Application of CuSUMO1 and CuHTR4 as internal reference genes and primers

Abstract

The application discloses application and primers of CuSUMO1 and CuHTR4 as internal reference genes, belongs to the technical field of plant molecular biology, and particularly relates to application of CuSUMO1 and / or CuHTR4 as internal reference genes for quantitative analysis of genes of Dendrocalamopsis oldhami in Jinfoshan Mountain, and is characterized in that the nucleotide sequence of the CuSUMO1 is shown as SEQ ID NO. 2, and the nucleotide sequence of the CuHTR4 is shown as SEQ ID NO. 3. The application provides the internal reference genes CuSUMO1 and CuHTR4 and a primer pair for detecting expression analysis research of target genes of samples in different tissues, different development periods and different stress treatments of Dendrocalamopsis oldhami in Jinfoshan Mountain. The internal reference genes CuSUMO1 and CuHTR4 have high stability, and have important values for evaluating and detecting expression amounts of target genes of Dendrocalamopsis oldhami in Jinfoshan Mountain in different tissues, different development periods and different stress treatments.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology technology, and in particular relates to the application of CuSUMO1 and CuHTR4 as internal reference genes and primers. Background Technology

[0002] Jinfo Mountain square bamboo ( Chimonobambusa utilis (Keng) PC Keng is a bamboo species in China with both economic and ecological value. Its bamboo shoots are crisp and delicious, earning it the title of "King of Bamboo Shoots." At the same time, Jinfoshan square bamboo is also an important forest resource in my country, playing a vital role in maintaining the stability of the regional ecological environment. With the acquisition of reference genome and multidimensional transcriptome data at the chromosome level for Jinfoshan square bamboo, defining ideal internal reference genes that are stably expressed under as many conditions as possible at the whole genome level will provide important guarantees for the molecular breeding of Jinfoshan square bamboo.

[0003] Real-time quantitative PCR (RT-qPCR) is a commonly used method for detecting gene expression, which has many advantages such as high sensitivity, strong specificity, high accuracy, simple operation, wide detection range, and has been widely used in drug development, medical diagnosis, plant and animal breeding and other scientific research fields. When using RT-qPCR to analyze the relative expression of target genes, the experimental results are usually affected by factors such as RNA quality, primer specificity and primer amplification efficiency, so screening a stable internal reference gene to correct the experimental results is an important factor to significantly improve the accuracy of the experimental results. The internal reference gene is usually a housekeeping gene with stable expression in cells, which encodes proteins necessary for maintaining basic life activities. For example, chromatin histone encoding gene HTR, glyceraldehyde-3-phosphate dehydrogenase gene GAPDH, ubiquitin-conjugating enzyme gene UBC, 18S ribosomal RNA gene 18S rRNA, and polyubiquitin gene UBQ have been widely used as internal reference genes in plant gene expression research. At the same time, based on the rapid development of high-throughput sequencing, it is possible to use transcriptome data to explore new internal reference genes, and some new internal reference genes show high stability under different conditions. An ideal internal reference gene needs to be stably expressed in different tissues, different treatments and different development periods, but research shows that there is no gene that can meet this requirement in practice. If an unselected internal reference gene is used directly, it will cause experimental data deviation and affect the reliability of the expression level results of the target gene. Therefore, it is imperative to screen the best internal reference gene for different tissues, different treatments and different varieties using RT-qPCR.

[0004] At present, there is no suitable and stable internal reference gene for Chimonobambusa fangfeng, and with the availability and release of Chimonobambusa fangfeng genome and transcriptome data and the application of bioinformatics methods, it is of great value to develop internal reference genes with strong conservation, stable expression and good accuracy for evaluating and detecting the expression of target genes in different tissues and different treatment samples. SUMMARY

[0005] To solve the above technical problems, the application provides application of CuSUMO1 and CuHTR4 as internal reference genes and primers, and provides internal reference genes CuSUMO1 and CuHTR4 and primer pairs for detecting expression of target genes of samples in different tissues, different development periods and different stress treatments of Chimonocalamus fargesii, and the internal reference genes CuSUMO1 and CuHTR4 have high stability, and have important values for evaluating and detecting expression of target genes of Chimonocalamus fargesii in different tissues, different development periods and different stress treatments.

[0006] To achieve the above object, the application provides application of CuSUMO1 and / or CuHTR4 as internal reference genes for quantitative analysis of genes of Chimonocalamus fargesii, the nucleotide sequence of the CuSUMO1 is shown as SEQ ID NO. 2, and the nucleotide sequence of the CuHTR4 is shown as SEQ ID NO. 3.

[0007] The application further provides application of the CuSUMO1 as an internal reference gene for quantitative analysis of genes of Chimonocalamus fargesii in different tissues.

[0008] The application further provides application of the CuSUMO1 as an internal reference gene for quantitative analysis of genes of Chimonocalamus fargesii in different development periods.

[0009] The application further provides application of the CuSUMO1 as an internal reference gene for quantitative analysis of genes of Chimonocalamus fargesii under different stress treatment conditions.

[0010] The application further provides application of the CuHTR4 as an internal reference gene for quantitative analysis of genes of Chimonocalamus fargesii under different stress treatment conditions.

[0011] The application further provides a primer pair for detecting the internal reference gene CuSUMO1 for quantitative analysis of genes of Chimonocalamus fargesii, and the nucleotide sequences of the primer pair for detecting the internal reference gene CuSUMO1 are shown as SEQ ID NO. 7 and SEQ ID NO. 8.

[0012] The application further provides a primer pair for detecting the internal reference gene CuHTR4 for quantitative analysis of genes of Chimonocalamus fargesii, and the nucleotide sequences of the primer pair for detecting the internal reference gene CuHTR4 are shown as SEQ ID NO. 9 and SEQ ID NO. 10.

[0013] Compared with the prior art, the application has the following advantages and technical effects:

[0014] The application provides applications of CuSUMO1 and CuHTR4 as internal reference genes and primers, based on the latest genome data of Jinfoshan bamboo, a large amount of transcriptome data is collected, candidate internal reference genes are screened, and then the primers meeting the characteristics of internal reference genes are screened through primer identification, amplification efficiency evaluation and melting curve analysis; the expression levels of the primers in bamboo shoots of different tissues and different development periods and in tissue samples under different stress treatment conditions of Jinfoshan bamboo are determined, and the stability of the candidate internal reference genes is evaluated by combining five kinds of analysis software, i.e., geNorm, NormFinder, Bestkeeper, DeltaCt and Refinder, and the internal reference genes CuSUMO1 and CuHTR4 with the best stability are screened, thereby providing important scientific value for expression analysis and research of target genes in samples of different tissues, different development periods of bamboo shoots and under different stress treatments of Jinfoshan bamboo. BRIEF DESCRIPTION OF DRAWINGS

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative effort on the basis of these drawings.

[0016] Figure 1 The figure is an agarose gel electrophoresis result diagram of PCR products of primers of four candidate internal reference genes CuHMG2 gene, CuSUMO1 gene, CuHTR4 gene and CuTPI1 gene, wherein 1 represents the CuHMG2 gene, 2 represents the CuSUMO1 gene, 3 represents the CuHTR4 gene, 4 represents the CuTPI1 gene, and M represents a 500bp DNA marker;

[0017] Figure 2 The figure is a standard curve diagram of amplification efficiency of RT-qPCR primers of four candidate internal reference genes CuHMG2 gene, CuSUMO1 gene, CuHTR4 gene and CuTPI1 gene, wherein A is the CuHMG2 gene, B is the CuSUMO1 gene, C is the CuHTR4 gene, and D is the CuTPI1 gene;

[0018] Figure 3 The figure is a melting curve diagram of RT-qPCR primers of four candidate internal reference genes CuHMG2 gene, CuSUMO1 gene, CuHTR4 gene and CuTPI1 gene, wherein A is the CuHMG2 gene, B is the CuSUMO1 gene, C is the CuHTR4 gene, and D is the CuTPI1 gene;

[0019] Figure 4Ct box plot of CuSUMO1 gene, CuHTR4 gene and CuTPI1 gene three candidate internal reference genes in different tissues and development periods of Jinfo Mountain Dendrocalamus giganteus;

[0020] Figure 5 Stability analysis of CuSUMO1 gene, CuHTR4 gene and CuTPI1 gene three candidate internal reference genes in different treatments of Jinfo Mountain Dendrocalamus giganteus by geNorm, NormFinder, Bestkeeper and DeltaCt software;

[0021] Figure 6 Ct box plot of CuSUMO1 gene, CuHTR4 gene and CuTPI1 gene three candidate internal reference genes in different treatments of Jinfo Mountain Dendrocalamus giganteus;

[0022] Figure 7 Stability analysis of CuSUMO1 gene, CuHTR4 gene and CuTPI1 gene three candidate internal reference genes in different treatments of Jinfo Mountain Dendrocalamus giganteus by geNorm, NormFinder, Bestkeeper and DeltaCt software;

[0023] Figure 8 Ct box plot of CuSUMO1 gene, CuHTR4 gene and CuTPI1 gene three candidate internal reference genes in all samples of Jinfo Mountain Dendrocalamus giganteus;

[0024] Figure 9 Stability analysis of CuSUMO1 gene, CuHTR4 gene and CuTPI1 gene three candidate internal reference genes in all samples of Jinfo Mountain Dendrocalamus giganteus by geNorm, NormFinder, Bestkeeper and DeltaCt software. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present application will now be described in detail, with reference to the drawings. The detailed description is not to be considered to limit the application, but rather to explain certain aspects, features and embodiments of the application.

[0026] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, for a range of values of a parameter, unless otherwise indicated, each intervening value by each intervening value, as well as any other stated or intervening value in that stated range is encompassed. In addition, any combination of the above ranges, as well as any other stated or intervening value in that stated range, is encompassed. Unless otherwise stated, the above ranges are inclusive of the recited endpoints. The above ranges are aftertreated to be independent of the inclusion or exclusion of a specific recited endpoint and are absolute.

[0027] All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains, unless indicated otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference for the purposes of the disclosure and description of the procedures and / or materials described therein. In case of conflict between the content of the specification and that of any incorporated literature, the content of the specification controls.

[0028] Various modifications and variations of the described methods and materials of the specification will be apparent to those skilled in the art without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples are illustrative only.

[0029] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed materials and methods.

[0030] Software versions used in the analysis of the present application: geNorm (Vandesompele et al., 2002), NormFinder (Andersen et al., 2004), Bestkeeper (Pfaffl et al., 2004), DeltaCt (Silver et al., 2006), Refinder (Xie et al., 2012).

[0031] Example 1

[0032] I. Establish a suitable method for screening reference genes for RT-qPCR of Phyllostachys aureosulcatus f. pubescens in Jinfo Mountain.

[0033] (I) Screening of candidate reference genes

[0034] Based on the transcriptome data of 213 samples of Phyllostachys aureosulcatus f. pubescens in Jinfo Mountain, including root, flower, bud, leaf, shoot, stem transcriptome data of different tissues, transcriptome data of root, stem and leaf of Phyllostachys aureosulcatus f. pubescens seedlings after drought, salt treatment, GA3 treatment, strong light treatment, and transcriptome data of different height shoots of Phyllostachys aureosulcatus f. pubescens. The transcriptome data was aligned to the latest reference genome of Phyllostachys aureosulcatus f. pubescens to obtain the expression amount TPM value of the gene.

[0035] To identify the candidate reference genes, genes with minimum log2(TPM) less than 3 were removed first. Then genes with log2(TPM) values less than 0.5 in standard deviation (SD) were retained. The coefficient of variation (CV) was calculated as CV = (log2(TPM) SD / log2(TPM) mean) x 100%. Finally, genes with CV less than 0.1 were selected as candidate reference genes.

[0036] In the different tissues and different development periods of bamboo shoots and different stress treatments of Jinfo Mountain bamboo, there were 1858 genes with no significant difference in expression. In addition, through further comparison and screening of the expression amount, four candidate reference genes (CuHMG2, CuSUMOl, CuHTR4 and CuTPIl) with relatively stable expression and moderate expression amount were determined, which were subjected to database alignment for annotation. The results are shown in Figure 1 、 Figure 2 A Figure 2 D and Figure 3 A Figure 3 D, indicating that these genes are involved in physiological processes necessary for maintaining plant life activities, which also meet the necessary conditions for reference genes.

[0037]

[0038] The nucleotide sequence of CuSUMOl is shown as SEQ ID NO. 2, wherein the bolded sequence is the sequence corresponding to the RT-qPCR primer pair, SEQ ID NO. 2: ATGTCCGGCGCGGCGGGGGAGGAGGACAAGAAGCCGGCGGGCGAGCAGGGCGGCGCCCACATCAACCTCAAGGTCAAGGGACAGGATGGCAATGAGGTGTTCTTCCGCATCAAGAGATCAACTCAACTGAAGAAGCTGATGAATGCCTACTGCGACCGCCAGTCTGTGGATATGAACGCTATTGCATTCCTGTTTGATGGTCGTAGGCTCCGTGGCGAGCAAACTCCTGATGAGCTCGAGATGGAAGATGGTGACGAGATCGATGCCATGCTTCACCAGACCGGTGGCTGTCTTCTGCCTAGTGCTTAG.

[0039] The nucleotide sequence of CuHTR4 is shown in SEQ ID NO. 3, wherein the bolded sequence is the sequence corresponding to the RT-qPCR primer pair, SEQ ID NO. 3: GGAACCGAGCGAAGCCAAGCGTGACGAGAGGATATCATTTACTAGATGGCGCGTACTAAGCAGACTGCTCGCAAATCCACTGGAGGAAAGGCTCCTAGGAAGCAACTTGCCACCAAGGCAGCCCGTAAGTCTGCTCCTACAACTGGAGGAGTCAAGAAGCCTCACCGTTACCGCCCAGGGACTGTTGCTCTTCGTGAGATCCGTAAGTATCAGAAGAGCACTGAGTTGCTCATAAGGAAGCTGCCATTCCAAAGGCTTGTTAGGGAAATTGCTCAGGATTTCAAGACTGATCTGCGTTTCCAGAGCCATGCCGTGCTTGCTCTTCAGGAGGCAGCAGAGGCCTATCTGGTCGGTCTCTTTGAAGACACCAATCTGTGTGCCATCCACGCTAAGCGTGTGACAATCATGCCAAAGGACATTCAGCTGGCAAGGAGGATCCGTGGTGAGAGGGCTTAGTCTGCCAATGGGAAAAGCTTTGTGCGTTCGTTGTGTGTTCGTCTCTGGGCGCAGCTTATGTGTCGAAATACTCTACCGATCGGTTTAACTCAGTAGTAACATATTGTAGTAGCTTAGCATGCCCGTCCCGTGCTATTGGTCGTACGCATGTGAACAGTGTCTTCTATTCGCGTGCTTCTGAATTGTCATGTTGTGGTGTCACATCCACCAGTTTATGGATGTGTATCTGGGTCTAACTGCAACTCTATGGATTTCGTTGTGAAGCGTGTTAATGGGTTATTACTTGTCTGGTTGGCTAATTTACTGTGCTCG.

[0040]

[0041] (II) Design of candidate reference gene primers and detection of target band size.

[0042] Based on the specific segments of candidate reference genes, reference primers were designed using the Premier 5.0 software (as shown in Table 1 below). The length of the primers was 20-25 bp, the Tm value of the primers was about 60°C, the GC content was about 50%, and the size of the amplified product was between 100-200 bp. Then, the cDNA of the leaves of the Jinfoshan Chimonobambusa utilis was selected as the template for PCR amplification. The agarose gel imaging system was used to observe the band size of the PCR product of the candidate reference gene primers. The results showed that the bands of the four pairs of primers were single and clear, and could be used as candidate reference genes for further analysis (as shown in Figure 1 ).

[0043] Table 1 Primers of four candidate reference genes stably expressed in Chimonobambusa utilis of Jinfoshan

[0044]

[0045] (III) Amplification efficiency of candidate reference genes and verification of primer specificity.

[0046] To verify the amplification efficiency of the primers, the cDNA was diluted by 10 0 , 10 1 , 10 2 , 10 3 , 10 4 , and 10 5 times, respectively, for RT-qPCR to produce a standard curve. The amplification efficiency E = (10 -1 / s -1) x 100%, and the amplification efficiency of the reference gene should be between 90%-110%, and R 2 ≥0.99. The gradient-diluted cDNA was used as the template for RT-qPCR analysis of the four candidate reference genes. Based on the Ct values of the quantitative analysis results, a standard curve was drawn, and the amplification efficiency and R 2 were calculated. The results showed that the amplification efficiency of the four primer sequences was between 98.53%-102.00%, and the R 2 value was greater than 0.99 (as shown in Figure 2 A, Figure 2 B, Figure 2 C, and Figure 2 D), and the selected primers met the requirements of the reference gene primers. Then, the peak graph of the melting curve of RT-qPCR was used to determine the specificity of the primers. The results showed that the CuSUMO1, CuHTR4, and CuTPI1 primers all showed a single peak shape, indicating that these primers had strong specificity; but the CuHMG2 primer showed a double peak shape, indicating that the primer had weak specificity (as shown inFigure 3 CuSUMO1, Figure 3 CuHTR4, Figure 3 CuTPI1 and Figure 3 CuTPI1 (as shown in Table 1). Therefore, primers of CuSUMO1, CuHTR4 and CuTPI1 were selected for further analysis of the stability of candidate reference genes by RT-qPCR.

[0047] II. Analysis of the expression amount and stability of candidate reference genes in different tissues and developmental stages

[0048] In the same site conditions of Jinfo Mountain Phyllostachys nidularis forest, 35 samples of Jinfo Mountain Phyllostachys nidularis root, flower, bud, leaf, shoot, etc. and different developmental stages (as shown in Table 2) were collected, and the samples were quickly frozen in liquid nitrogen and stored in a-80℃ refrigerator. The total RNA of the samples was extracted according to the RNA extraction kit (Tianmo, TR205-50, China), and the cDNA was reversely transcribed according to the reverse transcription kit (Bao Biology, RR037A, Japan).

[0049] Table 2 Different tissues and different developmental stages of samples

[0050]

[0051] The RT-qPCR reaction volume was 10 μL, which contained 5 μL of 2×SYBR Premix Taq (Roche, 04887352001, Germany), 0.4 μL of forward and reverse primers, 0.6 μL of cDNA template and 3.6 μL of sterilized double distilled water. The RT-qPCR program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, and a total of 45 cycles.

[0052] After the cycle, the melting curve was drawn: 60-95℃, and the fluorescence signal was collected every 0.5 s; four quantitative repeats were set for each sample. The corresponding threshold cycle number, i.e. Ct value, was obtained after PCR.

[0053] The Ct value results of RT-qPCR of the three candidate genes using different tissues and developmental stages of Jinfo Mountain Phyllostachys nidularis samples are shown in Table 3. Figure 4 The overall change range of the Ct value of the candidate reference genes was 16.94-23.36, and the Ct value difference size ranking was CuSUMO1 Figure 5The results of NormFinder and Bestkeeper analysis were basically similar, and the most stable gene expressed in different tissues and development stages of Jinfoshan Chamaecyparis funghuensis was CuSUMOl; geNorm and DeltaCt analysis showed that the most stable genes expressed in different tissues and development stages of Jinfoshan Chamaecyparis funghuensis were CuSUMOl and CuHTR4.

[0054] III. Expression and stability analysis of candidate reference genes under different stress treatments

[0055] The 2-month-old Jinfoshan Chamaecyparis funghuensis seedlings were selected for drought, strong light and salt stress treatments, as well as GA3 and PCA hormone treatments, and a total of 50 samples of root, stem and leaf tissue samples were collected after treatment (as shown in Table 3 below). The samples were quickly frozen in liquid nitrogen and stored in a -80℃ refrigerator. The total RNA of the samples was extracted according to the RNA extraction kit (Tianmo, TR205-50, China), and the cDNA was reverse transcribed according to the reverse transcription kit (Bao Biology, RR037A, Japan).

[0056] Table 3. Different stress treatment conditions

[0057]

[0058] The RT-qPCR reaction volume was 10 μL, which contained 5 μL of 2x SYBR Premix Taq (Roche, 04887352001, Germany), 0.4 μL of forward primer / reverse primer, 0.6 μL of cDNA template, and 3.6 μL of sterilized double distilled water. The RT-qPCR program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, and a total of 45 cycles.

[0059] After the cycle, the melting curve was drawn: 60-95℃, collecting fluorescence signal every 0.5 s; four quantitative repeats were set for each sample. The corresponding threshold cycle number, i.e. Ct value, was obtained after PCR.

[0060] The Ct value results of the RT-qPCR of the three candidate genes in different Jinfoshan Chamaecyparis funghuensis samples are shown in Table 4. Figure 6 The Ct value of the candidate reference gene changed in the range of 19.15-23.55, and the Ct value difference size ranking was CuHTR4 < CuSUMOl < CuTPIl. The results of geNorm, NormFinder, Bestkeeper and DeltaCt analysis are shown in Table 5. Figure 7The results of NormFinder, Bestkeeper and DeltaCt analysis were basically similar, and the most stable gene in the Jin Foshan bamboo under different treatments was CuHTR4; the geNorm analysis showed that the most stable gene in the Jin Foshan bamboo under different treatments was CuSUMO1 and CuHTR4.

[0061] IV. Comprehensive analysis of the expression and stability of the candidate reference genes

[0062] The Ct values of the three candidate genes in the RT-qPCR of all samples were analyzed comprehensively, and the results are shown in Table 2. Figure 8 The Ct values of the candidate reference genes changed in the range of 15.44-31.09, and the difference in the Ct values ranked CuHTR4 < CuSUMO1 < CuTPI1. The results of the geNorm, NormFinder, Bestkeeper and DeltaCt analysis are shown in Table 3. Figure 9 The results of NormFinder and DeltaCt analysis showed that the most stable gene in all samples was CuSUMO1; the Bestkeeper analysis showed that the most stable gene in all samples was CuHTR4; the geNorm analysis showed that the most stable genes in all samples were CuSUMO1 and CuHTR4.

[0063] According to the analysis results of Refiner software, the comprehensive ranking is shown in Table 4, and finally the most stable RT-qPCR reference gene with reference value in the Jin Foshan bamboo under different treatments is obtained, that is, the CuSUMO1 gene, which is used as a reference gene in the RT-qPCR of the Jin Foshan bamboo under different treatments. CuHTR4 gene, as a reference gene, is used in the RT-qPCR of different stress samples, and the difference between them is not large. Therefore, CuSUMO1 and CuHTR4 can be used as stable reference genes for the Jin Foshan bamboo.

[0064] Table 4 Comprehensive analysis of the stability of the candidate reference genes by Refiner software

[0065]

[0066] The above-described embodiments are only preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements of the technical solutions of the present application made by those skilled in the art shall fall within the protection scope of the present application.

Claims

1. The application of CuSUMO1 and CuHTR4 as internal reference genes for quantitative analysis of Phyllostachys edulis genes in Jinfoshan, characterized in that, The nucleotide sequence of CuSUMO1 is shown in SEQ ID NO.2, and the nucleotide sequence of CuHTR4 is shown in SEQ ID NO.

3.

2. The application of CuSUMO1 as described in claim 1 as an internal reference gene for quantitative analysis of Phyllostachys edulis genes in different tissues.

3. The application of CuSUMO1 as described in claim 1 as an internal reference gene for quantitative analysis of Phyllostachys edulis genes at different developmental stages.

4. The application of CuSUMO1 as described in claim 1 as an internal reference gene for quantitative analysis of Phyllostachys edulis genes under different stress conditions.

Images