SNP (Single Nucleotide Polymorphism) marker related to carotenoid content of sweet potato root tuber, primer group for detecting marker and application

Abstract

The invention relates to the technical field of sweet potato breeding. The invention provides an SNP (Single Nucleotide Polymorphism) marker related to the carotenoid content of sweet potato tuberous roots, a primer group for detecting the marker and application of the SNP marker. The nucleotide sequence of the SNP marker is shown as SEQ ID NO. 1. The KASP technology is utilized to obtain SNP typing, the carotenoid content of the sweet potato tuberous roots can be accurately and efficiently identified, and the method can be used for sweet potato molecular marker-assisted selective breeding. According to the provided detection method and kit, the phenotype selection efficiency of the developed SNP marker reaches 97.56% through sweet potato natural population phenotype identification and verification, the content of carotenoid in sweet potato tuberous roots can be rapidly and accurately detected, and the detection method and kit have the advantages of being easy and convenient to operate, low in cost and the like and can meet the requirement for large-scale molecular marker-assisted selection.

Description

Technical Field

[0001] The invention relates to the technical field of sweet potato breeding, and in particular to a SNP marker related to the carotenoid content of sweet potato root tubers, a primer set for detecting the marker and an application thereof. Background Art

[0002] Carotenoids are widely present in the chromoplasts of plant leaves, flowers and fruits, and play a very important role in photosynthesis and lipid peroxidation in chloroplasts. Carotenoids are important nutrients for humans, but humans cannot synthesize them themselves and can only take them in through food. Carotenoids play an indispensable role in the growth and development of both plants and humans.

[0003] Sweet potatoes have comprehensive and balanced nutritional value and significant health functions. Sweet potato tubers are rich in starch, dietary fiber, polyphenols, carotenoids and other substances, especially β-carotene. The content of β-carotene in 100g of fresh potatoes can reach 20mg, which is the best food recommended by the World Health Organization. Vitamin A deficiency is a serious health problem in developing countries, which can cause night blindness and premature death. Vitamin A-fortified sweet potatoes are one of the six major food crops in the International Biofortification Project. Cultivated sweet potatoes are hexaploid, with a highly heterozygous genetic background, and there are extensive hybridization and self-incompatibility. These physiological characteristics add obstacles to the construction of sweet potato genetic populations, so the QTLs obtained by constructing genetic population linkage analysis are still relatively small, and the positioning intervals of most QTLs are large, making it difficult to clone genes or even to precisely locate them. Relying solely on linkage analysis to mine QTLs limits its further research and application in breeding.

[0004] Genome-wide association study (GWAS) is a method for gene localization in natural populations based on the principle of linkage disequilibrium. This method does not require the construction of a genetic population, has high localization accuracy, a short cycle, and can discover a wide range of variants. It has been widely used in gene localization of animals and plants, and has cloned multiple genes with significant application value. It is a powerful means of gene mining.

[0005] GWAS analysis has high accuracy and can accurately identify single SNP sites, which can directly find causal mutations. Therefore, the GWAS method has been widely used in the key gene mining of important agronomic traits of different crops, which can greatly shorten the time of gene positioning and reduce labor intensity. It provides new ideas for the study of genetic molecular mechanisms of important agronomic traits of sweet potatoes and promotes the transformation of traditional sweet potato breeding to efficient and accurate molecular breeding.

[0006] Single nucleotide polymorphisms (SNPs) are a new generation of polymorphic genetic markers following restriction enzyme fragment length polymorphisms, variable number repeat sequences and microsatellite polymorphisms. KASP technology (competitive allele-specific PCR) is one of the mainstream methods for SNP typing in the world, and can accurately determine the biallelic nature of SNPs. This technology is based on the specific matching of primer terminal bases to type SNPs. KASP technology is used for large-scale detection of SNP marker gene typing, shortening marker verification time and reducing marker detection costs. It is an important method currently used in plant molecular marker positioning and large population scanning. KASP typing technology is based on its own unique PCR principle, which allows all site detections to ultimately use universal fluorescent primers for amplification, which greatly reduces the reagent cost of KASP. It has both the accuracy of the gold standard and reduced use costs, so KASP has very good application prospects in agricultural testing. Summary of the invention

[0007] The purpose of the present invention is to provide a SNP marker related to the carotenoid content of sweet potato root tubers and a primer set and application for detecting the marker. The SNP typing is obtained by using the KASP technology, which can accurately and efficiently identify the carotenoid content of sweet potato root tubers, and can be used for sweet potato molecular marker-assisted selection breeding.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The invention provides a SNP marker related to the carotenoid content of sweet potato root tubers. The nucleotide sequence of the SNP marker is shown as SEQ ID NO.1.

[0010] Preferably, the SNP marker is located at base 21056206 of chromosome 5 of sweet potato, and when the SNP genotype of the sample to be tested is C, the probability that the sample to be tested has a low carotenoid content is significantly higher than that of the genotype T;

[0011] When the SNP genotype is homozygous CC, the carotenoid content is low;

[0012] When the SNP genotype is homozygous TT, the carotenoid content is high;

[0013] When the SNP genotype is heterozygous CT, the carotenoid content is in the middle.

[0014] The present invention also provides a primer set for detecting the SNP marker, the primer set comprising a forward primer F1, a forward primer F2 and a reverse primer R;

[0015] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2;

[0016] The nucleotide sequence of the forward primer F2 is shown in SEQ ID NO.3;

[0017] The nucleotide sequence of the reverse primer R is shown in SEQ ID NO.4.

[0018] The present invention also provides application of the primer set in preparing a product for measuring the carotenoid content of sweet potato root tubers, wherein the product is a kit.

[0019] The invention also provides a kit for identifying the carotenoid content of sweet potato root tubers containing the primer set, and the kit comprises a primer set reagent and a detection reagent.

[0020] Preferably, the preparation method of the primer set reagent comprises the following steps:

[0021] (1) diluting the forward primer F1, forward primer F2 and reverse primer R to 80-120 μM with water to obtain a forward primer F1 solution, a forward primer F2 solution and a reverse primer R solution;

[0022] (2) Take 10 to 14 μL of forward primer F1 solution, 10 to 14 μL of forward primer F2 solution, and reverse primer R solution, mix them, and add water to 100 μL to obtain a primer set reagent;

[0023] The detection reagent is HiGeno 2×Probe MixA.

[0024] The present invention also provides a method for detecting the carotenoid content of sweet potato root tubers by using the kit, comprising the following steps: using the genomic DNA of the sweet potato to be detected as a template, performing KASP PCR amplification on the template by using the kit, and performing genotyping by using the amplification result.

[0025] Preferably, the amplification system used in the KASP PCR amplification is: 20-50 ng template, 4-6 uL detection reagent, 0.12-0.16 uL primer set reagent, and sterile water to 10 uL;

[0026] The reaction procedure of the KASP PCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 55°C-61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, annealing / extension at 55°C-61°C for 40 s, 30-34 cycles.

[0027] The present invention also provides application of the kit or the method in sweet potato breeding.

[0028] The present invention also provides a method for increasing the carotenoid content of sweet potatoes by using the kit or the method, comprising the following steps: performing genotype detection on the SNP marker located at the 21056206bp position of chromosome 5 in the sweet potato sample, and selecting the sweet potato sample with the genotype of TT for cultivation.

[0029] The present invention provides a SNP marker related to the carotenoid content of sweet potato root tubers and a primer set and application for detecting the marker, wherein the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1. The present invention uses KASP technology to obtain SNP typing, which can accurately and efficiently identify the carotenoid content of sweet potato root tubers, and can be used for sweet potato molecular marker assisted selection breeding. The provided detection method and kit, through the phenotypic identification of the natural population of sweet potatoes, verify that the phenotypic selection efficiency of the developed SNP marker reaches 97.56%, and can quickly and accurately detect the carotenoid content of sweet potato root tubers, has the advantages of simple operation and low cost, and can meet the needs of large-scale molecular marker assisted selection. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the typing result diagram of the SNP marker in the natural population.

[0031] Figure 2 Box plot of carotenoid content distribution in samples with different genotypes. DETAILED DESCRIPTION

[0032] The invention provides a SNP marker related to the carotenoid content of sweet potato root tubers. The nucleotide sequence of the SNP marker is shown as SEQ ID NO.1.

[0033] In the present invention, the SNP marker is located at the 21056206th base of chromosome 5 of sweet potato. When the SNP genotype of the sample to be tested is C, the probability that the sample to be tested has a low carotenoid content is significantly higher than that of the genotype T.

[0034] When the SNP genotype is homozygous CC, the carotenoid content is low;

[0035] When the SNP genotype is homozygous TT, the carotenoid content is high;

[0036] When the SNP genotype is heterozygous CT, the carotenoid content is in the middle.

[0037] The present invention also provides a primer set for detecting the SNP marker, the primer set comprising a forward primer F1, a forward primer F2 and a reverse primer R;

[0038] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2;

[0039] The nucleotide sequence of the forward primer F2 is shown in SEQ ID NO.3;

[0040] The nucleotide sequence of the reverse primer R is shown in SEQ ID NO.4.

[0041] The present invention also provides application of the primer set in preparing a product for measuring the carotenoid content of sweet potato root tubers, wherein the product is a kit.

[0042] The invention also provides a kit for identifying the carotenoid content of sweet potato root tubers containing the primer set, and the kit comprises a primer set reagent and a detection reagent.

[0043] In the present invention, the preparation method of the primer set reagent preferably comprises the following steps:

[0044] (1) diluting the forward primer F1, forward primer F2 and reverse primer R to 80-120 μM with water to obtain a forward primer F1 solution, a forward primer F2 solution and a reverse primer R solution;

[0045] (2) Take 10 to 14 μL of forward primer F1 solution, 10 to 14 μL of forward primer F2 solution, and reverse primer R solution, mix them, and add water to 100 μL to obtain a primer set reagent;

[0046] The detection reagent is preferably HiGeno 2×Probe MixA.

[0047] The present invention also provides a method for detecting the carotenoid content of sweet potato root tubers by using the kit, comprising the following steps: using the genomic DNA of the sweet potato to be detected as a template, performing KASPPCR amplification on the template by using the kit, and performing genotyping by using the amplification result.

[0048] In the present invention, the amplification system used in the KASP PCR amplification is preferably: template 20-50ng, detection reagent 4-6uL, primer set reagent 0.12-0.16uL, and sterile water is added to 10uL, and more preferably: template 30-40ng, detection reagent 5uL, primer set reagent 0.14uL, and sterile water is added to 10uL;

[0049] The reaction procedure of the KASPPCR amplification is preferably: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 55°C-61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, 30-34 cycles, and more preferably: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 58°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, 32 cycles.

[0050] The present invention also provides application of the kit or the method in sweet potato breeding.

[0051] The present invention also provides a method for increasing the carotenoid content of sweet potatoes by using the kit or the method, comprising the following steps: performing genotype detection on the SNP marker located at the 21056206bp position of chromosome 5 in the sweet potato sample, and selecting the sweet potato sample with the genotype of TT for cultivation.

[0052] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0053] Example 1: Localization of SNP loci associated with carotenoid content in sweet potato roots using whole genome association analysis

[0054] 314 sweet potato germplasm resources collected from all over the world were sequenced using resequencing technology. One of the subgenomes of the cultivated variety "Xushu 18" was used as a reference. The short sequences obtained by sequencing were aligned to the reference genome. After quality control and further screening, the variation information covering the whole genome of sweet potato was obtained, including 4,599,509 SNPs. GWAS analysis was performed in combination with the phenotypic data related to the carotenoid content of the tuber roots, and the SNP site Ib5CA (P=2.47×10-11) related to it was obtained. The Ib5CA site is located at the 21056206th base of chromosome 5 of sweet potato (genome version XUSHU18-IBA_r1.0).

[0055] Example 2 KASP technology is used to detect the genotyping of carotenoids in sweet potato roots

[0056] According to the above-mentioned Ib5CA site, 100bp nucleotide sequences upstream and downstream of Xushu 18 were retrieved as shown in SEQ ID NO.1 (the underlined bold part is the SNP site), and a characteristic primer pair for amplifying the above-mentioned SNP site was designed, including two allele forward primers with different terminal bases and a reverse primer R, and the 5' ends of the two forward primers were respectively connected to different detection adapter sequences; the nucleotide sequence of this group of specific primer pairs is shown in SEQ ID NO.2-3.

[0057] SEQ ID NO.1:

[0058] TGTAGTATGTTCATACATACTTTCCCAACCTACCGAAGCACAATGAATTAACCGTCGCCTCCACTGAGGCGAGAAATCCACTCCCATTAATGTTGGAGTGTAAATCAGGTGCTACTAAATCACCAAATTATTGTCTGAGCACCTTGTACT [C / T] AATTAACATCTCTATATTTATTCTCGAGAAAAGGTAACAT GATCAAATCGAAATAATATCTTACAATACCGTCGATAGTACTAAAAAAG AAAAAAGGGACGTTAAAAGAATTTGTTATTGAGCATCTGAGCTCAACCATCCGAACCAGCG.

[0059] Forward primer F1 (SEQ ID NO.2) (the underlined part is the FAM tag sequence):

[0060] GAAGGTGACCAAGTTCATGCT CAAATTATTGTCTGAGCACCTTGTA CTC.

[0061] Forward primer F2 (SEQ ID NO.3) (the underlined part is the HEX tag sequence):

[0062] GAAGGTCGGAGTCAACGGATT CAAATTATTGTCTGAGCACCTTGT ACTT.

[0063] Reverse primer RR (SEQ ID NO. 4): CGATTTGATCATGTTACCTTTTCTCG.

[0064] The specific KASP reaction system is: DNA (1uL, 50ng), HiGeno 2×Probe MixA (5uL), mixed primer (0.14)uL, sterile water 3.86uL, and the total reaction system is 10uL.

[0065] KASP PCR reaction program: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, 34 cycles.

[0066] After PCR is completed, QuantStudio Real Time PCR is used to read and analyze the fluorescence signal to obtain a clear and intuitive genotype diagram. Samples with the same genotype will appear in the same color and cluster together. The position close to the X-axis (red dot FAM) is the homozygous TT genotype, which is a variety with high carotenoid content. The position close to the Y-axis (blue dot HEX) is the homozygous CC genotype, which is a low carotenoid variety. The green one between the two is the heterozygous CT genotype, with a medium carotenoid content.

[0067] Example 3 KASP marker validation in natural populations

[0068] According to the resequencing results, 41 varieties with genotypes of TT, CC and CT were randomly selected from 314 natural populations and planted in Xuzhou, Jiangsu and Naiman Banner, Inner Mongolia. The genomic DNA of 41 sweet potato varieties was extracted and the carotenoid content was measured respectively (as shown in Table 1). Among them, 6 were high in carotenoids and 25 were low in carotenoids. In order to confirm the detection accuracy of the molecular markers screened by the invention, the above-mentioned KASP markers were used for genotyping. The typing results are shown in Tables 1 and Figure 1 As shown. Individuals with extremely low carotenoids are clustered near the Y axis (homozygous CC, blue dots), individuals with extremely high carotenoids are clustered near the X axis (homozygous TT, red dots), and green is the intermediate type in the middle. The lowest carotenoid content of sweet potato tubers of CC genotype is 0.62 mg / 100g, the highest is 3.75 mg / 100g, and the average is 1.76 mg / 100g. The lowest carotenoid content of sweet potato tubers of TT genotype is 16.17 mg / 100g, the highest is 24.37 mg / 100g, and the average is 20.23 mg / 100g. The lowest carotenoid content of sweet potato tubers of CT genotype is 2.02 mg / 100g, the highest is 14.61 mg / 100g, and the average is 6.58 mg / 100g. Among them, only the KASP marker of Ganyu 3 was detected as homozygous TT type, with a moderate carotenoid content, which was inconsistent with the CT genotype of the resequencing result. The results of the other varieties were consistent with the sequencing results, with an accuracy rate of up to 97.56%. The mean carotenoid content of the sweet potato tubers with TT genotype was significantly higher than that of the plants with CC genotype, and the mean carotenoid content of the sweet potato tubers with CT genotype was significantly higher than that of the plants with CC genotype.

[0069] Table 14 Detection results of carotenoid content and Ib5CA marker in 1 natural population of sweet potato

[0070]

[0071]

[0072] As can be seen from the above embodiments, the present invention provides a SNP marker related to the carotenoid content of sweet potato roots and a primer set and application for detecting the marker, and the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1. The present invention uses KASP technology to obtain SNP typing, which can accurately and efficiently identify the carotenoid content of sweet potato roots, and can be used for sweet potato molecular marker assisted selection breeding. The detection method and kit provided, through the phenotypic identification of the natural population of sweet potatoes, verify that the phenotypic selection efficiency of the developed SNP marker reaches 97.56%, and can quickly and accurately detect the carotenoid content of sweet potato roots, has the advantages of simple operation and low cost, and can meet the needs of large-scale molecular marker assisted selection.

[0073] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP marker associated with the carotenoid content of sweet potato root tubers, characterized in that: The nucleotide sequence of the SNP marker is shown in SEQ ID NO.

1.

2. The SNP marker according to claim 1, characterized in that The SNP marker is located at the 21056206th base of chromosome 5 of sweet potato. When the SNP genotype of the sample to be tested is C, the probability that the sample to be tested has a low carotenoid content is significantly higher than that of the genotype T. When the SNP genotype is homozygous CC, the carotenoid content is low; When the SNP genotype is homozygous TT, the carotenoid content is high; When the SNP genotype is heterozygous CT, the carotenoid content is in the middle.

3. A primer set for detecting the SNP marker according to claim 1, characterized in that: The primer set includes a forward primer F1, a forward primer F2 and a reverse primer R; The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; The nucleotide sequence of the forward primer F2 is shown in SEQ ID NO.3; The nucleotide sequence of the reverse primer R is shown in SEQ ID NO.

4.

4. Use of the primer set according to claim 3 in preparing a product containing carotenoids in sweet potato tubers, characterized in that: The product is a test kit.

5. A kit for identifying the carotenoid content of sweet potato root tubers comprising the primer set according to claim 3, characterized in that: The kit comprises a primer set reagent and a detection reagent.

6. The kit according to claim 5, characterized in that: The preparation method of the primer set reagent comprises the following steps: (1) diluting the forward primer F1, forward primer F2 and reverse primer R to 80-120 μM with water to obtain a forward primer F1 solution, a forward primer F2 solution and a reverse primer R solution; (2) Take 10 to 14 μL of forward primer F1 solution, 10 to 14 μL of forward primer F2 solution, and reverse primer R solution, mix them, and add water to 100 μL to obtain a primer set reagent; The detection reagent is HiGeno 2×Probe MixA.

7. A method for detecting the carotenoid content of sweet potato root tubers using the kit according to claim 5 or 6, characterized in that: The method comprises the following steps: using the genomic DNA of the sweet potato to be tested as a template, performing KASP PCR amplification on the template using the kit described in claim 5 or 6, and performing genotyping using the amplification result.

8. The method according to claim 7, characterized in that The amplification system used in the KASP PCR amplification is: 20-50 ng template, 4-6 uL detection reagent, 0.12-0.16 uL primer set reagent, and sterile water to 10 uL; The reaction procedure of the KASP PCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 55°C-61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, annealing / extension at 55°C-61°C for 40 s, 30-34 cycles.

9. Use of the kit according to claim 5 or 6 or the method according to claim 7 or 8 in sweet potato breeding.

10. A method for increasing the carotenoid content of sweet potatoes using the kit according to claim 5 or 6 or the method according to claim 7 or 8, characterized in that: The method comprises the following steps: performing genotype detection on a SNP marker located at the 21056206bp position of chromosome 5 in a sweet potato sample, and selecting a sweet potato sample with a genotype of TT for cultivation.

Images