Application of reagent for inhibiting NAT10 protein expression quantity in preparation of medicine for preventing and treating calcified aortic valve disease

Abstract

The invention belongs to the field of biological medicines, and particularly relates to a method for inhibiting osteogenic differentiation of human aortic valve interstitial cells (hVICs), namely, N-acetyltransferase 10 (NAT10) is silenced in vivo and in vitro by a biological method, and the NAT10 is over-silenced in a mouse body by adeno-associated viruses according to the method, so that the result shows that the mouse aortic valve calcification can be inhibited by the silencing of the NAT10, and the osteogenic differentiation of the human aortic valve interstitial cells (hVICs) can be inhibited. NAT10 is silenced in hVICs through adenovirus, and it is found that NAT10 silencing can inhibit osteogenic differentiation of hVICs, so that valve calcification is delayed or inhibited. The invention further provides a method for preventing and treating aortic valve calcification by inhibiting the NAT10 protein expression level, and a new non-surgical treatment scheme is provided for preventing and treating calcified aortic valve diseases.

Description

Technical field:

[0001] The present invention relates to the field of biomedicine, and in particular to application of a reagent for inhibiting the expression of NAT10 protein in the preparation of a drug for preventing and treating calcific aortic valve disease. Background technology:

[0002] Calcific aortic valve disease (CAVD) is a progressive disease of the elderly with high morbidity and mortality. The main pathophysiological changes are fibrous hyperplasia and calcification of the aortic valve leaflets. In recent years, many basic studies have shown that in addition to age-related degenerative factors, CAVD is also a complex pathological change process mediated by endothelial damage, inflammatory cell infiltration, extracellular matrix remodeling, and osteoblastic differentiation of valvular interstitial cells. Valvular endothelial cells (VECs) and valvular interstitial cells (VICs) are cell types in valve tissue. Studies have confirmed that osteoblastic differentiation of valvular interstitial cells is an important initiating factor in the occurrence of valve calcification. At present, there is a lack of effective clinically available drug treatment options for CAVD, and surgery is still its main treatment method. However, surgery will bring high economic burdens and serious complications such as postoperative bleeding and bioprosthetic valve failure. Therefore, exploring the specific pathogenesis of CAVD and using non-surgical methods to effectively prevent and / or treat calcific aortic valve disease are urgent needs in the current clinical treatment of CAVD.

[0003] N-acetyltransferase 10 (NAT10) is an enzyme with acetyltransferase and RNA binding activities. It can catalyze the epitranscriptome modification of N4-acetylcytosine (ac4C) on mRNA. It has important biological effects in many cellular events. Current research on this protein mainly focuses on its effects on ribosome biogenesis, bone remodeling, RNA translation efficiency, cell proliferation and epithelial-mesenchymal transition.

[0004] Related studies have found that NAT10 has a positive regulatory effect on the osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs). NAT10 may play an important role in the phenotypic transformation of valvular interstitial cells into osteogenic differentiation and aortic valve calcification. Reagents that inhibit NAT10 protein expression have potential clinical value in the preparation of drugs for the prevention or treatment of calcific aortic valve disease. Summary of the invention:

[0005] 1. Technical issues to be solved

[0006] Against the above background, the present invention has found through research that inhibiting the expression of NAT10 protein can effectively down-regulate the expression of osteogenic differentiation marker gene CD36 in human valvular interstitial cells (hVICs), inhibit the osteogenic differentiation of hVICs, and effectively inhibit the aortic valve calcification of mice induced by a high-fat and high-cholesterol diet. The use of an agent that inhibits the expression of NAT10 protein in the preparation of a drug for the prevention and treatment of calcific aortic valve disease is proposed, thereby providing a new non-surgical treatment plan for the prevention and treatment of calcific aortic valve disease.

[0007] (II) Technical solution

[0008] In order to achieve the above object, the present invention adopts the following technical scheme:

[0009] The present invention provides use of a reagent for inhibiting the expression of NAT10 protein in preparing a medicine for preventing and treating calcific aortic valve disease.

[0010] Furthermore, the reagent for inhibiting the expression of NAT10 protein includes any of the following:

[0011] A recombinant vector containing a short hairpin RNA (shNAT10) for inhibiting the expression of a gene encoding a NAT10 protein;

[0012] A recombinant virus containing a short hairpin RNA (shNAT10) that inhibits the expression of a gene encoding a NAT10 protein;

[0013] Furthermore, the recombinant virus containing short hairpin RNA (shNAT10) for inhibiting the expression of the gene encoding the NAT10 protein is a recombinant adenovirus or a recombinant adeno-associated virus containing shNAT10.

[0014] The reagent containing the amount of NAT10 protein expression inhibits the osteogenic differentiation of valvular interstitial cells by inhibiting the mRNA N4-acetylcytosine (ac4C) modification of CD36, a key gene for promoting hVICs osteogenic differentiation, and reducing its mRNA stability and protein expression, thereby delaying valve calcification.

[0015] Furthermore, the agent for inhibiting the expression of NAT10 protein also includes the NAT10 small molecule inhibitor Remodelin.

[0016] Furthermore, the drug for preventing and treating calcific aortic valve disease is a pharmaceutical composition prepared from an agent for inhibiting the expression of NAT10 protein and a conventional pharmaceutical carrier.

[0017] Furthermore, the pharmaceutical composition is a capsule, granule, injection, sustained-release tablet, buccal tablet or powder injection.

[0018] Furthermore, the drug for preventing and treating calcific aortic valve disease is a drug that inhibits the expression level of NAT10 in aortic valve tissue.

[0019] Furthermore, the calcific aortic valve disease is a calcified lesion of the heart valve.

[0020] The present invention also provides a method for preventing and treating aortic valve calcification, the method comprising inhibiting the expression level of NAT10 protein in a subject to be treated, so as to prevent and treat aortic valve calcification.

[0021] (III) Beneficial effects

[0022] The beneficial effects of the present invention are as follows: the present invention provides the use of a reagent for inhibiting NAT10 protein expression in the preparation of a drug for preventing and treating calcific aortic valve disease. Through research, it is found that inhibiting NAT10 protein expression can effectively down-regulate the mRNA stability and protein expression of the key osteogenic differentiation gene CD36 in valvular interstitial cells, inhibit the osteogenic differentiation of valvular interstitial cells, thereby delaying or inhibiting valve calcification. Furthermore, a reagent for inhibiting NAT10 protein expression and a method for preventing and treating aortic valve calcification by inhibiting the expression level of NAT10 are proposed, providing a new solution for the treatment of calcific aortic valve disease. Description of the drawings:

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below.

[0024] Figure 1 :Quantitative analysis of NAT10 in calcified aortic valve and normal aortic valve tissue;

[0025] A is the timely fluorescence quantitative PCR showing that compared with normal aortic valve tissue, the expression of NAT10 in calcified aortic valve tissue is significantly increased; B is the Western blot detection of NAT10 expression in normal and calcified aortic valve tissues, and the results show that the NAT10 protein level is significantly increased in calcified aortic valve tissue;

[0026] Figure 2 :Quantitative analysis of NAT10 in osteogenic differentiation of human aortic valve interstitial cells induced by osteogenic induction medium;

[0027] A is timely fluorescence quantitative PCR showing that compared with the control group, the expression of NAT10 in human valvular interstitial cells induced by osteogenic induction medium for 0 days, 1 day, 3 days, 5 days, 7 days and 14 days was significantly increased in a time-dependent manner; B is Western blot detection showing that compared with the control group, the expression of NAT10 protein level in human valvular interstitial cells induced by osteogenic induction medium for 0 days, 1 day, 3 days, 5 days, 7 days and 14 days was significantly increased in a time-dependent manner;

[0028] Figure 3 :Overexpression of NAT10 promotes phenotypic transformation of human valvular interstitial cells in osteogenic differentiation in vitro.

[0029] A is Alizarin red showing that compared with the control group, the calcium salt nodules of human aortic valve interstitial cells in the NAT10 overexpression group increased significantly; B is calcium quantitative analysis showing that after overexpression of NAT10, the calcium salt deposition of human aortic valve interstitial cells increased significantly;

[0030] Figure 4 :Knockdown of NAT10 inhibits osteogenic differentiation of human aortic valvular interstitial cells.

[0031] A is Alizarin red showing that compared with the control group, the calcium salt nodules of human aortic valve interstitial cells in the NAT10 knockdown group were significantly reduced; B is calcium quantitative analysis showing that after NAT10 was knocked down, the calcium salt deposition of human aortic valve interstitial cells was significantly reduced;

[0032] Figure 5 : Knockdown of NAT10 inhibits the osteogenic differentiation of human aortic valve interstitial cells by suppressing the mRNA stability and expression of CD36, a key pathogenic gene of valve calcification.

[0033] A is the change of CD36 mRNA stability detected by q-RTPCR after NAT10 knockdown. The results show that after NAT10 knockdown, the stability of CD36 mRNA decreased significantly; B is the change of CD36 expression detected by q-RTPCR after NAT10 knockdown. The results show that after NAT10 knockdown, CD36 expression was significantly downregulated;

[0034] Figure 6 :In vivo silencing of NAT10 inhibits aortic valve calcification in mice induced by a high-fat, high-cholesterol diet.

[0035] Figure 7 :Remodelin, a small molecule inhibitor of NAT10, inhibits osteogenic differentiation of human aortic valvular interstitial cells.

[0036] A is Alizarin red showing that compared with the control group, the calcium salt nodules of human aortic valve interstitial cells in the group treated with the NAT10 small molecule inhibitor Remodelin were significantly reduced; B is calcium quantitative analysis showing that the calcium salt deposition of human aortic valve interstitial cells in the group treated with the NAT10 small molecule inhibitor Remodelin was significantly reduced; Specific implementation method:

[0037] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0038] Example 1: Detection of NAT10 expression at tissue level.

[0039] The specific experimental plan is as follows:

[0040] 1. RNA extraction

[0041] 1) Tissue processing: Take about 50 mg of aortic valve tissue, grind it with liquid nitrogen until satisfactory, add 1 ml of Trizol reagent, shake and homogenize, and after sufficient lysis, centrifuge at 12000 rpm and 4°C for 15 minutes, and take the supernatant.

[0042] 2) Add 200ul of chloroform, shake and mix well, and leave at room temperature for 15 minutes.

[0043] 3) Centrifuge at 4°C, 12,000 rpm for 15 minutes, separate into three layers, take the upper aqueous phase to a new enzyme-free EP tube, add an equal volume of isopropanol, mix well and leave at room temperature for 10 minutes to precipitate RNA.

[0044] 4) Centrifuge at 4°C, 12,000 rpm for 15 minutes, carefully remove the supernatant and the RNA precipitate at the bottom of the tube.

[0045] 5) Add 1 ml of 75% ethanol for every 1 ml of Trizol and mix by inversion.

[0046] 6) Centrifuge at 8000 g at 4°C for 5 minutes, discard the supernatant, and dry at room temperature (5-10 minutes).

[0047] 7) Add appropriate amount of DEPC water to dissolve RNA, determine RNA concentration, and perform reverse transcription based on the quantitative results.

[0048] 8) RNA A260 / A280 = 1.8-2.1

[0049] 2. cDNA reverse transcription

[0050] 1) Reverse transcription system of Japanese TAKARA kit (10ul):

[0051]

[0052] Reaction conditions: 37°C, 15 minutes of reverse transcription reaction; 85°C, 5 seconds of reverse transcriptase inactivation reaction; 4°C, the reaction ends and the product is cDNA.

[0053] 3. QRT-PCR was used to detect the expression of NAT10 in normal and calcified aortic valve tissues, wherein the primer sequences of NAT10 real-time fluorescence quantitative PCR were as shown in SEQ ID NO: 2 (GGATTGCCTCAACATCACTCGG) and SEQ ID NO: 3 (CGTTGGAGGAAAACTTCAGAGGC).

[0054] 1) Experimental system:

[0055]

[0056]

[0057] 2) Reaction conditions:

[0058] 95°C, 2 min; 40 cycles (95°C, 10 sec; 60°C, 60 sec); 60-95°C melting curve.

[0059] 3) Amplification was performed on the machine. After the reaction was completed, the amplification curve and melting curve were confirmed. The expression intensity of each gene was calculated according to the CT value (threshold cycle values) and the P value was calculated by T test. The sequence of the primer for the internal reference housekeeping gene β-actin specific real-time fluorescence quantitative PCR is as shown in SEQ ID NO: 4

[0060] The primer pair is shown in (CACCATTGGCAATGAGCGGTTC) and SEQ ID NO: 5 (AGGTCTTTGCGGATGTCCACGT).

[0061] 4) Result analysis

[0062] Results Figure 1 A. The expression of NAT10 was detected in 32 normal aortic valve tissues and 32 calcified aortic valve tissues. The results showed that NAT10 was significantly upregulated in calcified aortic valve tissues compared with normal aortic valve tissues.

[0063] 2. Western blot analysis

[0064] SDS-PAGE gel preparation.

[0065] Considering that the traditional gel production process is cumbersome and time-consuming, and acrylamide is biologically toxic, all gels in this study are fast PAGE preparation kits provided by Shanghai Yazyme Biotechnology Co., Ltd. The gel is a premixed formula, easy and quick to operate, uses a modified coagulant, does not require acrylamide, and can be selected according to different concentrations. The product content is as follows:

[0066]

[0067]

[0068] Gel production process (taking the production of 2 pieces of 1.5mm gel as an example):

[0069] (1) Take 8 mL of the lower gel solution and gel buffer solution and mix thoroughly.

[0070] (2) Add 160uL of improved coagulant and mix thoroughly.

[0071] (3) After thorough mixing, inject into the glass plate with about 7 mL of liquid, with the liquid surface 0.5 cm away from the inserted comb teeth. Completely cover with anhydrous ethanol and flatten the liquid surface.

[0072] (4) Wait until the lower layer of glue is completely solidified and use filter paper to absorb the anhydrous ethanol.

[0073] (5) Take 2 mL of the upper gel solution and buffer solution, and mix thoroughly.

[0074] (6) Add 40uL of improved coagulant.

[0075] (7) After mixing, inject into the glass plate and insert the comb teeth.

[0076] (8) After the upper layer of gel is completely solidified, remove the comb teeth and prepare for electrophoresis.

[0077] Transfer solution preparation

[0078] This study used Yazyme Bio Omni-Flash TM Ice-bath-free rapid transfer buffer (10×) can use anhydrous ethanol instead of methanol compared to traditional transfer buffer, avoiding the use of toxic reagents, and has low heat generation, no ice bath required, and is efficient and convenient.

[0079]

[0080] The preparation method is as follows (taking 1000mL of rapid transfer solution 1× as an example):

[0081] Transfer conditions: 4% to 20% gradient gel, thickness 1.5mm, molecular weight 10 to 250kDa, constant current 400mA, transfer can be completed in 30 minutes; ordinary SDS-PAGE gel, according to different gel concentrations, determine the transfer time. Commonly used concentration 10% gel, using a constant current of 400mA, 30 minutes to complete the transfer of proteins with a molecular weight below 150kDa. For proteins with a molecular weight greater than 150kDa, the transfer time needs to be extended by about 5 to 10 minutes.

[0082] The blocking solution is prepared as shown in the following table (5% skim milk powder)

[0083] Component name content Skim milk powder 5g TBST 100mL

[0084] TBST preparation

[0085] The preparation ratio is: 1000mL Tris-HCl balanced salt buffer + 1mL Tween 20

[0086] Protein sample preparation

[0087] (1) Wash the cell samples in the 6-well plate with pre-cooled PBS three times, 5 minutes each time.

[0088] (2) Add 100uL of pre-cooled RIPA lysis buffer to each well, let stand on ice for 10 minutes, and collect the cell lysate into a new EP tube.

[0089] (3) Use an ultrasonic cell disruptor to continue processing the cell sample. The ultrasonic conditions are 60 Hz, 30 seconds each time, for a total of 5 times. Keep the ultrasonic process in an ice bath. Let it stand on ice for 20 minutes.

[0090] (4) Centrifuge at 4°C, 12,000 rpm for 15 minutes. Take the supernatant and measure the protein concentration.

[0091] Protein concentration determination

[0092] The protein concentration was detected by BCA method.

[0093] (1) Prepare BCA working solution: Mix reagent A and reagent B in a ratio of 50:1 to make a working solution, mix well and keep at room temperature for later use.

[0094] (2) Preparation of protein standard: Prepare the protein standard solution by adding 0.8 mL of preparation solution + 20 mg of BSA. Dilute the stock solution with PBS to 0.5 mg / mL as the working solution.

[0095] (3) The method of adding samples to a 96-well plate is shown in the table below.

[0096]

[0097] (4) Incubate at 37°C for 30 min and measure the absorbance with an ELISA reader (wavelength: 562 nm).

[0098] (5) Calculate protein concentration using Excel preset equation.

[0099] Protein denaturation

[0100] After the protein concentration is determined, add the sample buffer, mix well, and heat at 99°C for 10 minutes for denaturation. After denaturation, place on ice for later use or store at -80°C.

[0101] Protein electrophoresis

[0102] (1) Use the Beijing Liuyi old electrophoresis tank. After preparing the gel as described above, fill the inner tank with electrophoresis solution, remove the comb teeth, and use a micropipette to add 5uL of protein pre-stained marker (Thermo26616) and protein sample (the sample volume is calculated according to the protein concentration) into the swimming lane in sequence as needed.

[0103] (2) Perform electrophoresis at a constant voltage of 80 V. After all samples in each lane have been transferred to the separation gel, adjust the voltage to 150 V and adjust the time according to the molecular weight of the target protein.

[0104] Protein transfer

[0105] (1) After electrophoresis, cut out the gel blocks with a molecular weight of about 20 kDa above and below the target protein.

[0106] (2) Soak the activated PVDF membrane in methanol (about 30 seconds), discard the methanol and place it in pre-cooled transfer solution, equilibrate for 10 minutes and set aside.

[0107] (3) Place the gel and PVDF membrane using the sandwich method.

[0108] (4) Transfer the membrane using transfer buffer without ice bath, 400 mA, constant current, and adjust the transfer time according to the molecular weight (Note: All transfer buffers in this study can be recycled and used 3 times).

[0109] PVDF membrane immunoblotting

[0110] (1) Blocking: After transfer, block with 5% skim milk for 1 hour at room temperature.

[0111] (2) Primary antibody incubation. After blocking, wash the membrane with TBST. Cut the target band and dry the TBST with filter paper. Prepare the target protein primary antibody in advance with commercial primary antibody diluent (15 ml centrifuge tube, primary antibody concentration is diluted according to the manufacturer's instructions, and can be adjusted later according to experimental results). Incubate overnight at 4°C.

[0112] (3) Secondary antibody incubation. The next day, the primary antibody incubation was completed and the primary antibody was recovered. The membrane was washed with TBST for 3 times, 10 minutes each time. The secondary antibody was prepared with TBST at a dilution ratio of 1:5000 or 1:10000 (the specific dilution ratio can be adjusted according to the secondary antibody brand and experimental results). The secondary antibody was incubated for 1 hour.

[0113] (4) Chemical development. Discard the secondary antibody and wash the membrane with TBST. Use the Bio-Tech ECL Chemiluminescence Kit (Cat. No. P0018S) and mix the A and B developer solutions in a ratio of 1:1 as the working solution. Place the target band flat in the developer, add about 100uL of developer solution on the membrane to completely cover the target band, and leave it in the dark for 20 seconds. Use the software program to expose and collect images.

[0114] (5) Image analysis. ImageJ1.55 was used to detect the gray value. The gray value ratio of the target protein and the internal reference protein was analyzed to calculate the expression difference of the target protein between each sample.

[0115] Results Analysis

[0116] Results Figure 1 B. The expression of NAT10 was detected in 32 normal aortic valve tissues and 32 calcified aortic valve tissues. The results showed that NAT10 was significantly upregulated in calcified aortic valve tissues compared with normal aortic valve tissues.

[0117] Example 2: Construction of a cell model of osteogenic differentiation of human valvular interstitial cells induced by calcification induction medium.

[0118] 1. Extraction and culture of primary hVICs

[0119] hVICs extraction

[0120] (1) In a clean bench, transfer the aortic valve from sterile saline or high-glucose culture medium to a sterile 10 cm cell culture dish. Add about 10 mL of sterile PBS (containing penicillin and streptomycin) and rinse 3 to 5 times with a Pasteur pipette. Use sterile microscissors to separate the valve and cut it into small pieces for later use.

[0121] (2) Dissolve 1 vial of type I collagenase in 50 mL of DMEN high-glucose medium and add the dual antibody at the same time. The working solution concentration is 2 mg / mL.

[0122] (3) Take about 10 mL of type I collagenase working solution, mix it with the chopped valve tissue in step (1), transfer it to a 15 mL sterile centrifuge tube, and digest it at 37°C overnight.

[0123] (4) After complete digestion, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, resuspend the precipitate in 10% FBS+DMEM, mix gently, and culture in a T25 culture flask at 37°C in a constant temperature incubator.

[0124] hVICs culture

[0125] (1) After primary cells are isolated and inoculated into culture flasks or culture dishes, the medium is changed regularly every 2 to 3 days. When the cell density reaches about 90%, they can be digested and subcultured.

[0126] (2) Subculturing. Add 1 mL of 0.25% trypsin to each T25 culture flask for digestion for about 30 seconds. Discard the trypsin and add 3 mL of DMEM medium containing 10% FBS to each T25 culture flask. Use a Pasteur pipette to suspend the adherent cells and subculture at a ratio of 1 to 2 and continue culturing.

[0127] (3) Take cells from passages 2 to 5 for subsequent experiments.

[0128] 2. Method for inducing osteogenic differentiation of hVICs:

[0129] After 24 hours of cell transfection in each group, the cell confluence was observed, and human valvular interstitial cells with a culture density of about 90% were taken and starved overnight with DMEM high-glucose medium containing 2% fetal bovine serum. On the second day, human valvular interstitial cells were induced to differentiate into osteoblasts with a newly prepared osteoinduction medium (50 mg / mL vitamin C, 5 mmol / L β-glycerophosphate, 100 nmol / L dexamethasone, and the solvent was high-glucose DMEM medium containing 2% fetal bovine serum). The medium was changed every three days for 14 days of induction.

[0130] Example 3: Osteogenic induction medium induced inhibition of NAT10 expression in human valvular interstitial cells.

[0131] In this example, the scheme in Example 2 was used to induce osteogenic differentiation of human valvular interstitial cells at different time points, namely, day 0, day 1, day 3, day 5, day 7, and day 14. Then, the real-time fluorescence quantitative PCR and western blot methods in Example 1 were used to detect the changes in the mRNA and protein expression levels of NAT10 in the osteogenic differentiation-induced cells at different time points. The results showed that the mRNA ( Figure 2 A) and protein ( Figure 2 B) The expression levels in the osteogenic induction culture group increased significantly in a time-dependent manner.

[0132] Example 4: Overexpression of NAT10 can promote osteogenic differentiation of human valvular interstitial cells, and knockdown of NAT10 can inhibit osteogenic differentiation of human valvular interstitial cells.

[0133] In this example, valvular interstitial cells were isolated and cultured, NAT10 overexpression adenovirus and NAT10 gene-specific short hairpin RNA (shNAT10) were constructed, and after transfection of valvular interstitial cells, valvular interstitial cells were induced with osteogenic differentiation induction medium to construct an in vitro osteogenic differentiation model. The degree of calcification of valvular interstitial cells was evaluated by Alizarin red staining and calcium quantitative analysis.

[0134] The specific experimental plan is as follows:

[0135] 1. Cell transfection

[0136] In this study, gene silencing was performed using gene-specific short hairpin RNA (shRNAs). Specific shRNAs targeting NAT10 and negative control shRNA were synthesized by Shanghai Jima Company. The shNAT10 sequence is SEQ ID NO: 1: GCAATTGTACACAGTGACTAT. NAT10 overexpression vector and control group empty vector GV144 were synthesized by Shanghai Jikai Company. Lipofectamine3000 was used as the gene transfection reagent. The transfection steps are as follows:

[0137] (1) Cells were seeded into 6-well plates and transfection was started when the confluence reached 80%.

[0138] (2) Dilute Lipofectamine 3000 (5uL) with 125uL reduced serum medium.

[0139] (3) Dilute plasmid DNA (2.5ug) with 125uL reduced serum medium and add 5uL P3000.

[0140] (4) Mix the reagents obtained in step 2 and step 3 in a 1:1 ratio and incubate at room temperature for 5 minutes.

[0141] (5) Add the mixed reagents in step 4 to the cells, transfect the cells at 37°C, and analyze the transfection results after 72 hours.

[0142] 2. Alizarin red staining

[0143] Primary culture of hVICs

[0144] (1) Take the cells to be stained from a 12-well plate and wash them with 1 mL of pre-cooled 1× PBS for 3 times.

[0145] (2) Add 500uL of 4% paraformaldehyde to each well and fix at room temperature for 20 minutes.

[0146] (3) Wash the polyformaldehyde with 1× PBS for 3 times, 5 minutes each time.

[0147] (4) Add 600uL of Alizarin Red dye to each well and stain for 15 to 20 minutes.

[0148] (5) Wash with 1× PBS for 3 to 5 times and observe under a microscope. The calcium deposits in the cells will appear orange-red.

[0149] 3. Quantitative detection of calcium in hVICs

[0150] (1) Wash the cells cultured for 2 weeks in the test well plate with TBS, then add 0.6N HCl to the 12-well plate for 24 hours, and collect the supernatant containing calcium ions and HCl.

[0151] (2) Calcium content was detected according to the instructions of the Calcium C-test Wako detection kit. After gentle washing with TBS, the remaining cells at the bottom of the six-well plate were lysed with a 0.1N NaOH solution containing 0.1% SDS to extract total protein.

[0152] (3) The protein concentration was determined using a BSA kit and the obtained calcium content was standardized to the protein content.

[0153] 3. Results Analysis

[0154] Alizarin red staining and calcium quantitative analysis showed that compared with the control group, overexpression of NAT10 significantly promoted the calcium salt nodules of valvular interstitial cells induced by osteogenic induction medium ( Figure 3 A) and calcium salt deposition ( Figure 3 B) increased effect (P < 0.05), while knockdown of NAT10 significantly inhibited the calcium salt nodules of valvular interstitial cells induced by osteogenic induction medium ( Figure 4 A) and calcium salt deposition ( Figure 4 B) Increased effect (P<0.05).

[0155] Example 6: Knockdown of NAT10 can inhibit the mRNA stability and expression level of CD36, a key gene for valve calcification, and play a role in inhibiting the osteogenic differentiation of human aortic valve interstitial cells.

[0156] In this example, valvular interstitial cells were isolated and cultured. After successful transfection of shNAT10, the valvular interstitial cells were induced with osteogenic differentiation induction medium for 14 days to construct an in vitro osteogenic differentiation model. Then, the mRNA stability and expression changes of CD36, a key gene for valve calcification, were detected. The q-RTPCR results showed that after knocking down NAT10, the mRNA stability and expression level of CD36 were significantly downregulated ( Figure 5 A, Figure 5 B). The primer sequences of CD36 real-time fluorescence quantitative PCR are shown as the primer pair in SEQ ID NO: 4 (GGCTGTGACCGGAACTGTG) and SEQ ID NO: 5 (AGGTCTCCAACTGGCATTAGAA).

[0157] Example 7. Animal experiment: Effect of silencing NAT10 in vivo on the degree of aortic valve calcification in mice

[0158] At present, the three most commonly used animal models for CAVD research are mice, rabbits, and miniature pigs. The spontaneous development of CAVD in pigs is similar to the progression of human CAVD, but the modeling time is long. In addition to dietary induction, rabbit modeling also requires drug intervention, and it is difficult to construct a specific gene mutation system. Compared with the first two, mice have become the most widely used modeling choice in current research because of their advantages such as low economic cost, convenient management, high modeling rate, and mature gene mutation system. In this experiment, ApoE was selected - / - Genetically engineered mice were used to construct a CAVD animal model.

[0159] Recombinant adeno-associated virus (AAV) is a gene modification vector that is non-pathogenic and has broad tissue tropism. It is widely used in biomedical research. At the same time, AAV has strong genome integration and persistent infection capabilities, and can be efficiently transmitted both in vivo and in vitro (DE JESUSD F, ZHANG Z, KAHRAMAN S, et al. m(6)A mRNA Methylation Regulates Human β-Cell Biology in Physiological States and in Type 2 Diabetes. Nature metabolism, 2019, 1(8): 765-774), and has been successfully used in the study of various diseases (YANG Y, SHEN F, HUANG W, et al. Glucose Is Involved in the Dynamic Regulation of m6A in Patients With Type 2 Diabetes. The Journal of clinical endocrinology and metabolism, 2019, 104(3): 665-673; BUDIYANIL, PURNAMASARID, SIMADIBRATA M, et al. Insulin Resistance in Gastroesophageal Reflux Disease. Acta medica Indonesiana, 2018, 50(4): 336-342). AAV is classified according to serotypes, and different serotypes have huge differences in affinity for corresponding tissues. For valvular interstitial cells, studies have confirmed that among many AAV serotypes, AAV serotype 2 (AAV2) has higher tissue affinity and gene transduction ability than other serotypes (REDDY KJ, SINGH M, BANGIT JR, et al. The role of insulin resistance in the pathogenesis of atherosclerotic cardiovascular disease: an updated review. Journal of cardiovascular medicine (Hagerstown, Md), 2010, 11(9): 633-647).AAV2-mediated gene editing in mice has also been widely used in cardiovascular disease research, especially atherosclerosis (PICHéM E, PARRY SA, KARPE F, et al. Chylomone-Derived Fatty Acid Spillover in Adipose Tissue: A Signature of Metabolic Health?. The Journal of clinical endocrinology and metabolism, 2018, 103 (1): 25-34; XIE W, MA LL, XU YQ, et al. METTL3 inhibits hepatic insulin sensitivity via N6-methyladenosine modification of Fasn mRNA and promoting fatty acid metabolism. Biochemical and biophysical research communications, 2019, 518 (1): 120-126). Therefore, in the present invention, ApoE is used. - / - Genetically engineered mice, using AAV2 as a gene silencing vector in mice, further demonstrated that NAT10 gene silencing is important in ApoE - / - Role of in vivo levels in the progression of aortic valve calcification disease in mice.

[0160] 1. CAVD animal model grouping

[0161] Forty 4-week-old male ApoE - / - Mice were divided into two groups after being injected with AAV2-scr (control group, n=20) and AAV2-shNAT10 (n=20) through the tail vein:

[0162] (1) Normal diet (ND) + control group (ND + AAV2-scr), n = 10;

[0163] (2) High cholesterol diet (HCD) + control group (HCD + AAV2-scr), n = 10;

[0164] (3) normal diet + NAT10 silencing group (ND + AAV2-shNAT10), n = 10;

[0165] (4) High cholesterol diet + NAT10 silencing group (HCD + AAV2-shNAT10), n = 10.

[0166] 2. Diet induction started at 8 weeks of age. Aortic valve specimens were obtained after 24 weeks. Methods: Mice were fasted for one day. The next day, 10% chloral hydrate anesthesia was induced, a clear surgical field was established under the microscope, and the aorta was quickly cut off about 5 mm from the root. The heart was obtained intact. The whole heart tissue was fixed with 4% paraformaldehyde. Serial sections were made from the root of the aorta. The sections were stained with HE and Von Kossa to evaluate the degree of calcification of the aortic valve tissue.

[0167] 3. Results Analysis

[0168] Figure 6 HE staining of the valves showed that after induction of a high-fat and high-cholesterol diet, the thickness of the aortic valve leaflets of mice in the NAT10 silencing group was significantly reduced compared with the empty vector group. Alizarin red staining of the valves showed that after induction of a high-fat and high-cholesterol diet, the calcium salt deposition in the aortic valve leaflets of mice in the NAT10 silencing group was significantly reduced compared with the empty vector group. The above results confirmed that knocking down NAT10 can significantly inhibit aortic valve calcification in mice.

[0169] Example 8: Remodelin, a small molecule inhibitor of NAT10, inhibits osteogenic differentiation of human aortic valve interstitial cells.

[0170] In this example, valvular interstitial cells were isolated and cultured. After the NAT10 small molecule inhibitor Remodelin was used to treat the valvular interstitial cells to inhibit the activity of NAT10 acetyltransferase, the valvular interstitial cells were induced with osteogenic differentiation induction medium for 14 days to construct an in vitro osteogenic differentiation model. Alizarin red staining and calcium quantitative analysis were used to evaluate the degree of calcification of valvular interstitial cells. Alizarin red staining and calcium quantitative analysis showed that compared with the control group, Remodelin could significantly inhibit the calcium salt nodules of valvular interstitial cells induced by osteogenic induction medium ( Figure 7 A) and calcium salt deposition ( Figure 7 B) Increased effect (P<0.05). The molecular formula of Remodelin is C-(15)H-(14)N-4S, the molecular weight is 282.36, the product number is S7641, Selleck), and the concentration used is 20μM.

[0171] Finally, it should be noted that the above embodiments are only used to illustrate the present invention and are not intended to limit the protection scope of the present invention. In addition, after reading the technical content of the present invention, those skilled in the art may make various changes, modifications or variations to the present invention, and all of these equivalent forms also fall within the protection scope defined by the present application.

Claims

1. Use of an agent for inhibiting the expression of NAT10 protein in the preparation of a drug for preventing and treating calcific aortic valve disease. It is characterized in that: The reagent for inhibiting the expression of NAT10 protein includes any of the following: a recombinant vector containing a short hairpin RNA that inhibits the expression of a gene encoding a NAT10 protein, namely, shNAT10, whose nucleotide sequence is shown in SEQ ID NO: 1, specifically: GCAATTGTACACAGTGACTAT; a recombinant virus containing a short hairpin RNA that inhibits the expression of a gene encoding a NAT10 protein, namely, shNAT10; the reagent for inhibiting the expression of NAT10 protein inhibits the osteogenic differentiation of valvular interstitial cells by inhibiting the mRNA stability and protein expression of CD36, a key gene promoting osteogenic differentiation of hVICs, thereby delaying valve calcification.

2. The use according to claim 1, characterized in that: The recombinant virus of shNAT10 that inhibits the expression of the gene encoding the NAT10 protein is a recombinant adenovirus or a recombinant adeno-associated virus containing shNAT10 that inhibits the expression of the gene encoding the NAT10 protein.

3. The use according to claim 1, characterized in that: The reagent for inhibiting the expression of NAT10 protein also includes the NAT10 small molecule inhibitor Remodelin.

4. The use according to claim 1, characterized in that: The drug for preventing and treating calcific aortic valve disease is a pharmaceutical composition prepared from a reagent for inhibiting the expression of NAT10 protein and a conventional pharmaceutical carrier.

5. The use according to claim 4, characterized in that: The pharmaceutical composition is a capsule, granule, injection, sustained-release tablet, buccal tablet or powder injection.

6. The use according to claim 1, characterized in that: The calcific aortic valve disease is a calcified lesion of the heart valve.

Images