conversion. Figure 2The horizontal boxes correspond to (CPG1, 2... 22) in the analyzed PARP1 gene, and the indicated positions (hg38 chr1: 226372321, hg38 chr1: 226372269... hg38 chr1: 226371196) correspond to CPG1, 2,... CPG22. To further determine the optimal target gene amplicon sequence, for 5 candidate amplicons AMP2269 (CpG2 - CpG5, specific genomic location: hg38 chr1: 226372287 - 226372167), AMP2110 (CpG6 - CpG8, specific genomic location: hg38 chr1: 226372134 - 226372009), AMP1948 (CpG9 - CpG11, specific genomic location: hg38 chr1: 226371978 - 226371882), AMP1787 (CpG13 - CpG16, specific genomic location: hg38 chr1: 226371814 - 226371711), AMP1333 (CpG18 - CpG20, specific genomic location: hg38 chr1: 226371363 - 226371254), 5 sets of primer - probes were designed according to the MethyLight rule, and the primers and probes were optimized to achieve the best specificity and sensitivity. As shown in Table 4, SEQ ID No. 1 - 21 shows the specific primer and probe sequences used in the present invention. The present invention uses positive samples (gDNA extracted and transformed from B lymphocytes) and negative samples (gDNA extracted and transformed from non - B lymphocytes) as templates for the TPG system of the qPCR detection platform, and uses ΔCt (Ct 阴性 -Ct 阳性 )) to evaluate the specificity of the amplicon for identifying B lymphocytes. The higher the ΔCt value, the better the specificity for B lymphocytes. The results of qPCR are shown in Table 5. The primer - probe corresponding to AMP1333 shows the largest ΔCt, indicating that this amplicon has good specificity and sensitivity and can be used as a biomarker for B lymphocyte identification.
[0048] Preferably, Figure 2 the underlined positions (genomic location: hg38 chr1: 226371363 - 226371254) show the CPG site analysis on the amplicon determined for the PARP1 target gene for identifying B lymphocytes. The horizontal boxes correspond to the CPG positions (CPG18, 19, 20) in the analyzed amplicon, and the indicated positions (hg38 chr1: 226371333, hg38 chr1: 226371325, hg38 chr1: 226371279) correspond to CPG18, 19, 20.
[0049] SEQ ID No. 22 and SEQ ID No. 23 show the DNA sequences of the bisulfite-converted target gene amplicons of the qPCR and digital PCR detection systems according to the present invention. The methylated "CG" sites still maintain the differential methylation sites of "CG" and the specific primers and probes for detecting these sites. The TPG system refers to the differential methylation sites where the unmethylated "CG" sites are converted to "TG" after the DNA sequence of the target gene amplicon is sulfated, and the specific primers and probes for detecting these sites.
[0050] Preferably, the amplicon (SEQ ID No. 22) specific to the CPG (detecting methylation sites) system:
[0051] GGAAGTGTTGGATATGTAGAAATGGAAAGGCGTAGTTACGGTTTTTAGGGAGTTTAGAAGGGTTTATTGGTAAAGTTTTAGAGACGATGTTTTAGGATATAGAGTGTGG
[0052] Preferably, the amplicon (SEQ ID No. 23) specific to the TPG (detecting unmethylated sites) system:
[0053] GGAAGTGTTGGATATGTAGAAATGGAAAGGTGTAGTTATGGTTTTTAGGGAGTTTAGAAGGGTTTATTGGTAAAGTTTTAGAGATGATGTTTTAGGATATAGAGTGTGGG
[0054] Table 4 Sequences of specific primers and probes for the target gene PARP1
[0055]
[0056] Table 5 qPCR amplification results of 5 groups of primers and probes
[0057]
[0058] Example 3 Verification of the TPG and CPG specific PCR systems
[0059] Verify the specificity of the PCR system using test templates (plasmid DNA). Set two concentration gradients of templates. The sequence of plasmid C is the same as SEQ ID No. 22, and the sequence of plasmid T is the same as SEQ ID No. 23. Test the TPG and CPG systems respectively by PCR amplification. The results are as Figure 3 and Figure 4As shown
[0060] It can be seen from Figure 3 that when the added template is a high-concentration T plasmid or a high-concentration T plasmid diluted 100-fold, the qPCR amplification curve is a typical S-shaped amplification curve. However, when the template is a high- or low-concentration C plasmid, the amplification curve does not appear, which is consistent with the amplification of NTC. The above results can prove that the primers and probes of the TPG system have good specificity.
[0061] It can be seen from Figure 4 that when the added template is a high-concentration T plasmid or a high-concentration C plasmid diluted 100-fold, the qPCR amplification curve is a typical S-shaped amplification curve. However, when the template is a high- or low-concentration T plasmid, the amplification curve does not appear, which is consistent with the amplification of NTC. The above results can prove that the primers and probes of the CPG system have good specificity.
[0062] In addition, a methylation standard with a methylation rate of 0% and a methylation standard with a methylation rate of 100% were used to verify the specificity of the TPG and CPG systems. The methylation standards were sourced from QIAGEN. It can be seen from Figure 5 and 6 that when the 0% methylation standard was used as the template, the TPG system produced a typical amplification curve, while the CPG system did not produce an amplification curve. Similarly, when the 100% methylation standard was used as the template, the CPG system produced a typical amplification curve, while the TPG system did not produce an amplification curve. The above results indicate that the primers and probes of the TPG and CPG systems have good specificity.
[0063] Considering the differences in methylation levels in actual samples, gradient methylation standards were further used to verify the specificity of the PCR system. To this end, a methylation standard with a methylation rate of 0% and a methylation standard with a methylation rate of 100% were mixed to simulate methylation values in the range of 0% - 100%. Then, the proportion (%) of the TPG template in these mixtures was detected using the assay of the present invention. The results are as shown in Figure 7 and Figure 8 that when the methylation ratio changes from 0% to 100%, the ratio calculated by the digital PCR test also changes equivalently, showing a good linear relationship (R 2 = 0.9982). The test results of the gradient methylation standards fully demonstrate that the TPG and CPG systems have good specificity and can distinguish different methylation levels.
[0064] Example 4 Verification of PARP1 target gene as a B lymphocyte-specific marker
[0065] Verify the specificity of PARP1 as a B lymphocyte marker using purified cells. For this purpose, the DNA extracted and converted from lymphocytes purified by magnetic bead sorting (T lymphocytes, CD4+ T lymphocytes, CD8+ T lymphocytes, B lymphocytes, and NK cells) was used as a template, and the copy numbers of the target gene PARP1 and the reference gene RPP30 were directly obtained using a digital PCR platform. The relative content (%) of each cell subset can be directly calculated by the formula: relative content of cell subset (%) = copy number of PARP1 target gene / copy number of reference gene × 100. As Figure 9 known, the proportion of B lymphocytes detected by the TPG system is very high, while the proportions of T lymphocytes, CD4+ T lymphocytes, CD8+ T lymphocytes, and NK cells are <1.7%, and the detection results are in good agreement with those of flow cytometry. The above results also indicate that the PARP target gene can be used as a specific marker for B lymphocytes.
[0066] Example 5 Determination of B lymphocyte content in actual samples
[0067] Quantify the B lymphocyte content (%) in neonatal dried blood spot samples using the PARP1 primer-probe of the present invention. XLA is the most severe disease among B lymphocyte immunodeficiency diseases. Patients with XLA cannot produce mature B lymphocytes, which affects humoral immunity and increases the probability of severe and lethal bacterial infections. The copy numbers of the PARP1 gene and the reference gene were detected by digital PCR. Using the formula: proportion of B lymphocytes (%) = copy number of PARP1 target gene / copy number of reference gene × 100, the relative content of B lymphocytes in white blood cells can be calculated. As shown in Table 6, the copy number of the target gene in XLA samples is 3 - 13 copies / µL, and the proportion in white blood cells is 0.2 - 1.6%, while the copy number of the target gene in normal neonatal samples is 40 - 288 copies / µL, and the proportion in white blood cells is 3.9 - 8.8%. The above results indicate that the method provided by the present invention can significantly distinguish between XLA children and normal neonates and can serve for the screening of neonatal primary immunodeficiency diseases.
[0068] Table 6 Quantification of PARP1 gene and proportion of B lymphocytes in dried blood spot samples
[0069]
[0070] It should be understood that the present invention disclosed is not limited to the specific methods, protocols, and substances described, as these can vary. It should also be understood that the terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the scope of the present invention, which is limited only by the appended claims.
[0071] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.
Claims
1. A method for human B lymphocyte counting based on gene methylation detection, characterized in that: The method is for detecting methylation of the PARP1 gene in a sample, and the method is for detecting the differentially methylated region hg38 chr1:226372321-226371196 on the PARP1 gene.
2. The method according to claim 1, characterized in that The method is used to detect the differentially methylated region hg38 chr1: 226371254-226371363 on the PARP1 gene.
3. The method according to claim 1, characterized in that The method is used to detect a gene region comprising at least one of the differentially methylated sites hg38 chr1: 226371196, hg38 chr1: 226371228, hg38 chr1: 226371279 and hg38 chr1: 226371333 on the PARP1 gene.
4. The method according to claim 1, characterized in that The method calculates the proportion of human B lymphocytes to human leukocytes by detecting the copy numbers of the internal reference gene and the PARP1 gene.
5. The method according to claim 4, characterized in that The internal reference gene is the RPP30 gene.
6. The method according to claim 4, characterized in that The method is a sequencing method, a quantitative PCR method or a digital PCR method.
7. The method according to claim 6, characterized in that The method includes using primers and probes for detecting the methylation status of CpG sites in the region of hg38 chr1:226371254-226371363 and primers and probes for detecting the copy number of an internal reference gene.
8. The method according to claim 7, characterized in that The method uses: upstream primer SEQ ID No. 13GGAAGTGTTGGATATGTAGAAATGG, downstream primer SEQ ID No. 14: CCCACACTCTATATCCTAAAACATCA, and probe SEQ ID No. 15: AGGTGTAGTTATGGGTT.
9. The method according to claim 1, characterized in that: The sample is selected from a peripheral blood sample, a capillary blood sample or a venous blood.
Citation Information
Patent Citations
LRP5 as epigenetic marker for the identification of immune cells, in particular b-cells
CN108026578A