Construction method of transferrin overexpression non-human primate animal model and application of transferrin overexpression non-human primate animal model in construction of cerebral apoplexy animal model

Abstract

The invention provides a construction method of a transferrin overexpression non-human primate animal model and application of the transferrin overexpression non-human primate animal model in construction of a cerebral apoplexy animal model, and belongs to the technical field of disease animal model construction. The invention relates to a method for constructing a transferrin over-expression non-human primate animal model, which comprises the following step of: introducing recombinant adeno-associated virus obtained by packaging a recombinant expression adeno-associated virus vector of a transferrin coding gene into a non-human primate animal for over-expression to obtain the transferrin over-expression non-human primate animal model. The method has the characteristics of being short in animal model construction period, remarkable in phenotype, high in repeatability and beneficial to large-scale application, and can be applied to research on thrombosis diseases such as cerebral apoplexy and coronary heart disease. The apoplexy animal model is constructed by adopting a photochemical induction method on the basis of the transferrin overexpression non-human primate animal model, the difference of various phenotypes after the transferrin overexpression can be observed, and a solid foundation is provided for revealing the pathogenesis of the apoplexy.

Description

Technical Field

[0001] The present invention belongs to the technical field of disease animal model construction, and specifically relates to a method for constructing a transferrin overexpressing non-human primate model and an application of the method in constructing a stroke animal model. Background Art

[0002] Stroke is a general term for a group of diseases in which sudden local cerebral blood circulation disorders cause neurological dysfunction, usually caused by vascular embolism or blood vessel rupture. Patients with moderate to severe stroke often induce complications of other geriatric diseases, posing a great threat to human life and health. However, current intervention treatment methods are limited, and it has become an urgent need to analyze its pathogenesis and develop effective prevention and intervention strategies. Selecting a suitable animal model is the key to disease mechanism research and drug development. Currently commonly used model animals such as rodents such as rats and mice are easy to genetically manipulate, but because they cannot completely replicate the complexity of human diseases and cannot accurately simulate the pathogenesis of human brain diseases, they have also become a major problem that needs to be solved in drug development and clinical practice. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide a method for constructing a transferrin overexpression non-human primate model, by overexpressing the transferrin encoding gene in non-human primates through adenovirus mediation, thereby providing a basis for the construction of an animal model of stroke.

[0004] The present invention provides a method for constructing a transferrin overexpression non-human primate model, comprising the following steps:

[0005] Packaging the recombinant adeno-associated virus vector for expressing the transferrin coding gene and the auxiliary vector to obtain a recombinant adeno-associated virus;

[0006] The recombinant adeno-associated virus is introduced into non-human primates for overexpression to obtain a transferrin overexpression non-human primate model.

[0007] Preferably, the recombinant adeno-associated virus is introduced by intravenous injection;

[0008] The dosage of the recombinant adeno-associated virus is not less than 1×10 12 VG / pc.

[0009] Preferably, the recombinant adeno-associated virus vector is constructed by cloning the fusion gene formed by the kozak sequence and the transferrin coding gene into the XhoI and SpeI multiple cloning sites in the backbone vector;

[0010] The backbone vector includes GPAAV-CMV-P2A-eGFP-WPRE.

[0011] Preferably, the nucleotide sequence of the gene encoding transferrin is as shown in SEQ ID NO:1.

[0012] The present invention provides the construction method or the use of the transferrin overexpressing non-human primate model obtained by the construction method in preparing a non-human primate thrombotic disease model.

[0013] The invention provides the use of a reagent for promoting transferrin overexpression and a photochemical inducer in preparing a non-human primate model of cerebral stroke.

[0014] Preferably, the reagent promoting overexpression of transferrin comprises a recombinant adeno-associated virus vector or a recombinant adeno-associated virus containing a gene encoding transferrin.

[0015] Preferably, the photochemical inducer comprises Rose Bengal and a green light source.

[0016] Preferably, the photochemical inducer is used to induce treatment in non-human primates 25 days after treatment with the transferrin overexpressing agent.

[0017] Preferably, the induction treatment method is to inject Rose Bengal into the non-human primate with overexpression of transferrin, and then irradiate the arterial area of ​​the motor cortex and sensory cortex of the non-human primate with green light;

[0018] The duration of green light irradiation is 18 to 22 minutes;

[0019] The spot diameter of the green light irradiation is 7-9 mm.

[0020] The present invention provides a method for constructing a transferrin overexpression non-human primate model, comprising the following steps: packaging a recombinant adeno-associated virus vector and an auxiliary vector of a transferrin coding gene to obtain a recombinant adeno-associated virus; introducing the recombinant adeno-associated virus into a non-human primate for overexpression to obtain a transferrin overexpression non-human primate model. The present invention uses non-human primates as host animals, which are superior to their highly similar genetic composition, physiological metabolism, tissue and organ structure, and behavioral cognitive functions to humans, and can highly restore the molecular mechanism of disease occurrence and development, providing technical support for drug development and disease treatment. At the same time, the present invention uses adeno-associated viruses to mediate the expression of transferrin coding genes in animals, which not only avoids the adverse factors of viral cytotoxicity, but also ensures the overexpression of exogenous target genes. The embodiment of the present invention shows that the coagulation time of the transferrin overexpression non-human primate model constructed by the present invention is shortened. It can be seen that the present invention successfully established an animal model of non-human primate coagulation tendency by overexpressing the coagulation regulatory factor transferrin, which can be used in the construction of thrombotic disease models such as stroke, coronary heart disease and atherosclerosis.

[0021] The present invention provides the use of reagents that promote transferrin overexpression and photochemical inducers in the preparation of non-human primate models of stroke. The present invention first constructs an animal model of non-human primate coagulation tendency by using a reagent that promotes transferrin overexpression, and then uses this as a treatment object to obtain a photochemical induction using a photochemical inducer. The results of the embodiments of the present invention show that compared with the empty adeno-associated virus group, the macaques in the transferrin overexpression group had more severe brain pathological damage volume and poor recovery ability after photochemical induction treatment, and the ability to evaluate behavioral functions was significantly reduced. The application provided by the present invention makes it possible to observe more phenotypes and differences in drug treatment in stroke disease models, and provides a new means for revealing the pathogenesis of stroke and the clinical treatment of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The graph shows the expression of transferrin in macaque plasma after injection of macaque transferrin-overexpressing adeno-associated virus and control empty adeno-associated virus at different times;

[0023] Figure 2 This is a graph showing the results of coagulation index detection in plasma of a non-human primate model with overexpression of transferrin;

[0024] Figure 3 The figure shows the expression results of transferrin in the cerebrospinal fluid of transferrin-overexpressing macaques;

[0025] Figure 4 This is the result of blood routine index test after photochemical induction surgery in transferrin-overexpressing macaques;

[0026] Figure 5 The results of MRI detection of brain edema in two groups of non-human primate stroke models; A is the MRI image result, and B is the injury volume statistical result;

[0027] Figure 6 These are the results of postoperative behavioral testing of photochemically induced transferrin-overexpressing macaques, where A is the behavior graph of the modified Brinkman plate feeding task, B is the average single feeding time result graph of the Brinkman plate feeding task, C is the number of successful feedings in the first 30 seconds of the Brinkman plate feeding task, D is the total time to complete the Brinkman plate feeding task, E is the behavior graph of the vertical trough feeding task, and F is the feeding time of the vertical trough feeding task. DETAILED DESCRIPTION

[0028] The present invention provides a method for constructing a transferrin overexpression non-human primate model, comprising the following steps:

[0029] Packaging the recombinant adeno-associated virus vector for expressing the transferrin coding gene and the auxiliary vector to obtain a recombinant adeno-associated virus;

[0030] The recombinant adeno-associated virus is introduced into non-human primates for overexpression to obtain a transferrin overexpression non-human primate model.

[0031] The invention packages a recombinant adeno-associated virus vector for expressing the coding gene of transferrin and an auxiliary vector to obtain a recombinant adeno-associated virus.

[0032] In the present invention, the construction method of the recombinant adeno-associated virus vector is preferably to clone the fusion gene formed by the kozak sequence and the gene encoding transferrin into the XhoI and SpeI multiple cloning sites in the backbone vector. The kozak sequence promotes the recognition and binding of the ribosome to the start codon, thereby improving the efficiency of translation initiation. The backbone vector preferably includes a plasmid obtained by removing the GFP gene from the GPAAV-CMV-P2A-eGFP-WPRE as the basic vector. The nucleotide sequence of the gene encoding transferrin is preferably as shown in SEQ ID NO: 1. The length of the recombinant adeno-associated virus vector is 7545bp.

[0033] In the present invention, the auxiliary vector preferably includes an adenovirus AAV9 auxiliary packaging plasmid and a serotype plasmid. The recombinant adeno-associated virus vector, the serotype plasmid and the adenovirus AAV9 auxiliary packaging plasmid form a packaging system according to a molar ratio of 1:1:2. In the packaging system, the working concentration of the recombinant adeno-associated virus vector is preferably 500ng / μL. The packaging method transfects the packaging system into mammalian cells under the action of a transfection reagent. The present invention does not impose any special restrictions on the type of the transfection reagent, and a transfection reagent well known in the art can be used, such as HG transgene reagent. The mammalian cells are preferably AAV Pro-293T cells. The transfection time is preferably 15 to 20 minutes, more preferably 20 minutes. After the transfection, fresh culture medium is replaced for 6 to 8 hours to continue culturing. The number of copies of the virus in the virus concentrate is detected by quantitative PCR to verify whether the adeno-associated virus is successfully packaged. The results show that the packaged adeno-associated virus particles are successfully obtained.

[0034] The recombinant adeno-associated virus is introduced into non-human primates for overexpression to obtain a transferrin overexpression non-human primate model.

[0035] In the present invention, the non-human primate preferably includes macaques and / or cynomolgus monkeys. Transferrin is mainly synthesized in the liver, so the recombinant adeno-associated virus is preferably introduced by intravenous injection, rapidly distributed to the liver through the blood circulation and infected to achieve overexpression. In addition, transferrin can specifically bind to the transferrin receptor present on the surface of brain capillary endothelial cells of the blood-brain barrier to form a transferrin-receptor complex, which can enter the brain through endocytosis and then dissociate from the receptor, thereby achieving the passage of transferrin in the blood-brain barrier. The dosage of the recombinant adeno-associated virus is not less than 10 12 VG / pcs, can be 5×10 12 ~10 14 The working concentration of the recombinant adeno-associated virus is preferably 10 13 VG / mL, can be 10 12 -10 14 VG / mL. The present invention injects the recombinant adeno-associated virus into macaques by intravenous injection, and the transferrin content detection shows that transferrin is overexpressed not only in the plasma of peripheral blood, but also in the cerebral blood. The changes in coagulation indexes are further measured. Result a shows that the detection values ​​of APTT and FIB in transferrin-overexpressing macaques are lower than those in the control group, which indicates that the coagulation time of transferrin-overexpressing macaques is shortened, showing a high coagulation tendency.

[0036] In view of the fact that the transferrin-overexpressing non-human primate model has the characteristic of shortened coagulation time, the present invention provides the use of the construction method or the transferrin-overexpressing non-human primate model obtained by the construction method in preparing a non-human primate thrombotic disease model.

[0037] In the present invention, the thrombotic disease preferably includes at least one of the following: stroke, coronary heart disease and atherosclerosis.

[0038] The invention provides the use of a reagent for promoting transferrin overexpression and a photochemical inducer in preparing a non-human primate model of cerebral stroke.

[0039] In the present invention, the reagent for promoting overexpression of transferrin preferably comprises a recombinant adeno-associated virus vector or a recombinant adeno-associated virus containing a gene encoding transferrin. The nucleotide sequence of the gene encoding transferrin is preferably as shown in SEQ ID NO: 1. The present invention has no particular restrictions on the construction method of the recombinant adeno-associated virus vector or a recombinant adeno-associated virus containing a gene encoding transferrin, and the construction method of the recombinant adeno-associated virus vector or a recombinant adeno-associated virus well known in the art can be used.

[0040] In the present invention, the photochemical inducer preferably includes Rose Bengal and a green light source. The emission wavelength of the green light source is preferably 528-532nm, and can be 530nm. In the present invention, the photochemical inducer is preferably induced in the non-human primate treated with the transferrin overexpressing reagent for 25d. The method of the induction treatment is preferably to inject Rose Bengal into the non-human primate overexpressing transferrin, and then irradiate the arterial area of ​​the motor cortex and sensory cortex of the non-human primate with green light. The injection dose of Rose Bengal is 20mg / kg / time, and the total injection is 2 times, and the interval between the two injections is preferably 20min. The effect of Rose Bengal is to produce free radicals by photocatalytic degradation, damage vascular endothelial cells, promote platelet aggregation, activate the coagulation process, and thus promote thrombosis. The duration of the green light irradiation is preferably 18-22min, more preferably 20min. The spot diameter of the green light irradiation is preferably 7-9mm, and can be 8mm.

[0041] In the present invention, the present invention detects the blood routine, behavioral phenotype, transferrin expression and pathological tissue of the brain injury area of ​​the constructed non-human primate model of stroke. The results show that the transferrin-overexpressing macaques have poor recovery ability after photochemical induction (PT), and the edema injury in the lesion area of ​​the transferrin-overexpressing group is more persistent.

[0042] The following is a detailed description of the method for constructing a transferrin overexpressing non-human primate model provided by the present invention and its application in constructing a stroke animal model in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0043] Example 1

[0044] A method for constructing a transferrin overexpression non-human primate model

[0045] 1. Construction of macaque transferrin gene overexpression plasmid and adeno-associated virus packaging

[0046] 1.1 Plasmid construction

[0047]

[0048] 1.2 Adeno-associated virus packaging

[0049] The successfully constructed adeno-associated expression vector and adenovirus AAV9 auxiliary packaging plasmid were extracted using a high-purity, endotoxin-free kit and transfected using a transfection reagent (HG transgene TM The constructed viral vector and its auxiliary packaging element plasmid were co-transfected into AAVPro-293T cells using reagent. In the transfection, the expression plasmid (10 μg), serotype plasmid and auxiliary plasmid were prepared in a molar ratio of 1:1:2 to prepare the transfection system. After 6 to 8 hours of transfection, fresh culture medium was replaced with Enhancing buffer (5 mM). After 72 hours of continuous culture, cells rich in viral particles and supernatant were collected after cell detachment, and high-titer viral concentrate was obtained after concentration and purification. At the same time, in the control group, a blank vector without the target gene was used to replace the adeno-associated expression vector and the adenovirus AAV9 auxiliary packaging plasmid for adeno-associated virus packaging, and the obtained virus was the control adeno-associated virus.

[0050] 1.3 Adeno-associated virus titer test

[0051] Before the titer test, a standard plasmid needs to be prepared. The bacterial solution containing the empty vector plasmid is cultured overnight, and 3-5 mL of fresh bacterial solution is taken to extract the plasmid. Take 1 μg of the extracted empty vector plasmid, double-digest it with Xho I restriction endonuclease and Spel restriction endonuclease, and then perform agarose gel electrophoresis on the digestion product. After the electrophoresis, perform gel recovery. At the same time, the recombinant vector of the transferrin encoding gene prepared above is also double-enzymed, and the digestion product is subjected to agarose electrophoresis and the target fragment is recovered. Determine the concentration of the recovered vector and the target fragment, and calculate the required volume ratio according to the molar ratio of vector: target fragment = 1:7, and connect the vector and the target fragment with DNA ligase. Finally, the ligation product is transformed into the prepared Escherichia coli competent cells. After the resistance screening link, a single colony is picked from it for sequencing and identification.

[0052] Prepare samples and standards by serially diluting the standard plasmid 10-fold, with the standard plasmid set to the original concentration, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 ; 10-fold gradient dilution of the sample to be tested, specifically: 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7. The total volume of the reaction tube was calculated according to the number of reactions (X) (two replicate wells were made for each gradient above). The qPCR system was set up as follows: 2×SYBR Mix (10 μL), 0.2 μL 10 μM upstream primer (CGCTATGTGGATACGCTGCTTTA, SEQ ID NO: 2), 0.2 μL 10 μM downstream primer (GCAACCAGGATTTATACAAGGAGGA, SEQ ID NO: 3), template (2 μL), and then ultrapure water (7.6 μL) was used to supplement the total system to 20 μL. The reaction system was: pre-denaturation 95°C (30 s); PCR cycle 95°C (15 s), 60°C (60 s), a total of 40 cycles; melting curve 60°C→95°C. The number of AAV virus particles was determined by qPCR to detect the genome copy number of the AAV vector to determine whether the adeno-associated virus was successfully packaged. The results showed that recombinant AAV virus particles were successfully obtained.

[0053] 2. Construction of macaque transferrin overexpression model

[0054] The successfully packaged transferrin overexpressing adeno-associated virus and blank vector adeno-associated virus were injected intravenously into macaques (4 empty vectors and 4 transferrin overexpressing vectors), with a virus injection dose of 1×10 13 VG / mL / mouse. Serum was collected before virus injection (0d) and after virus injection (7d, 14d, 20d, 25d, 30d, 36d, 43d) for transferrin content detection (ELISA detection) to evaluate the transferrin overexpression effect. The steps for detecting transferrin content in macaque serum are as follows:

[0055] The macaque serum was diluted with coating solution (0.01 sodium carbonate, pH 9.6) at a dilution ratio of 1:5000, and 100 μL was added to each well of a 96-well flat-bottom immunoplate, 3 replicates were set, and incubated overnight at 4°C. The supernatant was then discarded, and the plate was washed 3 times with PBST buffer (PBS buffer containing 0.1% Tween 20), and 100 μL of 5% BSA blocking solution (5 g BSA dissolved in 100 g PBST buffer) was added to each well and incubated at 37°C for 1 h.

[0056] After washing 3 times, anti-transferrin antibody (1:1000) was dissolved in blocking solution, 100 μL was added to each well, and incubated at 37°C for 1 hour. After washing 3 times again, rabbit IgG secondary antibody (1:5000) was added and incubated at 37°C for another 1 hour. 90 μL / well TMB buffer was used for color development, and incubated at 37°C for about 10 minutes. After a clear color gradient was observed, 50 μL / well stop solution was used to stop the reaction. The absorbance was detected at 450 nm using an enzyme reader.

[0057] Results Figure 1 . 14 days after intravenous injection of adeno-associated virus (AAV) into macaques, a significant increase in the level of transferrin can be detected in the blood.

[0058] Example 2

[0059] Detection of coagulation time in transferrin-overexpressing macaques

[0060] The four coagulation parameters of peripheral blood of transferrin-overexpressing macaques were tested by an automatic coagulation function analyzer, including prothrombin time (PT), activated partial thromboplastin time (APTT), thrombin time (TT) and fibrinogen (FIB).

[0061] Results Figure 2 The APTT and FIB values ​​of transferrin-overexpressing macaques were lower than those of the control macaques.

[0062] Example 3

[0063] Application of transferrin-overexpressing macaques in photochemically induced stroke model

[0064] 25 days after the injection of transferrin overexpressing virus (TF) and empty virus (Vehicle), photochemical induction was performed to construct a stroke model. First, the blood routine, behavioral phenotype (Brinkman board feeding, vertical trough feeding) and magnetic resonance imaging of the two groups of macaques were tested and the baseline values ​​were recorded.

[0065] The photochemical induction of stroke model was performed as follows: after the macaques were intravenously injected with Rose Bengal (20 mg / kg, 2 injections were performed at an interval of 20 min), the motor cortex and sensory cortex of the macaques' brain were surgically exposed, and 3 sites in the lateral fissure segment at the distal opercular segment of the middle artery (M3) were selected and irradiated with green light (530 nm, spot size 8 mm) for 20 min each to induce stroke.

[0066] The blood routine, behavioral phenotype (Brinkmanboard feeding, vertical trough feeding) and magnetic resonance imaging of the two groups of macaques after induction were tested. Finally, the macaque brain was perfused and sampled 30 days after light induction, and the expression of transferrin in the cerebrospinal fluid was tested to verify the effect of transferrin overexpression on the macaque photochemical-induced stroke model.

[0067] Results Figure 3 The transferrin content in the cerebrospinal fluid of transferrin overexpressing macaques and control macaques was detected by enzyme-linked immunosorbent assay. At 30 days after surgery, the transferrin content in the cerebrospinal fluid of the overexpressing macaques was still high and showed a significant difference.

[0068] Results Figure 4 . The blood routine indicators were tested by a fully automatic blood analyzer. Compared with the control macaques, the transferrin overexpression macaque group had a stronger level of inflammatory response after surgery, a larger increase in the amplitude, and a significant difference. This indicates that transferrin overexpression promotes the increase of inflammatory response in macaques after photochemical induction.

[0069] Results Figure 5 . A three-dimensional weighted fast spin echo sequence (voxel size = 0.5 × 0.5 × 0.5 mm, echo time = 396.48 ms, repetition time = 3400 ms, deflection angle: 59°) was used to detect the phenotype of brain edema in macaques after photochemical induction. Compared with the control macaques, the edema damage in the lesion area of ​​the transferrin-overexpressing macaque group was more persistent and showed significant differences. This indicates that transferrin-overexpressing macaques have poor recovery ability after photochemical induction.

[0070] Results Figure 6 . The finger motor function phenotype of macaques after photochemical induction was evaluated using the modified Brinkman board feeding task and the vertical slot feeding task. Compared with the control macaques, the transferrin-overexpressing macaques in the modified Brinkman board feeding task had significantly fewer successful feeding times after surgery than the preoperative baseline level, as shown by a reduced rate of change in the number of successful feeding times, and the postoperative feeding time was significantly slower than the preoperative baseline level, as shown by an increased rate of change in feeding time; in addition, the transferrin-overexpressing macaques in the vertical slot feeding task had significantly slower postoperative feeding time than the preoperative baseline level; while the control macaques had little change in the number of times and feeding time after surgery, or were slightly better than before surgery. This suggests that transferrin-overexpressing macaques can aggravate photochemical-induced stroke damage and have poor recovery from damage.

[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for constructing a transferrin overexpression non-human primate model, characterized in that: The following steps are involved: Packaging the recombinant adeno-associated virus vector for expressing the transferrin coding gene and the auxiliary vector to obtain a recombinant adeno-associated virus; The recombinant adeno-associated virus is introduced into non-human primates for overexpression to obtain a transferrin overexpression non-human primate model.

2. The construction method according to claim 1, characterized in that: The recombinant adeno-associated virus is introduced by intravenous injection; The dosage of the recombinant adeno-associated virus is not less than 1×10 12 VG / pc.

3. The construction method according to claim 1, characterized in that: The recombinant adeno-associated virus vector is constructed by cloning the fusion gene formed by the kozak sequence and the transferrin coding gene into the XhoI and SpeI multiple cloning sites in the backbone vector; The backbone vector includes GPAAV-CMV-P2A-eGFP-WPRE.

4. The construction method according to claim 1 or 3, characterized in that: The nucleotide sequence of the transferrin encoding gene is shown in SEQ ID NO:

1.

5. Use of the construction method according to any one of claims 1 to 4 or the transferrin-overexpressing non-human primate model obtained by the construction method in preparing a non-human primate thrombotic disease model.

6. Application of a reagent promoting transferrin overexpression and a photochemical inducer in preparing a non-human primate stroke model.

7. The use according to claim 6, characterized in that: The reagent for promoting overexpression of transferrin includes a recombinant adeno-associated virus vector or a recombinant adeno-associated virus containing a gene encoding transferrin.

8. The use according to claim 6 or 7, characterized in that: The photochemical inducer includes Rose Bengal and a green light source.

9. The use according to claim 8, characterized in that: The photochemical inducing agent is used to induce the transferrin overexpressing agent-treated non-human primates for 25 days.

10. The use according to claim 9, characterized in that: The induction treatment method comprises injecting Rose Bengal into the non-human primate with overexpression of transferrin, and then irradiating the arterial area of ​​the motor cortex and sensory cortex of the non-human primate with green light; The duration of green light irradiation is 18 to 22 minutes; The spot diameter of the green light irradiation is 7-9 mm.

Images