Specific sequence for identifying ST1 type high-poison clostridium difficile and application

Abstract

The invention relates to a specific sequence for identifying ST1 type high-poison clostridium difficile. The specific sequence comprises a nucleotide sequence as shown in SEQ ID No.7. The invention also relates to a method for identifying the ST1 type high-poison clostridium difficile. The method can be used for accurate nucleic acid detection of high-poison-yield clostridium difficile, especially has specificity for ST1 type high-poison-yield clostridium difficile, and can effectively improve the identification level of clostridium difficile infection.

Description

Technical Field

[0001] The present invention relates to a specific sequence for identifying ST1 type highly toxin-producing Clostridium difficile and application thereof. Background Art

[0002] Clostridium difficile ( Clostridioides difficile C. difficile (CD) is a Gram-positive, obligately anaerobic, spore-forming bacillus and the main pathogen of antibiotic-associated diarrhea in hospitals. The clinical symptoms caused by it can range from mild to severe diarrhea, colitis, pseudomembranous colitis, toxic megacolon, etc., and in severe cases, it can even lead to death. In recent years, the morbidity and mortality of Clostridioides difficile infection (CDI) have gradually increased at home and abroad, causing tens of thousands of deaths worldwide each year, and the cost of treatment is as high as billions of dollars. In 2013 and 2019, the Center for Disease Control and Prevention (CDC) of the United States listed C. difficile infection as an urgent-level pathogen of "microorganisms causing public health threats." The pathogenicity of C. difficile is largely attributed to these two toxins, enterotoxin A (TcdA) and cytotoxin B (TcdB). The main pathogenesis of CDI is that spores enter the human body through the fecal-oral route and colonize in the colon. When long-term use of broad-spectrum antibiotics or proton pump inhibitors leads to an imbalance in the intestinal flora, Clostridium difficile multiplies and produces TcdA and TcdB, destroying the intestinal cell skeleton, increasing cell permeability, and ultimately leading to symptoms such as diarrhea. In addition, in recent years, the high-yield strain of Clostridium difficile ST1 / NAP1 / 027 / B1 has broken out in many countries in Europe and the United States. It not only produces TcdA and TcdB, but also binary toxins (cdtA and cdtB), resulting in a significant increase in the incidence and mortality of CDI, which has attracted widespread attention from the whole society to CDI.

[0003] Accurate diagnosis of CDI is crucial to guiding treatment and preventing the spread of pathogens. At present, there are a variety of laboratory detection methods for CDI for different detection targets. The methods for detecting free toxins in feces include enzyme immunoassay (EIA) and fecal cytotoxicity assay (CTA); the methods for determining the specific antigens of Clostridium difficile include EIA method to measure glutamate dehydrogenase (GDH); the methods for detecting toxigenic Clostridium difficile strains include toxigenic Clostridium difficile culture (TC) and nucleic acid amplification test (NAAT). Among them, fecal CTA and TC are the gold standards for detecting toxins or toxic strains, respectively, but due to technical problems and long detection time, these two methods have not been routinely used. The NAAT method is a Clostridium difficile detection method based on molecular detection technologies such as real-time fluorescence PCR, loop-mediated isothermal amplification technology or microarray technology. There are many types of target genes detected by NAATs, including tcdB , tcd as well as tC gene (using ∆117 as a marker for the 027 epidemic strain) or binary toxin ( cdt ) gene. NAATs are very sensitive (average sensitivity 96% (95% CI = 0.93-0.98)) and have a high negative predictive value. Moreover, they are fast and can get results within an hour, so they are often used as a screening test for CDI. However, NAATs still have potential problems, such as due to gene variation, tcdB or tcd Gene fragments may lead to false negatives. tC There is controversy regarding (∆117) as a specific detection site for highly virulent strains of Clostridium difficile.

[0004] In previous studies, we have found that pilin pilW It has the function of identifying highly toxin-producing Clostridium difficile. pilW The gene sequence was compared by BLAST sequence comparison, and a specific site mutation (165 C→T) was found, which can be used to identify high-toxin-producing strains. However, the identification rate of this method for high-toxin-producing strains is not 100%. Among the 25 ST1 high-toxin-producing strains, only 24 strains of high-toxin-producing Clostridium difficile were identified, and the other strain did not have this mutation (DSM_28196). Moreover, among other strains, there is also an ST188 strain (Cd1) that also has this mutation. Therefore, in actual verification, identification errors are inevitable and need further improvement.

[0005] Therefore, there is still a need to further search for new specific gene sequences of highly toxin-producing ST1 type Clostridium difficile in order to further improve the accuracy of detection. Summary of the invention

[0006] The purpose of the present invention is to provide a specific sequence that can accurately identify ST1 type highly toxin-producing Clostridium difficile.

[0007] The present invention adopts the following technical solution: A specific sequence for identifying ST1 type highly toxin-producing Clostridium difficile, comprising the nucleotide sequence shown in SEQ ID No.7.

[0008] Furthermore, the above-mentioned specific sequence is f The mutated gene is f There is a T→C mutation at position 301 and an A→G mutation at position 558. fThe gene sequence was derived from the NCBI Gene database (Gene symbol: fliF; Gene description: flagellar basal-body MS-ring / collar protein FliF; Locus tag: KNZ77_RS01820).

[0009] A primer pair for amplifying the above-mentioned specific sequence, the nucleotide sequences of which are shown as SEQ ID No.5 and SEQ ID No.6.

[0010] An application of the above primer pair in identifying ST1 type highly toxin-producing Clostridium difficile.

[0011] A detection kit comprising the primer pair as claimed in claim 3.

[0012] A method for identifying ST1 type highly toxin-producing Clostridium difficile, using the primer pair shown in SEQ ID No.5 and SEQ ID No.6, to perform SYBR Green detection on the genomic DNA of the bacteria to be detected, if the detection result is positive, the bacteria is determined to be ST1 type highly toxin-producing Clostridium difficile.

[0013] The beneficial effect of the present invention is that the present invention can be used for accurate nucleic acid detection of highly toxin-producing Clostridium difficile, especially has specificity for ST1 type highly toxin-producing Clostridium difficile, and can effectively improve the identification level of Clostridium difficile infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 for f Presence of genes in different ST-type strains of C. difficile.

[0015] Figure 2 Clostridium difficile f Gene clustering analysis.

[0016] Figure 3 for f Sequence analysis of the mutation site at position 301 of the gene.

[0017] Figure 4 for f Sequence analysis of the mutation site at position 558 of the gene.

[0018] Figure 3 and Figure 4 In red font, CP037844.1 is the Cd1 (ST188 type) strain, and the other red fonts are ST1 strains. The blue font (serial number: CP012320.1) is the DSM_28196 (ST1 type) strain. The yellow and green background characters are the locations of the mutations.

[0019] Figure 5 Based on f Schematic diagram of the PCR reaction curves for mutations at positions 301 and 558 of the gene. DETAILED DESCRIPTION

[0020] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] The present invention is directed to Clostridium difficile flagellin. f In the study of genes, flagellin was found f The presence of the gene varies between strains. f Gene (SEQ ID No.1) was used to design primers (SEQ ID No.2 and SEQ ID No.3), and 108 strains of local clinical strains and preserved reference strains were tested by conventional PCR and agarose gel electrophoresis. Figure 1 As shown, pilin f The gene is present in strains of types ST1, ST37, ST2, ST3, ST35, ST37, ST54, ST26, ST48, ST205, ST53, ST8, and ST5, but is not present in strains of types ST11, ST39, and ST240, and is partially present in strains of types ST8 and ST102.

[0022] SEQ ID No.1:

[0023] SEQ ID No. 2 (fliF_PF): TAAGATTAAGGAGCAAGTTGCTA.

[0024] SEQ ID No. 3 (fliF_PR): TTTATTATTCTCTGTTACTTGGTCTGGCTT.

[0025] Based on the above findings, the 108 strains were further analyzed. f Gene sequencing and sequence comparison were performed to further identify the pilin f The sequence differences of the genes in these isolates were compared. Sequence comparison revealed that ST1 strains f There are specific T→C and A→G mutations at positions 301 and 558 of the gene. Taking the ST1 type highly virulent strain R20291 as an example, f The mutant gene sequence is shown in SEQ ID No.4.

[0026] SEQ ID No.4:

[0027] On this basis, in order to verify whether these two mutation sites have broad application significance in highly toxin-producing ST1 Clostridium difficile, we used f The mutant gene sequence was BLASTed on NCBI. Cluster analysis was performed on the 100 matched strains, and it was found that f The mutant gene has a good clustering ability and can cluster specific ST types of Clostridium difficile into one branch, including 27 strains of ST1 high-toxin-producing Clostridium difficile ( Figure 2 ). Moreover, pilW Different genes, f The mutant gene can also cluster DSM_28196 (ST1 type) and other ST1 type strains on the same branch. pilW Compared with genes, f The mutant gene has a better ability to identify highly toxin-producing ST1 type C. difficile.

[0028] To further confirm whether these two mutations can more accurately distinguish ST1 and ST188 types of Clostridium difficile, f Do these two mutations of the mutant gene exist in DSM_28196 (ST1 type, Accession ID: CP012320.1) and Cd1 (ST188 type, Accession ID: CP037844.1). After sequence comparison, it was found that this mutation site is indeed present in 27 ST1 strains, but not in Cd1 (ST188 type) strains ( Figure 3 and Figure 4 ).

[0029] The results show that f Two mutation sites in the mutant gene, fliF_301 (T→C) and fliF_558 (A→G), can be used to identify highly toxin-producing ST1 type Clostridium difficile.

[0030] Next, primer pairs were designed for the two mutation sites, and the nucleotide sequences of the primer pairs are shown in SEQ ID No. 5 and SEQ ID No. 6. The amplified target sequence is shown in SEQ ID No. 7.

[0031] SEQ ID No. 5 (F2_301): CAGAAGTTGATAAGTTAAGGCTGGAGC.

[0032] SEQ ID No. 6 (R2_558): GTGCCCATAACAGATTTTATTTGGTTTTTTTCC.

[0033] SEQ ID No.7: CAGAAGTTGATAAGTTAAGGCTGGAG C TAGCACCAAGTCTTACAGGTGGTTCTAAAGGATTTGCACTAATGGATGATAGTTCATCAATAGGACTTACTGATGAAGAGTTTCAGATTAAGAAGCAAAGAATGATACAAGGTGAAATAGAAAAAACA ATAAAGAGTTTTCCACAAGTGGAAGATACTAGAGTACATATAACATTTGGAGAGTCATCAGTATTTGAGAAGGAGGCTATTCCAGGGAGTGCAGCAGTTTATTTGATGTTAAAACCAGGGACGACTTT G GAAAAAAACCAAATAAAATCTGTTATGGCAC.

[0034] SYBR Green method was used to detect 108 local isolated and reference Clostridium difficile strains. The total reaction system was 20 μL, including 10 μL of 2×SYBR Green qPCR Master Mix, 0.6 μL of upstream and downstream primers (10 pmol / L), 6.8 μL of ddH2O, and 2 μL of template DNA. The reaction conditions were: 95°C pre-denaturation for 3 min; 95°C denaturation for 5 s, 65°C annealing for 30 s, and 70°C extension for 30 s, for a total of 40 cycles. After the reaction, the results can be interpreted according to the amplification of the target curve.

[0035] The results showed that (such as Figure 5 ), the amplification curve of the ST1 strain showed a typical S-shaped curve, indicating that the test result was positive; while the amplification curves of the non-ST1 strains did not show an S-shaped curve, indicating that the test result was negative. The primers and methods of the present invention can accurately distinguish between ST1 and non-ST1 strains.

[0036] In summary, f The mutant gene is specific and can accurately detect highly toxin-producing strains of ST1 Clostridium difficile, which is innovative and has broad application prospects.

Claims

1. A specific sequence for identifying ST1 type highly toxin-producing Clostridium difficile, characterized in that: It comprises the nucleotide sequence shown as SEQ ID No.

7.

2. The specific sequence for identifying ST1 type highly toxin-producing Clostridium difficile according to claim 1, characterized in that: Its f The mutant gene f Mutated genes in f There is a T→C mutation at position 301 and an A→G mutation at position 558 of the gene.

3. A primer pair for amplifying the specific sequence according to claim 1, characterized in that: The nucleotide sequences thereof are shown in SEQ ID No.5 and SEQ ID No.

6.

4. Use of the primer pair as claimed in claim 3 in identifying ST1 type highly toxin-producing Clostridium difficile.

5. A detection kit, characterized in that: Comprising the primer pair as claimed in claim 3.

6. A method for identifying ST1 type highly toxin-producing Clostridium difficile, characterized in that: The genomic DNA of the bacteria to be tested is detected by SYBR Green method using the primer pair shown in SEQ ID No.5 and SEQ ID No.

6. If the test result is positive, the bacteria is determined to be ST1 type highly toxin-producing Clostridium difficile.

Images