3D protein mutant o foot-and-mouth disease recombinant virus strain and construction and application thereof

By genetically engineering a mutation of methionine at position 403 of the 3D protein of type O foot-and-mouth disease virus to alanine, a recombinant virus strain rFMDV-M403A was constructed, which solved the problem of viral function inhibition, achieved a reduction in viral titer and an increase in the survival rate of suckling mice, and provided a theoretical basis for the development of new vaccines.

CN119391655BActive Publication Date: 2026-04-24LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)
Filing Date
2024-11-06
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing technologies are unable to effectively inhibit the function of the 3D protein of type O foot-and-mouth disease virus, leading to abnormal viral particle assembly, affecting infectivity, and lacking effective prevention and diagnostic methods.

Method used

Using genetic engineering, the methionine at position 403 of the 3D protein of type O foot-and-mouth disease virus was mutated to alanine to construct the recombinant virus strain rFMDV-M403A, and the virus strain was rescued using reverse genetics technology.

Benefits of technology

The recombinant viral strain undergoes stable mutations in cells, resulting in reduced viral titers, increased survival rate in suckling mice, and decreased viral load and tissue lesions in the liver. This provides the possibility of an attenuated vaccine, and the strain is immunogenic, making it suitable as a vaccine candidate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119391655B_ABST
    Figure CN119391655B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and particularly relates to a 3D protein mutant O foot-and-mouth disease recombinant virus strain and construction and application thereof. The application mutates methionine at the 403th position of the 3D protein of the O foot-and-mouth disease virus into alanine, and successfully constructs and rescues a 3D protein mutant O foot-and-mouth disease recombinant virus strain rFMDV-M403A by using reverse genetic technology. The amino acid of the recombinant virus strain can be stably mutated in the process of subculture, and the growth speed of the mutant strain is slower than that of the wild strain, and the virus titer is significantly reduced. In individual experiments, the infection of the mutant strain to suckling mice shows that the mutant strain can improve the survival rate of the suckling mice, and significantly reduce the viral load in the liver and the tissue lesions. The application provides an attenuated foot-and-mouth disease recombinant virus strain, which has important significance for in-depth understanding of the pathogenic mechanism and prevention and control strategy of the foot-and-mouth disease virus, and provides an important theoretical basis for further development of the foot-and-mouth disease genetic engineering vaccine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a 3D protein-mutated type O foot-and-mouth disease recombinant virus strain and its construction and application. Background Technology

[0002] Foot-and-mouth disease (FMD) is a serious, acute, febrile, and highly contagious infectious disease that severely harms the health of cloven-hoofed animals. It is caused by the foot-and-mouth disease virus (FMDV). FMDV consists of a single-stranded positive-sense RNA virus surrounded by a capsid; the viral envelope is symmetrical and icosahedral. There are seven serotypes of this virus: A, O, C, SAT1, SAT2, SAT3, and Asia1, and there is no cross-protective reaction between the serotypes. Serotype O is one of the most common and widespread serotypes.

[0003] The FMDV genome encodes four structural proteins and eight non-structural proteins, among which the 3D protein, a non-structural protein encoded by FMDV, plays a crucial role in the replication of foot-and-mouth disease virus. It possesses RNA polymerase activity, catalyzing the synthesis of viral RNA, essential for viral genome replication and the production of progeny viral particles. The 3D protein also assists in the correct assembly of viral structural proteins to form complete viral particles. Inhibition or loss of 3D protein function may lead to abnormal viral particle assembly, affecting the virus's infectivity. The 3D protein plays a key role in FMDV replication and pathogenesis, and is of great significance for the diagnosis and control of foot-and-mouth disease. Constructing a 3D mutant strain of type O foot-and-mouth disease virus and analyzing its biological characteristics is of great importance for a deeper understanding of the pathogenic mechanism of FMDV and the formulation of control strategies.

[0004] The rise and development of reverse genetics technology for FMDV has provided a convenient and powerful tool for FMD vaccine research. Using this technology, researchers can replace, delete, and modify viral genes according to their needs to rescue desired recombinant viruses, achieving significant success. Further research is needed on the impact of changes in the viral genome on viral function, including studies on the structure, function, and molecular immune mechanisms of the viral genome, thereby developing novel foot-and-mouth disease vaccines. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention focuses on the 3D protein of type O FMDV. Key sites of the 3D protein are mutated to amplify a fragment. This fragment is then inserted into the type O FMDV rescue system and directly transformed into competent cells to obtain a recombinant plasmid, successfully constructing the recombinant viral strain rFMDV-M403A of the type O FMDV 3D protein. The recombinant viral strain rFMDV-M403A exhibits a decreased viral titer, a later onset of chronic pulmonary embolism (CPE) in cells, and stable mutation. Furthermore, it significantly improves the survival rate of suckling mice and substantially reduces viral load and tissue lesions in the liver, thus reducing pathogenicity and providing a possibility for developing novel attenuated vaccines. Simultaneously, the mutant strain possesses certain immunogenicity and shows promise as a vaccine candidate. Specifically, it includes the following:

[0006] In a first aspect, the present invention provides an application in preparing an attenuated recombinant foot-and-mouth disease virus strain by mutating methionine at position 403 of the foot-and-mouth disease virus 3D protein to alanine.

[0007] Preferably, the foot-and-mouth disease virus is an O-type foot-and-mouth disease virus strain.

[0008] Preferably, the O-type foot-and-mouth disease virus strain is the O / BY / CHA / 2010 strain.

[0009] Secondly, the present invention provides a foot-and-mouth disease recombinant virus strain, wherein the foot-and-mouth disease recombinant virus strain is formed by mutating the methionine at position 403 of the 3D protein of the parent foot-and-mouth disease virus to alanine.

[0010] Preferably, the parent foot-and-mouth disease virus is an O-type foot-and-mouth disease virus strain.

[0011] Preferably, the parent foot-and-mouth disease virus is strain O / BY / CHA / 2010.

[0012] Thirdly, the present invention provides the application of the foot-and-mouth disease recombinant virus strain described in the second aspect above in the preparation of foot-and-mouth disease vaccines.

[0013] Preferably, the foot-and-mouth disease vaccine is an attenuated vaccine.

[0014] Fourthly, the present invention provides a method for preparing the foot-and-mouth disease recombinant virus strain described in the second aspect above, wherein the method involves mutating the methionine at position 403 of the parent foot-and-mouth disease virus 3D protein to alanine using genetic engineering techniques.

[0015] Preferably, the method includes the following steps:

[0016] (1) Using the recombinant plasmid of the parent foot-and-mouth disease virus strain O / BY / CHA / 2010 as a template, the methionine at position 403 of the parent foot-and-mouth disease virus 3D protein was mutated to alanine using site-directed mutagenesis PCR to construct the full-length plasmid FMDV-M403A.

[0017] (2) The full-length plasmid FMDV-M403A was transfected into BHK-21 cells, and the recombinant foot-and-mouth disease virus strain was obtained by virus rescue.

[0018] Preferably, the specific method for virus rescue is as follows:

[0019] (1) 2.5 μg of full-length plasmid FMDV-M403A was mixed with 5 μL of Lipo3000 and transfected into 60%-90% monolayer BHK-21 cells.

[0020] (2) After transfection, place the incubator at 37°C and 5% CO2 for 48-72 hours.

[0021] (3) Harvest the sample when the cells show 80% to 90% CPE, and after repeated freeze-thaw cycles at -80℃ 2 to 3 times, passage it continuously for 10 generations in BHK-21 cells.

[0022] The beneficial effects of this invention are as follows: This invention mutates the methionine at position 403 of the O-type foot-and-mouth disease virus 3D protein to alanine, and successfully constructs and rescues a mutant strain rFMDV-M403A of O-type foot-and-mouth disease virus 3D using reverse genetics technology. The recombinant virus exhibits stable amino acid mutations during passage, and the mutant strain grows at a slower rate than the wild-type strain, with a significantly lower viral titer. In individual experiments, infection of suckling mice showed that the mutant strain increased the survival rate of suckling mice and significantly reduced viral load and tissue lesions in the liver. This invention provides an attenuated recombinant foot-and-mouth disease virus strain, which is of great significance for a deeper understanding of the pathogenesis and control strategies of foot-and-mouth disease virus, and also provides an important theoretical basis for further development of foot-and-mouth disease genetic engineering vaccines. Attached Figure Description

[0023] Figure 1 Strategy for constructing infectious clones of full-length cDNA with the M403 site mutation in type O FMDV 3D protein;

[0024] Figure 2 Construction of FMDV infectious clone pcDNA3.1;

[0025] Figure 3 CPE analysis of recombinant viral strain rFMDV-M403A and parental viral strain rFMDV-WT on BHK-21 cells;

[0026] Figure 4Partial identification results of recombinant virus strain rFMDV-M403A and its parental strain rFMDV-WT;

[0027] Figure 5 Growth curve determination of recombinant virus strain rFMDV-M403A and parental strain rFMDV-WT;

[0028] Figure 6 Survival statistics of recombinant virus strain rFMDV-M403A and parental strain rFMDV-WT in suckling mice;

[0029] Figure 7 Determination of viral load in the liver of suckling mice by recombinant virus strain rFMDV-M403A and parental strain rFMDV-WT;

[0030] Figure 8 Differences in liver damage in suckling mice between recombinant virus strain rFMDV-M403A and parental strain rFMDV-WT. Detailed Implementation

[0031] To make the technical means, creative features, objectives, and effects of this invention easier to understand, the invention is further described below in conjunction with specific embodiments. However, the scope of protection of this invention is not limited to the embodiments described below.

[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent companies.

[0033] FMDV (O / BY / CHA / 2010) was preserved by the National Foot-and-Mouth Disease Reference Laboratory. The pcDNA3.1 vector and BHK-21 cells were both preserved by the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0034] *E. coli* DH5α was purchased from Shenzhen Kangti Life Technology Co., Ltd.; restriction endonucleases (NotI, BamHI) were purchased from Thermo Fisher Scientific, USA; DNA markers were purchased from Beijing Qingke Biotechnology Co., Ltd.; gel extraction kits were purchased from Omega England Biolabs, USA; T4 DNA ligase was purchased from New England Biolabs; plasmid miniprep kits were purchased from Tiangen Biotech (Beijing) Co., Ltd.; Lipo3000 liposome transfection reagent (L3000015) was purchased from Invitrogen; Trizol reagent and PrimeSTAR Max high-fidelity DNA polymerase were both purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.; reverse transcriptase was purchased from Novizan Biotechnology Co., Ltd.; DMEM cell culture medium was purchased from Invitrogen (Shanghai) Trading Co., Ltd.; fetal bovine serum (FBS) was purchased from Biological Industries (BI); 0.05% EDTA trypsin was purchased from Gibco; and tissue grinding beads (zirconia) were purchased from Wuhan Saiwei Biotechnology Co., Ltd. The probe-based one-step RT-PCR quantitative detection kit was purchased from Shanghai Bioscient Biotechnology Co., Ltd.

[0035] All data involved in statistical analysis were repeated at least three times. Data are expressed as mean ± standard deviation. Statistical differences between the means were analyzed using t-tests: *: P < 0.05; **: P < 0.01; ***: P < 0.001.

[0036] Example 1: Construction of the rFMDV-M403A recombinant virus strain

[0037] This invention designs a complete 3D protein of FMDV with a methionine residue at position 403 mutated to alanine, and synthesizes it together with the unmutated 3D protein at Suzhou Genewiz Biotechnology Co., Ltd. The construction strategy is as follows: Figure 1 As shown. The specific method is as follows:

[0038] 1. Construction of full-length plasmids containing mutant amino acids

[0039] Based on the full-length cDNA sequence of foot-and-mouth disease virus type O, a target gene fragment containing a one-amino acid mutation (3D M403A) with NotⅠ and BamHI restriction sites was designed and synthesized by Suzhou Genewise Biotechnology Co., Ltd. After digestion with NotⅠ and BamHI restriction enzymes, the approximately 3172 bp target fragment was recovered by gel electrophoresis and ligated into the pcDNA3.1(+) vector to obtain the full-length plasmid FMDV-M403A containing the mutated amino acid. Figure 2As shown, the recombinant plasmid was identified by double digestion with BamHI and NotI, and the results showed target bands (3172bp and 2192bp) that matched the expected size. The plasmid with correct enzyme digestion was sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that a full-length plasmid containing the mutant amino acid was successfully constructed.

[0040] 2. Rescue of recombinant viral strains

[0041] 2.5 μg each of the correctly sequenced full-length plasmids FMDV-M403A and rFMDV-WT were mixed with 5 μL of Lipo3000 and transfected into 60%-90% confluent BHK-21 cells (see kit instructions for detailed transfection steps). Normal cells were used as a control. After transfection, the cells were incubated at 37°C with 5% CO2 for 48-72 hours. Cytopathic effects (CPE) were observed daily. When significant CPE was observed in approximately 80%-90% of the cells, the samples were harvested. After repeated freeze-thaw cycles at -80°C 2-3 times, the cells were passaged 10 times in BHK-21 cells and stored at -80°C for later use.

[0042] The results are as follows Figure 3 As shown, when BHK-21 monolayers reached 60%-90% confluency in 6-well plates, they were used for transfection. Plasmids rFMDV-M403A and rFMDV-WT were transfected into BHK-21 cells and cultured for 48 hours. Significant cell morphological changes (CPE) were observed, characterized by rounded cells that detached and formed single or grape-like clusters. However, cells inoculated with rFMDV-M403A showed CPE later, while control cells maintained intact morphology and clear outlines. The virus was harvested, subjected to three freeze-thaw cycles, and passaged in BHK-21 cells until the time to CPE was shortened and the lesions became more typical. This indicates that the recombinant viral strain rFMDV-M403A, with a methionine mutation at position 403 of the 3D protein replaced by alanine, was successfully rescued.

[0043] 3. Identification of recombinant virus strains

[0044] RT-PCR identification: The supernatant of the recombinant viral strain with obvious CPE was repeatedly frozen and thawed, and total RNA was extracted with trizol. After reverse transcription with reverse transcriptase, the target fragment was amplified using primers FMDV-MA-mutant-F: cctgaagctcatggagaagag and FMDV-MA-mutant-R: gcaggtaaagtgatctgtagc. The recovered fragments were sent to Qingke Biotechnology Co., Ltd. for sequencing to identify the correctness of the recombinant viral strain.

[0045] To confirm the correctness of the recombinant viral strain's genome sequence, recombinant viral strain rFM DV-M403A, passaged to the 10th and 12th generations, was collected. Total RNA was extracted from transfected BHK-21 cells using trizol. Specific primers were designed, and the gene fragment containing amino acid position 403 was amplified by RT-PCR. Sequencing results are shown below. Figure 4 As shown, the methionine at position 403 of the 3D protein of the rescued recombinant virus strain rFMDV-M403A was successfully mutated to alanine, and it was able to be stably inherited.

[0046] Example 3: Biological characteristics analysis of foot-and-mouth disease virus recombinant strain rFMDV-M403A

[0047] 1. Viral passage and mutation stability testing

[0048] The correctly identified recombinant virus strain was continuously passaged in BHK-21 cells at a 5% inoculum up to the 10th generation. The time of CPE at each generation was observed and recorded. Total RNA was extracted from the 6th, 8th, and 10th generations of the virus using the trizol extraction method. Fragment genes were amplified by RT-PCR using primers FMDV-MA-mutant-F / FMDV-MA-mutant-R to ensure that the amino acid mutations of the recombinant virus strain were stable during passage. The results are as follows: Figure 4 As shown, the methionine at position 403 of the 3D protein of the rescued recombinant virus strain rFMDV-M403A was successfully mutated to alanine, and it was able to be stably inherited.

[0049] 2. One-step growth curve

[0050] Monolayers of BHK-21 cells were inoculated with 0.1 volumes of passage 10 rFMDV-M403A and rFMDV-WT virus solution, respectively. After 1 hour of adsorption, the virus solution was discarded, and fresh culture medium was used. Samples were taken at different time points to determine the virus titer. A one-step virus growth curve was plotted based on the determined virus titer results.

[0051] Growth curve determination, such as Figure 5 As shown, the replication kinetics of the recombinant viral strain rFMDV-M403A are similar to those of rFMDV-WT, but the growth rate of rFMDV-M403A is slower than that of the wild-type strain, and its titer is significantly lower than that of the parental virus rFMDV-WT, although it can still proliferate effectively in the cell culture system. This indicates that the mutation of methionine to alanine at position 403 of the FMDV 3D protein weakens the virus's replication ability on BHK-21 cells.

[0052] 3. Infection in suckling mice

[0053] Survival experiment in suckling mice: Stable recombinant virus, passaged in BHK-21 cells, was diluted 1000-fold with PBS buffer and subcutaneously injected into the neck and back of 2-4 day old suckling mice. Ten mice were injected with each of the recombinant virus strain rFMDV-M403A and the parental strain rFMDV-WT, with an inoculation volume of 50 μL per mouse. A blank control group was also included. Mice were observed for 8 consecutive days. Mortality was recorded, and a survival rate graph was plotted based on the mortality rate.

[0054] To detect viral replication in the liver: Recombinant virus stably passaged in BHK-21 cells was diluted 1000-fold and subcutaneously injected into the neck and back of 2-4 day old suckling mice. Seven mice were injected with each of the recombinant virus strain rFMDV-M403A and the parental virus rFMDV-WT, with an inoculation volume of 50 μL per mouse. Mice were observed for 7 consecutive days, and livers were collected from mice that died during this period. When the mice were in good condition on the seventh day, all mice were euthanized, and their livers were collected for viral load analysis and viral pathological analysis. Tissue RNA was extracted after grinding, and the amount of viral RNA in the liver was quantified using RT-qPCR. The livers were then sent to Wuhan Saiwei Biotechnology Co., Ltd. for histopathological staining analysis.

[0055] Stable passaged recombinant virus strain rFMDV-M403A and parental strain rFMDV-WT were inoculated into suckling mice. One day after inoculation, some suckling mice inoculated with parental rFMDV-WT developed symptoms such as respiratory distress and limb stiffness; these mice began to die after three days, and all mice died after four days. Suckling mice inoculated with recombinant virus strain rFMDV-M403A remained normal and all survived the observation period. The survival rates of the two strains were as follows: Figure 6 As shown.

[0056] Liver samples were collected from both dead and surviving suckling mice for viral load determination and histopathological analysis. For example... Figure 7 As shown, the viral load in the liver of suckling mice inoculated with the recombinant virus strain rFMDV-M403A was significantly lower than that in suckling mice inoculated with rFMDV-WT. Figure 8 As shown, histopathological analysis revealed extensive liver necrosis and congestion in suckling mice infected with rFMDV-WT, while the liver damage was less severe in suckling mice inoculated with the recombinant virus strain rFMDV-M403A.

[0057] The above results demonstrate that, based on the parental foot-and-mouth disease virus (FMDV) (taking O / BY / CHA / 2010 as an example), successfully mutating methionine at position 403 of the 3D protein to alanine, the constructed recombinant virus strain rFMDV-M403A exhibits significantly weaker virulence compared to the parental strain, making it a potential vaccine candidate and providing a new approach for FMD vaccine preparation. The O-type FMDV 3D mutant strain constructed in this study possesses unique biological characteristics, offering new insights and research directions for FMD prevention and control. Future research can focus on optimizing the performance of the mutant strain, developing novel vaccines, and deepening the understanding of the pathogenic mechanism of FMDV, making a greater contribution to ensuring the healthy development of animal husbandry.

[0058] The embodiments described above are merely illustrative of implementation methods of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make other improvements without departing from the concept of the present invention, and these improvements all fall within the protection scope of the present invention.

Claims

1. Application in preparing an attenuated recombinant foot-and-mouth disease virus strain by mutating methionine at position 403 of the 3D protein of foot-and-mouth disease virus to alanine; wherein the foot-and-mouth disease virus is type O foot-and-mouth disease virus strain O / BY / CHA / 2010.

2. A foot-and-mouth disease recombinant virus strain, characterized in that, The recombinant foot-and-mouth disease virus strain is formed by mutating methionine at position 403 of the 3D protein of the parent foot-and-mouth disease virus to alanine; the parent foot-and-mouth disease virus is the O type foot-and-mouth disease virus strain O / BY / CHA / 2010.

3. The use of the foot-and-mouth disease recombinant virus strain as described in claim 2 in the preparation of foot-and-mouth disease vaccine.

4. The application as described in claim 3, characterized in that, The foot-and-mouth disease vaccine mentioned is an attenuated vaccine.

5. The method for preparing the foot-and-mouth disease recombinant virus strain as described in claim 2, characterized in that, The method involves using genetic engineering to mutate the methionine at position 403 of the parent foot-and-mouth disease virus 3D protein to alanine.

6. The method as described in claim 5, characterized in that, The method includes the following steps: (1) Using the recombinant plasmid of the parent foot-and-mouth disease virus strain O / BY / CHA / 2010 as a template, the methionine at position 403 of the parent foot-and-mouth disease virus 3D protein was mutated to alanine using site-directed mutagenesis PCR to construct the full-length plasmid FMDV-M403A. (2) The full-length plasmid FMDV-M403A was transfected into BHK-21 cells, and the recombinant foot-and-mouth disease virus strain was obtained by virus rescue.

Citation Information

Patent Citations

  • Replication-defective foot-and-mouth disease virus, construction method and application

    CN116804187A