Molecular marker primer group for identifying strength of peanut stalks and application of molecular marker primer group

Abstract

The invention belongs to the field of plant genetic breeding, and particularly discloses a molecular marker primer group for peanut stem strength identification and application, a site significantly related to the stem strength is identified by using whole genome association analysis, and the molecular marker is an SNP site 231358672, located on a peanut A02 chromosome and located at 31358672bp; the sequences of 100 bp before and after the SNP site 231358672 are respectively shown as SEQ ID NO. 1; when the genotype of the SNP locus 231358672 is C / C, the corresponding peanut stalk strength is high, and when the genotype is A / C, the stalk strength is poor; peanut varieties which are high in stalk strength and suitable for mechanization can be identified and screened in the early stage through the molecular marker, so that the production cost is greatly saved, and the production efficiency is improved.

Description

Technical Field

[0001] The invention relates to the field of plant genetic breeding, in particular to a primer set of molecular markers for identifying the strength of peanut stalks and applications thereof. Background Art

[0002] Peanut is one of the important oil crops and cash crops, and is grown worldwide. Peanut is also the main source of protein, edible oil and vitamins, and occupies an important position in my country. Peanut stems support the structure of the aboveground part of peanuts and transport nutrients. With the continuous expansion of the main planting area of ​​peanut production, improving production efficiency is an important goal of peanut production. Therefore, mechanized production has become the development direction of peanut production. Stalk strength is an important factor affecting peanut mechanization. Stalk lodging is a serious problem that affects crop yield and quality. Studies in recent years have shown that strong stalks can significantly reduce the frequency of lodging. Among rapeseed, ZS11 is a rapeseed variety with strong adaptability, good stable yield and strong lodging resistance. High stem mechanical strength is the main factor determining the excellent lodging resistance of ZS11.

[0003] With the rapid development of high-throughput sequencing technology, genome-wide association studies (GWAS) are being used more and more widely. GWAS links observable traits, i.e. phenotypes, to genotypes, and then screens out genetic variants (markers) that are most likely to affect the trait, and mines genes associated with trait variation. Since the first GWAS study on age-related (retinal) macular degeneration was reported in Science magazine in 2005 (Klein et al. 2005), a series of GWAS-related studies have also been reported. In recent years, GWAS has been widely used in the field of plant research. For example, Mazaheri et al. used a set of 942 maize inbred lines and 899,784 RNA-Seq-derived single nucleotide polymorphism (SNP) markers to discover 16 candidate genes associated with four stalk traits through GWAS analysis (Mazaheri et al. 2019). GWAS is also widely used in peanut research. Zhou et al. (Zhou et al. 2021) used peanut mini-core germplasm as material and adopted the method of whole-genome association analysis to identify 57 SNP sites significantly associated with pod size traits.

[0004] The stem plays a vital role in plants. It supports the plant shape and transports nutrients. For underground fruiting crops such as peanuts, the stem strength is too weak and the stem is prone to breakage or bending, which seriously affects the yield. Therefore, it is necessary to study the stem strength. However, there is no relevant research on the stem strength of peanuts.

[0005] Chinese patent application number CN201810060028.2 discloses a primer set for detecting the rice lodging resistance gene SCM3, wherein the gene SCM3 includes three SNP molecular markers, namely K_030531, K_030532, and K_030533, wherein the polymorphic base of K_030531 is C or T, the polymorphic base of K_030532 is T or C, and the polymorphic base of K_030533 is C or G. By using the molecular markers, the lodging resistance SCM3 gene can be detected quickly and accurately, greatly improving the efficiency of gene transfer.

[0006] However, the above primer set is used for the rice lodging resistance gene SCM3, and the gene of rice is different from that of peanut. The above primer set and molecular markers cannot be used to identify the stem strength of peanut. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a primer set of molecular markers for identifying the strength of peanut stalks and its application.

[0008] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0009] One of the purposes of the present invention is to provide a primer set of molecular markers for identifying peanut stalk strength, the primer set comprising:

[0010] primer_X: GAAGGTGACCAAGTTCATGCTGCGCGAAATTGTGAACAATAC (SEQ ID NO. 2);

[0011] primer_Y: GAAGGTCGGAGTCAACGGATTGCGCGAAATTGTGAACAATAA (SEQ ID NO.3);

[0012] primer_C: GCTGGTTAGTTGTGCGAAGTT (SEQ ID NO.4);

[0013] The molecular marker is SNP site 2_31358672, located on peanut chromosome A02 at 31358672bp; the sequence of 100bp before and after the SNP site 2_31358672 is shown in SEQ ID NO.1.

[0014] The second object of the present invention is to provide a primer set of molecular markers for identifying peanut stalk strength in identifying high-strength peanut stalks for peanut breeding, comprising the following steps:

[0015] S1, extracting DNA from the young leaves of peanuts to be identified, and using a molecular marker primer set to perform polymerase chain reaction (PCR) identification;

[0016] S2. If the genotype of SNP site 2_31358672 is C / C, the stalk strength of the peanut to be identified is high; if the genotype of SNP site 2_31358672 is A / C, the stalk strength of the peanut to be identified is poor. Further, the PCR reaction system is 5 μL DNA, 5 μL 2×KASP MasterMix and 0.14 μL mixed primers (primer_X, primer_Y and primer_C are mixed in a ratio of 1:1:2.5); the PCR reaction program is 94°C for 15 min; 94°C for 20 s, 61-55°C for 60 s, cooling at a rate of 0.6°C / cycle, 10 cycles; 94°C for 20 s, 55°C for 60 s, 26 cycles.

[0017] Compared with the prior art, the present invention identifies a site that is significantly correlated with stalk strength. The site is located at base 31358672bp on chromosome A02. When the genotype is C / C, the corresponding peanut stalk strength is high, and when the genotype is A / C, the stalk strength is poor. This molecular marker can be used to identify and screen peanut varieties with high stalk strength and suitable for mechanization at an early stage, thereby greatly saving production costs and improving production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Normal distribution diagram of stem strength under different planting environments: A, ZC environment; B, ZJ environment; C, HN environment; D, BLUP environment.

[0019] Figure 2 For population structure analysis: A. Admixture calculates the optimal k value; B. Admixture performs population structure analysis and infers the population structure when k=4 through analysis. A single vertical line represents a variety and each color represents a population; C. Linkage disequilibrium diagram.

[0020] Figure 3 is the distribution of SNPs across the whole genome.

[0021] Figure 4 Manhattan plot and QQplot of peanut culm strength obtained using the GLM method of TASSEL software for ZC environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0022] Figure 5Manhattan plot and QQplot of peanut culm strength obtained using the GLM method of TASSEL software for ZJ environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0023] Figure 6 Manhattan plot and QQplot of peanut culm strength obtained using the GLM method of TASSEL software for HN environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0024] Figure 7 The BLUP values ​​(Best Linear Unbiased Prediction Values) calculated to correct the stalk strength were used. The Manhattan plot and QQplot of peanut stalk strength were obtained using the GLM method of TASSEL software: (a) Manhattan plot; (b) QQplot.

[0025] Figure 8 Manhattan plot and QQplot of peanut culm strength obtained using the mrMLM software package for ZC environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0026] Fig. 9 Manhattan plot and QQplot of peanut culm strength using the mrMLM software package for ZJ environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0027] Fig.10 Manhattan plot and QQplot of peanut culm strength obtained using the mrMLM software package for HN environmental phenotypic data: (a) Manhattan plot; (b) QQplot.

[0028] Fig.11 Manhattan plot and QQplot of peanut stalk strength obtained using mrMLM software package: (a) Manhattan plot; (b) QQplot.

[0029] Fig.12 Manhattan plot of peanut stalk strength obtained using the 3vmrMLM package for ZC environmental phenotypic data.

[0030] Fig.13 Manhattan plot of peanut stalk strength obtained using the 3vmrMLM package for the ZJ environmental phenotypic data.

[0031] Fig.14 Manhattan plot of peanut stalk strength obtained using the 3vmrMLM package for HN environmental phenotypic data.

[0032] Fig.15The data were used to calculate the BLUP values ​​(Best Linear Unbiased Predictors) corrected for stalk strength. The Manhattan plot of peanut stalk strength was obtained using the 3vmrMLM software package.

[0033] Fig.16 This is the haplotype analysis diagram of site 2__31358672: A, BLUP environment; B, ZC environment; C, HN environment.

[0034] Fig.17 It is a sequencing fragment containing 2__31358672 variable sites. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0036] Example 1: Identification of loci significantly associated with culm strength

[0037] 1. Field trial design

[0038] 122 peanut materials were planted in three environments in 2022 and 2023, namely, the Zengcheng Teaching and Research Base of South China Agricultural University in Zengcheng, Guangzhou, China (denoted as ZC), Zhanjiang Academy of Agricultural Sciences (denoted as ZJ), and Hainan Nanbin Farm (denoted as HN), as shown in Table 1. The field planting in the three environments adopted a completely randomized block design. There were 15 plants for each variety, with a row spacing of 80 cm and a plant spacing of 15 cm. The field management was consistent with conventional field management.

[0039] Table 1122 Peanut materials field planting number, sequencing number and planting environment

[0040]

[0041]

[0042]

[0043] 2. Stem strength determination

[0044] According to the method published in previous literature, the stalk strength tester was used to measure the second internode of the peanut stalk during the peanut harvest period. The "fracture method" was selected for three replicates. Statistical analysis of peanut stalk strength in different environments is shown in Figure 2. Figure 1 And as shown in Table 2.

[0045] Table 2 Statistical analysis of stem strength phenotype

[0046]

[0047] 3. Phenotypic Data Processing

[0048] Microsoft Office Excel was used to organize the raw data, and SPSS Statistics Version 24 (IBM SPSS, IBM Corp, Armonk, NY, USA) was used to perform statistical analysis on the phenotypic data. The variance analysis used the one-way ANOVA test method to compare the mean values. According to the estimated variance components, the formula was: H 2 =σ 2 g / (σ 2 g+σ 2 e / r) to determine the broad-sense heritability of culm strength, where σ 2 g、σ 2 e represents the genotype variance and environmental variance, and r is the number of environmental experiments.

[0049] 4. Genotype Data Analysis

[0050] Genotype data were obtained from Shandong Academy of Agricultural Sciences. Genomic DNA was extracted from young leaves using a plant genomic DNA extraction kit, and library construction and amplification were performed according to the standard protocols specified by the Illumina HiSeq 4000 sequencer and the BGISEQ500 sequencer. Using the Tifrunner genome as the reference genome, 122 peanut materials were resequenced. Figure 2is a population structure analysis, where A is the optimal k value calculated using Admixture software; B is a population structure analysis using Admixture software, and the population structure inferred by the analysis is k=4, a single vertical line represents a variety, and each color represents a population; C is a linkage disequilibrium map. Cultivated peanut or peanut (Arachis hypogaea L.) is an allotetraploid, Arac his hypogaea L belongs to the Leguminosae family, and can be divided into two subspecies and six variants based on morphological characteristics: var.fastigiata, var.vulgaris, var.peruviana and var.aequatoriana belong to ssp.fastigiata, while var.hypogaea and var.hirsuta belong to ssp.hypogaea. In this experiment, 122 peanut germplasm resources were divided into four biological types: Valencia type (var.fastigiata), Spanish type (var.vulgais), Virginia type (var.peruviana) and Peruvian type (var.hypogaea). Population structure analysis also showed that 122 cultivated peanut accessions were divided into four subgroups. SOAPnuke (v1.6.0) was used to filter the data, and the data removed included: (1) sequencing adapter; (2) low-quality base ratio (base quality ≤ 12) of > 50%; (3) N (unknown base) ratio of > 10%. After data filtering, Sentieon DNAseq software was used to detect SNPs. First, the filtered data were mapped to the genome sequence of cultivated peanut (https: / / www.peanutbase.org / data / v2 / Arachis / hypogaea / genomes / Tifrunner.gnm1.KYV3). The Sentieon BWA model was used for alignment, and then the Sentieon Haplotyper model (the same algorithm as GATK) was used to name SNPs; finally, we used GATK to integrate multiple individual SNP sets of gVCF files into the final overall SNP set with VCF format. The distribution of SNPs across the whole genome is shown in Figure 2. Figure 3As shown. For the quality control of SNPs, the SelectVariables model in GATK was used to remove low-quality SNPs. The SelectVariables model parameters included: QualByDepth (QD≥2), FisherStrand (FS≤60), RMSMappingQuality (MQ≥40), MappingQualityRank SumTest (MQRankSum≥-12.5), ReadPosRankSum (ReadPosRankSum≥-8.0) and StrandOddsRatio (SOR>3.0). TASSEL was used to further screen high-quality SNPs, and the criteria were: Miss<=0.2 of the missing rate of the SNP site in the sample, and Maf>=0.05 of the minor allele frequency. Finally, 463,256 high-quality SNPs were obtained for subsequent association analysis.

[0051] 5. Genome-wide association analysis

[0052] ADMIXTURE software was used to analyze the population genetic structure of 122 peanut core germplasms based on polymorphic SNP loci. TASSEL 5.0 software was used for principal component analysis and phylogenetic evolutionary tree construction. In the genome-wide association analysis, the general linear model (GLM) of TASSEL 5.0 software, R package mrMLM and R package 3vmrMLM were used to analyze the association between SNPs and culm strength. The Manhattan plot and QQplot of the general linear model (GLM) of TASSEL 5.0 software were drawn using the R package qqman. The genome-wide significance threshold used by the TASSEL method was 0.05 / 463256=1.09e-7, -log10 (P value)=6.96. The genome-wide recommendation threshold was 1 / 463256=2.16e-6, -log10 (P value)=5.67. The threshold lines of mrMLM and 3vmrMLM were both LOD values ​​3. PopLDdecay (http: / / github.com / BGI-shenzhen / PopLDdecay) software was used to estimate the LD parameter (r) between two SNPs. 2 ). See Figure 4-Figure 15 The Manhattan plot and QQplot of peanut stalk strength obtained by using the GLM method of TASSEL software for ZC environmental phenotype data are shown in Figure 4 As shown; the Manhattan plot and QQplot of peanut stalk strength obtained by using the GLM method of TASSEL software for ZJ environmental phenotype data are shown in Figure 5As shown; the Manhattan plot and QQplot of peanut stalk strength obtained by using the GLM method of TASSEL software for HN environmental phenotype data are shown in Figure 6 As shown; the BLUP value (best linear unbiased prediction value) was calculated by correcting the stalk strength. The Manhattan plot and QQplot of peanut stalk strength obtained by the GLM method of TASSEL software are shown in Figure 7 As shown; the Manhattan plot and QQplot of peanut stalk strength obtained using the mrMLM software package for ZC environmental phenotype data are shown in Figure 8 As shown; the Manhattan plot and QQplot of peanut stalk strength obtained using the mrMLM software package for ZJ environmental phenotype data are shown in Fig. 9 As shown; the Manhattan plot and QQplot of peanut stalk strength obtained using the mrMLM software package for HN environmental phenotype data are shown in Fig.10 As shown; the BLUP value (best linear unbiased prediction value) was calculated by correcting the stalk strength. The Manhattan plot and QQplot of peanut stalk strength obtained using the mrMLM software package are shown in Fig.11 The Manhattan plot of peanut stalk strength obtained using the 3vmrMLM software package for ZC environmental phenotype data is shown in Fig.12 As shown; the Manhattan plot of peanut stalk strength obtained using the 3vmrMLM software package for ZJ environmental phenotype data is shown Fig.13 As shown; the Manhattan plot of peanut stalk strength obtained using the 3vmrMLM software package for HN environmental phenotype data is shown in Fig.14 As shown; the BLUP value (best linear unbiased prediction value) was calculated for the stem strength correction. The Manhattan plot of the peanut stem strength obtained using the 3vmrMLM software package is shown as Fig.15 shown.

[0053] Depend on Figure 4-Figure 15 It can be seen that the second environment (ZJ) had poor results, so the second environment (ZJ) was removed for subsequent analysis. The results were summarized. In the TASSEL results, a total of 92 loci were screened, and 13, 65 and 14 loci were detected in the three environments of ZC, HN and BLUP, respectively; a total of 41 loci were screened using the mrMLM software package, and 15, 12 and 15 loci were detected in the three environments of ZC, HN and BLUP, respectively; a total of 45 loci were screened using the IIIvmrMLM software package, and 15, 15 and 16 loci were detected in the three environments of ZC, HN and BLUP, respectively.

[0054] 6. Haplotype analysis of QTL loci for culm strength

[0055] Through association analysis, combining three methods, we obtained significant SNP loci related to peanut culm strength (see Table 3).

[0056] Table 3 SNPs co-localized by different methods

[0057]

[0058]

[0059] Haplotype analysis of these loci showed that the 2__31358672 genotype was obvious, and the genotype with high phenotypic value was C / C, while the genotype with low phenotypic value was A / C. It can be seen that locus 2__31358672 (chromosome A02, position 31358672bp) has obvious genotyping. When the genotype is C / C, the peanut stalk strength is good, and when the genotype is A / C, the stalk strength is poor ( Fig.16 ).

[0060] Example 3: Verification of associated sites

[0061] The 100 bp sequence before and after the 2__31358672 site in the reference genome was extracted, and the KASP marker was designed using the KASP (competitive allele-specific PCR) technology, and amplified and sequenced in 122 material populations. The DNA sequence of the peanut sample was amplified and sequenced using the following KASP primers. If the genotype of the 2__31358672 site is C / C, the peanut stalk strength is better, and when the genotype is A / C, the stalk strength is poor.

[0062] The sequence is as follows:

[0063] CATAAGCTTCTTCCTCAGATGAAGCTTCCTTAGTACTGCTTGGGTGCATT

[0064] TTGCATTTTGATTATTAACAAAAACTTGGTGCCGAAATTGTGAACAATA C T

[0065] TTTCACAACTCTCATAATCCCCGGTCATGAACCCCAAAAACATGGTAGCTC

[0066] AATACCATGGCATTACACAACTTCGCACAACTAACCAGCAAGTGCAC

[0067] (SEQ ID NO.1, the underline indicates the position of the site), see Fig.17 .

[0068] Primers were designed according to the above sequences using Primer 5.0 software (http: / / www.premierbiosoft.com / index.html), and were synthesized by Bioengineering (Shanghai) Co., Ltd.

[0069] primer_X: GAAGGTGACCAAGTTCATGCTGCGCGAAATTGTGAACAATA C (SEQ ID NO. 2);

[0070] primer_Y: GAAGGTCGGAGTCAACGGATTGCGCGAAATTGTGAACAATA A (SEQ ID NO.3);

[0071] primer_C: GCTGGTTAGTTGTGCGAAGTT (SEQ ID NO.4);

[0072] The reaction system for PCR amplification was 5 μL DNA, 5 μL 2×KASP MasterMix and 0.14 μL mixed primers (primer_X, primer_Y and primer_C were mixed in a ratio of 1:1:2.5). The PCR reaction program was 94°C for 15 min; 94°C for 20 s, 61-55°C for 60 s, 10 cycles (touch-down, 0.6°C lowered per cycle); 94°C for 20 s, 55°C for 60 s, 26 cycles.

[0073] Among them, 2×KASP Master Mix is ​​a universal test kit of LGC (Laboratory of the Government Chemist), which is applicable to all KASP tests and should be operated according to the product instructions.

[0074] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A primer set for molecular markers for identifying peanut stalk strength, characterized in that: The primer set comprises: primer_X: GAAGGTGACCAAGTTCATGCTGCGCGAAATTGTGAACAATA C (SEQ ID NO. 2); primer_Y: GAAGGTCGGAGTCAACGGATTGCGCGAAATTGTGAACAATA A (SEQ ID NO.3); primer_C: GCTGGTTAGTTGTGCGAAGTT (SEQ ID NO.4); The molecular marker is SNP site 2_31358672, located on peanut chromosome A02 at 31358672bp; the sequence of 100bp before and after the SNP site 2_31358672 is shown in SEQ ID NO.

1.

2. Use of the molecular marker primer set for identifying peanut stalk strength as claimed in claim 1 in identifying high-strength peanut stalks in peanut breeding.

3. The use of the molecular marker primer set for identifying peanut stalk strength according to claim 2 in identifying high-strength peanut stalks in peanut breeding, characterized in that: The following steps are involved: S1, extracting DNA from young leaves of peanut to be identified, and performing PCR identification using a molecular marker primer set; S2. If the genotype of the SNP site 2_31358672 is C / C, the stalk strength of the peanut to be identified is high; if the genotype of the SNP site 2_31358672 is A / C, the stalk strength of the peanut to be identified is poor.

4. The use of the molecular marker primer set for identifying peanut stalk strength according to claim 3 in identifying high-strength peanut stalks in peanut breeding, characterized in that: The PCR reaction system was 5 μL DNA, 5 μL 2×KASP MasterMix, and 0.14 μL mixed primers (primer_X, primer_Y, and primer_C were mixed in a ratio of 1:1:2.5); the PCR reaction program was 94°C for 15 min; 94°C for 20 s, 61-55°C for 60 s, cooling at a rate of 0.6°C / cycle, 10 cycles; 94°C for 20 s, 55°C for 60 s, 26 cycles.

Images