SNP (Single Nucleotide Polymorphism) molecular marker related to oxidative stress resistance of Tibetan sheep and application of SNP molecular marker

Abstract

The invention relates to the technical field of molecular markers, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to the oxidative stress resistance of Tibetan sheep and application of the SNP molecular marker. The invention relates to an SNP (Single Nucleotide Polymorphism) molecular marker related to the oxidative stress resistance of Tibetan sheep, the molecular marker is located at the 196714361th basic group on the No.3 chromosome of the international sheep genome Oarv4.0 version, and the mutant basic group is A or C. The content of the antioxidant stress index T-AOC of a Tibetan sheep individual can be judged by detecting the basic group of the 196714361th nucleotide site on the No.3 chromosome of the Tibetan sheep, and a new SNP molecular marker resource is provided for non-diagnostic Tibetan sheep antioxidant stress character marker-assisted selection.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, and in particular to a SNP molecular marker related to the anti-oxidative stress ability of Tibetan sheep and an application thereof. Background Art

[0002] Tibetan sheep are an important part of grassland animal husbandry in the high-altitude pastoral areas of the Qinghai-Tibet Plateau. The characteristics of the Qinghai-Tibet Plateau are: high altitude, low air pressure, strong ultraviolet rays, hypoxia, etc. Due to the harsh environment in the Qinghai-Tibet Plateau, a series of non-specific reactions will be caused in Tibetan sheep, mainly immune stress, cold stress and oxidative stress, among which oxidative stress is the main one. After being stimulated by stressors, Tibetan sheep destroy the dynamic balance of the oxidation system and antioxidant system in the body. The antioxidants in the body are mainly composed of two major types of substances, one is antioxidant enzymes; the other is non-enzymatic antioxidants. The antioxidant effect of this system is mainly achieved through the following three pathways: eliminating free radicals and active oxygen to avoid inducing lipid peroxidation; decomposing peroxides and blocking peroxidation chains; removing catalytic metal ions. The total antioxidant capacity (Total Antioxidant Capacity, T-AOC) is the main indicator reflecting the total antioxidant level of the body's enzymatic and non-enzymatic systems. In the prior art, there are many studies on the relationship between exercise, free radicals and antioxidant systems, but there are few studies on the adaptive regulation of Tibetan sheep, a plateau native animal, in different degrees of hypoxic environments.

[0003] By testing the content of total antioxidant capacity, the oxidative stress capacity and health status of Tibetan sheep can be evaluated. By testing the indicators of antioxidant stress, the oxidative stress response capacity of Tibetan sheep can be discovered in time, and certain measures can be taken to improve their oxidative stress capacity, so that they can better adapt to the harsh environmental conditions of the Qinghai-Tibet Plateau, and provide a basis for the auxiliary breeding of Tibetan sheep.

[0004] With the rapid development of molecular marker technology, the mutation sites in genes are searched from the gene level, and the relationship between genes and traits is discovered through the association analysis between genes and traits, and early selection is carried out to improve the selection efficiency and accuracy, which can fundamentally improve the oxidative stress capacity of Tibetan sheep and has broad application value. Therefore, molecular markers have laid the foundation for people to study the genetic mechanism of the oxidative stress capacity of Tibetan sheep at the molecular level. Screening corresponding molecular markers for more efficient use in the breeding of Tibetan sheep is an important issue in this field. There are not many studies on molecular markers related to the oxidative stress capacity of Tibetan sheep in the prior art for assisted breeding. It is particularly important to provide a molecular marker related to the oxidative stress capacity of Tibetan sheep, so as to be used in the molecular marker-assisted breeding of Tibetan sheep and screen Tibetan sheep with strong anti-oxidative stress ability. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to the anti-oxidative stress ability of Tibetan sheep and application thereof.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides a SNP molecular marker related to the antioxidant stress resistance of Tibetan sheep. The molecular marker is located at the 196714361st base on chromosome 3 of the international sheep genome Oar_v4.0 version, and the mutant base is A or C.

[0008] Preferably, the genotype of the Tibetan sheep with the mutant base A is AA or AC;

[0009] The genotype of Tibetan sheep with the mutant base C is CC;

[0010] The anti-oxidative stress index T-AOC of the CC genotype Tibetan sheep individuals was significantly higher than that of the AA genotype individuals;

[0011] There was no significant difference in the anti-oxidative stress index T-AOC between the Tibetan sheep individuals with AA and AC genotypes;

[0012] There was no significant difference in the anti-oxidative stress index T-AOC between the AC and CC genotype Tibetan sheep individuals.

[0013] The present invention also provides the use of the SNP molecular marker in marker-assisted selection of Tibetan sheep anti-oxidative stress traits for non-diagnostic purposes.

[0014] The present invention also provides application of the SNP molecular marker in Tibetan sheep assisted breeding.

[0015] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the primer pair is shown in SEQ ID NO. 2-3.

[0016] The present invention also provides the use of the primer pair in preparing a marker-assisted selection product for the antioxidant stress trait of Tibetan sheep for non-diagnostic purposes.

[0017] The present invention also provides application of the primer pair in preparing Tibetan sheep auxiliary breeding products.

[0018] The present invention also provides a method for marker-assisted selection of Tibetan sheep anti-oxidative stress traits for non-diagnostic purposes, comprising the following steps:

[0019] (1) Extracting Tibetan sheep genomic DNA;

[0020] (2) using the Tibetan sheep genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0021] (3) Performing genotyping analysis on the amplified products to obtain Tibetan sheep with different genotypes; correlating the genotypes of the Tibetan sheep with anti-oxidative stress indicators; the anti-oxidative stress indicators include total antioxidant capacity.

[0022] Preferably, the amplification system in step (2) is: 22 μL of Gold Mix (green), 1 μL of upstream and downstream primers, and 1 μL of template DNA;

[0023] The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 59°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

[0024] The present invention also provides a kit for marker-assisted selection of Tibetan sheep anti-oxidative stress traits and / or Tibetan sheep assisted breeding for non-diagnostic purposes, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The SNP molecular marker described in the present invention is located at the 196714361th base on chromosome 3 of the international sheep reference genome Oar_v4.0 version; the variation type is A / C, named g196714361A>C, and there are three genotypes. When the 196714361th base on chromosome 3 is A, the genotype is AA or AC; when the 196714361th base on chromosome 3 is C, the genotype is CC; through the association analysis of different genotypes with the content of anti-oxidative stress index T-AOC, it is found that the anti-oxidative stress index T-AOC of Tibetan sheep individuals with CC genotype is significantly higher than that of individuals with AA genotype (p<0.05), the anti-oxidative stress index T-AOC of Tibetan sheep individuals with AA and AC genotypes is not significantly different (p>0.05), and the anti-oxidative stress index T-AOC of Tibetan sheep individuals with AC and CC genotypes is not significantly different (p>0.05).

[0027] The present invention can determine the content of T-AOC, an antioxidant stress index, in individual Tibetan sheep by detecting the base at the 196714361th nucleotide site on chromosome 3 of Tibetan sheep. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0029] Figure 1 It is the amplification product of SNP site detected by agarose gel electrophoresis, where M represents Marker; 1, 2, and 3 represent 3 groups of repeats;

[0030] Figure 2 The peak diagram and sequence are obtained after the PCR amplification product is purified and sequenced. DETAILED DESCRIPTION

[0031] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0032] Example 1

[0033] 1. Sample Collection

[0034] The samples came from Tibetan sheep populations under natural grazing conditions, including 58 samples from Gannan Tibetan Autonomous Prefecture, Gansu Province, 50 samples from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 67 samples from Shigatse City, Tibet Autonomous Region. 5 mL of blood samples were collected from 175 fasting Tibetan sheep and placed in a clean pro-coagulant vacuum blood collection tube, left to stand for 30 minutes, and then centrifuged at 3500r / min for 15 minutes. The supernatant was aspirated into a clean PE tube, which was sealed and stored in a -20℃ low-temperature refrigerator. Another 5 mL of blood sample was collected in a blood collection tube with EDTA-K2 anticoagulant added. After the blood sample was collected, it was quickly mixed and temporarily stored in a sampling box containing ice packs. After being transported back to the laboratory, it was frozen in a -20℃ refrigerator for extraction of genomic DNA.

[0035] 2. Main reagents and instruments

[0036] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebaugh Technology Co., Ltd.; Gold Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. The total antioxidant capacity T-AOC (A015-2-1) detection kit was purchased from Nanjing Jiancheng Bioengineering Institute.

[0037] 3. Methods

[0038] 3.1 Detection of T-AOC in serum

[0039] The ABTS method was used to determine the T-AOC detection kit of Nanjing Jiancheng Bioengineering Institute. The determination steps are as follows: (1) add 10 μL of double distilled water and 20 μL of reagent IV application solution (reagent I and peroxidase are mixed at a ratio of 9:1) to the blank tube, add 10 μL of MTrolox solution of different concentrations and 20 μL of reagent IV application solution to the standard tube, and add 10 μL of serum to be tested and 20 μL of reagent IV application solution to the test tube; (2) add 170 μL of ABTS working solution (reagent I: reagent II: reagent III application solution = 76:5:4) to the blank tube, standard tube and test tube; (3) react at room temperature for 6 minutes, and read the OD value of each well at a wavelength of 405 nm using an enzyme reader; (4) prepare a standard curve using the standard OD and obtain the curve formula, and substitute the OD measured in the sample test tube into the calculation formula to obtain the result.

[0040] 3.2 Extraction of genomic DNA from blood

[0041] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was greater than 20 ng / μL and OD260 / OD280 was between 1.7 and 1.9, which met the experimental requirements. It was stored at -20°C for future use.

[0042] 3.3 Primer design

[0043] Referring to the chromosome 3 gene sequence of the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019460.2), a pair of specific primers including the g196714361A>C SNP site were designed using primerpremier5.0 software.

[0044] Primer sequences:

[0045] F: 5'-CAAGAATACTTTGCCATTCCCT-3'; (SEQ ID NO. 2)

[0046] R: 5'-TGGCATGACTGACTCAATGGAC-3' (SEQ ID NO. 3).

[0047] The length of the amplified fragment was 412 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0048] 3.4 PCR amplification and sequencing

[0049] PCR amplification system 25 μL: Gold Mix (green) 22 μL, upstream and downstream primers 1 μL each, template 1 μL.

[0050] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 59°C for 10 s, 72°C for 10 s, for a total of 40 cycles; extension at 72°C for 2 min.

[0051] The PCR product was detected by 1.5% agarose gel electrophoresis. After the PCR product was qualified by agarose gel electrophoresis, it was sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO.1, and the SNP marker is located at position 266 of the nucleotide sequence shown in SEQ ID NO.1.

[0052] The biological analysis software MEGA 6.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0053] 4 Statistical analysis

[0054] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g196714361A>C gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the anti-oxidative stress index T-AOC, and the results were expressed as "mean ± standard error".

[0055] 5 Results

[0056] 5.1 PCR amplification and sequencing results

[0057] The amplified product of the g196714361A>C SNP site on chromosome 3 of Tibetan sheep was detected by 1.5% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 412bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0058] SEQ ID NO.1:

[0059] CAAGAATACTTTGCCATTCCCTTCTCCAGTGGACCATGTTTTGTCAGAAATTTCCACTATTACCTGTCCATCTTGGTTGGCCCTATACAGCGTGGCTCATAGTTTCATTGAGTTAGACAAGGCTATGGTCCATGTGATCAGTTAGGTTAGTTTTCTGTGACTGTGGTTTTTCAGTCTGTCTGCCCTCTGATGAATGAAGATAAGAGG CTTATAGAAGCTTCCTGATGGGAGAGACTGACTGTGGGGGGAATCTAGGTCTTGTTCTGATGGGCAGGGCCATGCTCGGTTGAGTTCAGTCACTCAGTCCTGTCTGACTCTTTGTGACCCCACAAACTGCAGCACACAAGGCCTCCCTGTCTATCACCAACTCCCAGAGTTCACCCAAACTCATGTCCATTGAGTCAGTCATGCCA.

[0060] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that the AC mutation occurred at the g196714361A>CSNP site, and there are three genotypes: AA, AC, and CC.

[0061] 5.2 Statistical analysis results

[0062] The genotype and allele frequencies of the g196714361A>C SNP locus on chromosome 3 of Tibetan sheep were analyzed from the perspective of population genetics. As shown in Table 1, at the g196714361A>C SNP locus, the CC genotype frequency was the highest, which was the dominant genotype, and the C allele frequency was 72.3%, which was the dominant allele. The χ2 fitness test showed that the SNP locus deviated significantly from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.401, the PIC was 0.320, and 0.25<PIC<0.50, which was moderately polymorphic.

[0063] Table 1 Polymorphism of the g196714361A>C SNP locus on chromosome 3 of Tibetan sheep

[0064]

[0065] 2.3 Association analysis between different genotypes and the antioxidant stress index T-AOC

[0066] The general linear model in IBM SPSS Statistics 22 software was used to analyze the correlation between different genotypes of Tibetan sheep and the content of T-AOC, an indicator of antioxidant stress. The results showed that the T-AOC of the CC genotype Tibetan sheep was significantly higher than that of the AA genotype (p<0.05), and the difference in T-AOC of the AA and AC genotypes was not significant (p>0.05), and the difference in T-AOC of the AC and CC genotypes was not significant (p>0.05), indicating that the base of the g196714361A>C SNP site on chromosome 3 of Tibetan sheep is significantly correlated with T-AOC of Tibetan sheep, and is a SNP marker related to T-AOC of Tibetan sheep. The results are shown in Table 2.

[0067] Table 2 Correlation analysis between different genotypes and the anti-oxidative stress index T-AOC

[0068]

[0069] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0070] In summary, the SNP molecular marker described in the present invention is located at the 196714361th base on chromosome 3 of the international sheep reference genome Oar_v4.0 version; the variation type is A / C, named g196714361A>C, and there are three genotypes. When the 196714361th base on chromosome 3 is A, the genotype is AA or AC; when the 196714361th base on chromosome 3 is C, the genotype is The type is CC; through the association analysis between different genotypes and the content of antioxidant stress index T-AOC, it was found that the antioxidant stress index T-AOC of Tibetan sheep individuals with the CC genotype was significantly higher than that of individuals with the AA genotype (p<0.05), the antioxidant stress index T-AOC of Tibetan sheep individuals with AA and AC genotypes was not significantly different (p>0.05), and the antioxidant stress index T-AOC of Tibetan sheep individuals with AC and CC genotypes was not significantly different (p>0.05).

[0071] The present invention can determine the content of T-AOC, an antioxidant stress index, in individual Tibetan sheep by detecting the base at the 196714361th nucleotide site on chromosome 3 of Tibetan sheep. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes.

[0072] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP molecular marker related to the anti-oxidative stress ability of Tibetan sheep, characterized in that: The molecular marker is located at the 196714361th base on chromosome 3 of the international sheep genome Oar_v4.0 version, and the mutant base is A or C.

2. The molecular marker according to claim 1, characterized in that The genotype of Tibetan sheep with the mutant base A is AA or AC; The genotype of Tibetan sheep with the mutant base C is CC; The anti-oxidative stress index T-AOC of the CC genotype Tibetan sheep individuals was significantly higher than that of the AA genotype individuals; There was no significant difference in the anti-oxidative stress index T-AOC between the Tibetan sheep individuals with AA and AC genotypes; There was no significant difference in the anti-oxidative stress index T-AOC between the AC and CC genotype Tibetan sheep individuals.

3. Use of the SNP molecular marker described in claim 1 or 2 in marker-assisted selection of anti-oxidative stress traits in Tibetan sheep for non-diagnostic purposes.

4. Use of the SNP molecular marker according to claim 1 or 2 in Tibetan sheep assisted breeding.

5. A primer pair for amplifying the SNP molecular marker according to claim 1 or 2, characterized in that: The primer pair is shown in SEQ ID NO. 2-3.

6. Use of the primer pair according to claim 5 in preparing a marker-assisted selection product for the antioxidant stress trait of Tibetan sheep for non-diagnostic purposes.

7. Use of the primer pair described in claim 5 in preparing Tibetan sheep assisted breeding products.

8. A method for marker-assisted selection of anti-oxidative stress traits in Tibetan sheep for non-diagnostic purposes, characterized in that: The steps include: (1) Extracting Tibetan sheep genomic DNA; (2) using the Tibetan sheep genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair described in claim 5 to obtain an amplified product; (3) Performing genotyping analysis on the amplified products to obtain Tibetan sheep with different genotypes; correlating the genotypes of the Tibetan sheep with anti-oxidative stress indicators; the anti-oxidative stress indicators include total antioxidant capacity.

9. The method according to claim 8, characterized in that The amplification system in step (2) is: 22 μL of Gold Mix (green), 1 μL of upstream and downstream primers, and 1 μL of template DNA; The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 59°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

10. A kit for marker-assisted selection of Tibetan sheep antioxidant stress traits and / or Tibetan sheep assisted breeding for non-diagnostic purposes, characterized in that: It comprises a reagent for detecting the SNP molecular marker according to claim 1 or 2 or a primer pair according to claim 5.

Images