Trichoderma asperellum TAZ19, biocontrol agent and application thereof

Abstract

The present application provides a strain of Trichoderma asperellum TAZ19, a biocontrol agent and application thereof, wherein the Trichoderma asperellum TAZ19 is preserved in China Center for Type Culture Collection on October 25, 2024, and the preservation number is CCTCC M 20242341. The active ingredient of the biocontrol agent comprises the above-mentioned Trichoderma asperellum TAZ19 strain, and the Trichoderma asperellum TAZ19 strain is one or more of conidium, mycelium, fermentation filtrate or active extract thereof. The Trichoderma asperellum TAZ19 has excellent antagonistic effect on multiple plant disease pathogens such as Diaporthe phaseolorum, multiple Fusarium oxysporum, Valsa mali, and Botryosphaeria dothidea, has broad-spectrum antibacterial property, fast growth, high antibacterial activity, strong parasitism, and good salt and alkali tolerance, and has a growth-promoting effect on plants. The Trichoderma asperellum TAZ19 can be widely applied to the prevention and treatment of multiple plant diseases such as pine branch and stem rot, wheat stem base rot, tomato wilt, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a strain of Trichoderma echinosporum TAZ19, a biocontrol agent, and its application. Background Technology

[0002] As a major agricultural country, agriculture is the foundation of our nation, and sustained high yields are a decisive factor in our food security. However, crops are easily infected by pathogens during their growth, leading to various diseases and causing huge losses to agricultural production. With the continued warming of the global climate, outbreaks and epidemics of various crop diseases and pests are becoming more frequent. Effective prevention and control of crop diseases has become a crucial limiting factor for stable and high crop yields.

[0003] To reduce losses to agricultural and forestry production caused by pests and diseases, many control technologies and systematic methods for plant pests and diseases have been established. However, in practice, due to their low cost, rapid effect, and ease of use, the application of chemical pesticides still dominates the market, accounting for 80%. However, the overuse of chemical pesticides has caused many negative impacts, such as ecological damage, environmental pollution, excessive residues, and pathogen resistance, even threatening human health. Our country has begun research and development and application promotion of technologies to reduce the use of chemical pesticides and fertilizers in agricultural production. To promote green development in agricultural production and reduce the use of chemical pesticides, it is urgent to research and promote green control technologies for plant pests and diseases.

[0004] Biological control is a crucial measure for the prevention and control of plant diseases. Biocontrol bacteria can control the population of harmful organisms by suppressing diseases, inducing plant resistance, competing for nutrients and ecological niches, exhibiting hyperparasitism, or lysis, thereby effectively controlling plant diseases and pests. Furthermore, based on their environmental friendliness, ecological safety, and harmlessness to natural enemies, biocontrol agents prepared using antagonistic bacteria are the best alternative to chemical agents. Currently, various commercially available biocontrol agents are widely used in the control of plant fungal diseases, plant nematode diseases, and plant oomycete diseases.

[0005] However, the existing biocontrol agents have relatively limited functions, insufficient lysis spectrum width, different lysis specificity, and different application ranges. They also have poor salt and alkali tolerance, which limits their practical application. Meanwhile, there are few reports of excellent bacterial strains that can control diseases, tolerate salt and alkali, and promote plant growth.

[0006] Therefore, existing technologies need further improvement. Summary of the Invention

[0007] To address the aforementioned problems, this invention provides a strain of Trichoderma echinococcus, TAZ19, a biocontrol agent, and its applications. The Trichoderma echinococcus TAZ19 has a broad antibacterial spectrum and strong antibacterial activity, as well as good salt and alkali tolerance. It also has a growth-promoting effect on plants and can be widely used as a biocontrol agent for the prevention and control of various plant pathogens and for promoting plant growth.

[0008] To address the above problems, this application provides the following technical solution:

[0009] Firstly, this application provides a strain of Trichoderma acicularis ( Trichoderma asperellum TAZ19, with accession number CCTCC M 20242341.

[0010] This strain was isolated from the rhizosphere soil of grapes at the Qingdao Agricultural University internship base in 2022. Its morphological characteristics are as follows: the colonies formed on PDA plates are initially white and round, and gradually turn green as the culture time increases (producing conidia); under electron microscopy, its sporulating cells are flask-shaped, and the conidia are nearly round or elliptical. Both the morphological and molecular biological identification results of this strain indicate that it is a new Trichoderma echinosporum strain, which is named TAZ19.

[0011] This strain was deposited at the China Center for Type Culture Collection, Wuhan University on October 25, 2024, with accession number CCTCC M 20242341.

[0012] Experiments have shown that *Trichoderma echinococcus* TAZ19 exhibits good antifungal activity against various plant pathogens, including *Fusarium oxysporum* of tobacco, *Fusarium oxysporum* of tomato, *Fusarium solanum*, *Anthracis chinensis*, *Fusarium graminearum* of potato, *Fusarium graminearum*, *Sclerotium sclerotiorum*, *Verticillium dahliae*, *Diplosporium pineense*, and *Fusarium graminearum*. It displays a broad lysis spectrum and can be widely used in the control of diseases in various economic crops. Furthermore, this fungus also possesses good salt and alkali tolerance and growth-promoting effects, enriching the multifunctional strain resources of biocontrol bacteria and laying the foundation for the research and development of antagonistic bacterial agents.

[0013] Secondly, this application also provides a biocontrol agent comprising the aforementioned Trichoderma echinosporum TAZ19.

[0014] Based on the broad-spectrum antibacterial and growth-promoting properties of Trichoderma echinosporum TAZ19, its bacterial solution, secretions, or spores can all be used as active ingredients to prepare biocontrol agents for the prevention and control of various plant diseases.

[0015] In addition, in order to further optimize and improve the bactericidal or growth-promoting effects of the biocontrol agent, the biocontrol agent also includes other bactericidal active ingredients used in combination (such as other biocontrol bacteria with complementary bactericidal spectrum, bacteriostatic active substances, etc.) or existing growth-promoting active ingredients.

[0016] Preferably, the active ingredient in the biocontrol agent is one or more of the conidia, hyphae, fermentation filtrate, or active extracts of Trichoderma echinococcus TAZ19. Experiments have shown that its spores and secretions have significant inhibitory activity against pathogens.

[0017] Thirdly, this application also provides the application of the aforementioned Trichoderma acicularis TAZ19 and the aforementioned biocontrol agents in the prevention and control of plant diseases.

[0018] Optionally, the plant diseases include: pine branch and trunk rot, wheat stem base rot, tomato wilt, cucumber wilt, grape anthracnose, tobacco root rot, tobacco black stem disease, Verticillium wilt of solanaceous crops, white mold disease of crops, and sheath blight of crops.

[0019] 1. Fourthly, this application also provides the application of the above-mentioned *Trichoderma echinosporum* TAZ19 and the above-mentioned biocontrol agent in the inhibition of pathogens, wherein the pathogens include: *Fusarium oxysporum* (FON), *Fusarium oxysporum* (FOL), and *Fusarium solanum* (…). F. solani ), Colloidal anthrax bacteria ( C. gloeosporioides Fusarium oxysporum (FOT), Fusarium pseudograss ( F. pseudograminearum ), neat sclerotium ( S. rolfsii Verticillium dahliae V. dahliae ), Pine-colored two-spore ( D. sapinea ) and Fusarium oxysporum ( F. oxysporum ).

[0020] Experiments have shown that *Trichoderma echinococcus* TAZ19 has good antifungal effects against the aforementioned pathogens. This result also indicates that *Trichoderma echinococcus* TAZ19 has a broad lytic spectrum and a wide range of applications in actual field disease control.

[0021] Fifthly, this application also provides the application of the above-mentioned Trichoderma acicularis TAZ19 and the above-mentioned biocontrol agent in saline-alkali environments, or in improving the tolerance of plants to saline-alkali environments.

[0022] Experiments have shown that *Trichoderma echinococcus* TAZ19 can grow normally in culture environments with pH 5-10, with almost no difference in growth rate, indicating that this fungus has good alkali tolerance. Experiments also showed that *Trichoderma echinococcus* TAZ19 grows rapidly on PDA with 1-2% NaCl, exceeding the growth rate of most soil-borne pathogens. These results indicate that strain TAZ19 has strong salt, acid, and alkali tolerance, and good adaptability to saline-alkali environments, making it suitable for use in saline-alkali environments to improve crop tolerance.

[0023] Optionally, the application method is as follows: during seedling transplantation, the conidial liquid of Trichoderma echinosporum TAZ19 is used to irrigate the plant roots, or TAZ19 is made into a bio-fertilizer for application.

[0024] Preferably, the spore concentration of the conidial solution is 10⁵ spores / mL or higher.

[0025] The present invention has the following beneficial effects:

[0026] 1. This invention provides a self-isolated Trichoderma acicularis TAZ19 strain with broad-spectrum antibacterial activity, rapid growth, high antibacterial activity, and strong reparasitic ability. This fungus exhibits excellent antagonistic effects against various plant pathogens, including Fusarium oxysporum, Fusarium oxysporum, Fusarium solanum, Colletotrichum anthracnose, Fusarium oxysporum var. spp., Fusarium oxysporum var. spp., Fusarium oxysporum var. spp., Sclerotium sclerotiorum, Verticillium dahliae, Diplosporium pineae, and Fusarium root rot of peanut. It can be used to prepare a biocontrol agent for application on pine trees. Control of pathogens causing various plant diseases, including stem rot, pine stem rot, apple rot, apple ring rot, apple anthracnose, wheat stem base rot, tomato wilt, cucumber wilt, tobacco root rot, tobacco black shank, Verticillium wilt of solanaceous crops, white mold disease of crops, and sheath blight of crops.

[0027] 2. The *Trichoderma echinococcus* TAZ19 strain exhibits broad adaptability to acids, alkalis, and salts, which can improve the crop's tolerance to saline-alkali environments. The secretions of *Trichoderma echinococcus* TAZ19 strain also possess strong inhibitory activity against pathogens, greatly expanding the types of its products and their applications. Therefore, *Trichoderma echinococcus* TAZ19 strain has promising market application prospects in agricultural production. Attached Figure Description

[0028] Figure 1 These are morphological images of strain TAZ19; where A is a colony formed by this bacterium on PDA medium, B is an electron micrograph of the sporulating cells of the strain, and C is an electron micrograph of the conidia of this strain.

[0029] Figure 2 Analysis of the multigene phylogenetic relationships of strain TAZ19;

[0030] Figure 3 A represents the tolerance of TAZ19 strain to acids, alkalis, and salts; A represents the tolerance of TAZ19 strain to different pH values, and B represents the tolerance of TAZ19 strain to salts.

[0031] Figure 4The inhibitory effects of strain TAZ19 on different pathogens were shown; among them, A was Fusarium oxysporum tobacco, B was Fusarium oxysporum tomato, C was Fusarium solanum, D was Corydalis glomeratus, E was Fusarium tumefaciens, F was Fusarium pseudograss, G was Sclerotium sclerotiorum, H was Verticillium dahliae, I was Diplostomum pineense, and J was Fusarium oxysporum arachidii.

[0032] Figure 5 The image shows the reparasitism of the TAZ19 strain against pathogens; A is a photograph of the TAZ19 strain confronting Fusarium oxysporum and Fusarium tumefaciens; B is a photograph of the colonies of Fusarium oxysporum and Fusarium tumefaciens on a PDA that have been completely reparasitized by the TAZ19 strain.

[0033] Figure 6 The results show the inhibitory effect of TAZ19 strain secretions on pathogens; A shows the inhibition of TAZ19 strain secretions on *Sclerotium truncatum*, and B shows the inhibition of TAZ19 strain secretions on *Dioscorea opposita*.

[0034] Figure 7 To study the control of wheat stem base rot by strain TAZ19; where A: wheat inoculated with Fusarium graminearum treated with strain TAZ19, and B: wheat inoculated with Fusarium graminearum. Detailed Implementation

[0035] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0036] Example 1: Isolation and Identification of Trichoderma echinosporum strain TAZ19

[0037] 1. Experimental Methods

[0038] (1) Isolation of Trichoderma echinosporum strain TAZ19

[0039] In August 2022, grape rhizosphere soil was dug up from the internship base of Qingdao Agricultural University. 10g of soil was added to 90mL of sterile water, vortexed, and allowed to stand for 30min. The supernatant was then diluted 1000 times and spread on PDA (containing streptomycin sulfate) plates and incubated at 25℃. Single colonies were picked for subsequent experiments.

[0040] (2) Identification of Trichoderma echinosporum strain TAZ19

[0041] A. Morphological identification: Single colonies of the isolated strain were inoculated onto PDA plates and cultured at 25°C. The morphology and color of the colonies formed were observed, as well as the morphology of the conidia and sporogenous cells produced by the strain.

[0042] B. Molecular identification: Genomic DNA was extracted from the hyphae and used as a template to amplify the ITS gene of the strain using primers ITS5 and ITS4; the RBP2 gene was amplified using primers RBP2-5F and RBP2-7cR; and the TEF gene was amplified using primers EF1-728F and TEF1LLErev. Finally, the amplified fragments were sequenced and BLAST aligned, followed by MEGA(X) multigene phylogenetic analysis.

[0043] The amplification primer sequences for the above three genes are as follows:

[0044] ITS5: GGAAGTAAAAGTCGTAACAAGG (sequence as shown in SEQ ID NO.1); ITS4: TCCTCCGCTTATTGATATGC (sequence as shown in SEQ ID NO.2);

[0045] RBP2-5F: GAYGAYMGWGATCAYTTYGG (sequence as shown in SEQ ID NO.3);

[0046] RBP2-7cR: CCCATRGCTTGYTTRCCCAT (sequence shown in SEQ ID NO.4);

[0047] EF1-728F: CATCGAGAAGTTCGAGAAGG (sequence as shown in SEQ ID NO.5);

[0048] TEF1LLErev: AACTTGCAGGCAATGTGG (sequence as shown in SEQ ID NO.6).

[0049] 2. Experimental methods and analysis

[0050] (1) Upon observation, such as Figure 1 As shown, the isolated strain initially forms white, circular colonies on PDA plates. With prolonged incubation, the colonies gradually turn green, indicating the production of conidia (such as...). Figure 1 A) Further observation under electron microscopy revealed that the sporogenous cells were flask-shaped (e.g., Figure 1 B), conidia are nearly round or elliptical (e.g. Figure 1 C); The morphological observation results indicate that this strain is a Trichoderma strain.

[0051] (2) The ITS, RBP2, and TEF gene sequences of this strain are shown in SEQ ID NO. 7-9, respectively. BLAST alignment results show that these three gene sequences are similar to those of *Trichoderma hydatids* (…). Trichoderma asperellum The sequence identity of this strain was higher than 99%. Multigene phylogenetic analysis showed that this strain was related to... Trichoderma asperellum Clustered on the same branch (e.g.) Figure 2 This result also confirms that the strain is *Trichoderma echinosporum*, and the strain is named *Trichoderma echinosporum* TAZ19.

[0052] Example 2: Salt and alkali resistance test of strain TAZ19

[0053] 1. Experimental Methods

[0054] Strain TAZ19 was inoculated onto PDA plates at pH 5, pH 6, pH 7, pH 8, pH 9, and pH 10 for culture. In addition, strain TAZ19 was inoculated onto PDA plates with NaCl concentrations of 0%, 1%, 2%, 5%, 7.5%, and 10%, and cultured at 25°C to observe the growth of the colonies.

[0055] 2. Experimental Results and Analysis

[0056] like Figure 3 As shown in Figure A, strain TAZ19 grew normally on PDA medium with pH 5-10, and the growth rate was almost the same.

[0057] like Figure 3 As shown in Figure B, the growth results of colonies on PDA plates containing NaCl showed that high concentrations of NaCl inhibited the growth of TAZ19. However, the growth rate of TAZ19 on PDA with 2% NaCl still exceeded that of most soil-borne pathogens (Table 1). On PDA with 1% NaCl, the growth rate of TAZ19 was even faster (e.g., ...). Figure 3 B).

[0058] Table 1. Colony radius of different bacterial strains cultured at 25℃ for 60 h.

[0059]

[0060] The above experimental results show that the TAZ19 strain has strong salt and acid / alkali tolerance, good adaptability to saline-alkali environments, and can be applied in saline-alkali environments to improve the crop's tolerance to saline-alkali environments.

[0061] Example 3 Antibacterial activity of strain TAZ19

[0062] 1. Experimental Methods

[0063] 1. Select *Fusarium oxysporum* sp. (FON), *Fusarium oxysporum* sp. (FOL), and *Fusarium solani* sp. (FON). F. solani ), Colloidal anthrax bacteria ( C. gloeosporioides Fusarium oxysporum (FOT), Fusarium pseudograss ( F. pseudograminearum ), neat sclerotium ( S. rolfsii Verticillium dahliae V. dahliae ), Pine-colored two-spore ( D. sapinea ) and Fusarium oxysporum ( F. oxysporum These ten strains were used as pathogens to be tested.

[0064] The various pathogens were cultured against TAZ19 strain on PDA medium, with each pathogen cultured separately as a control. The inhibition rate of TAZ19 against different pathogen strains was detected by measuring the size of the colonies formed.

[0065] 2. Experimental Results and Analysis

[0066] The results are as follows Figure 4 As shown, TAZ19 has a strong inhibitory effect on the growth of pathogens such as Fusarium oxysporum, Fusarium oxysporum, Fusarium solanum, Fusarium tumefaciens, Colletotrichum anthracnose, Fusarium graminearum, Sclerotium sclerotiorum, Phytophthora tobaccoii, Verticillium dahliae, and Diplosporium pineense. The specific inhibition rates of its colony growth against different pathogens are shown in Table 2 below.

[0067] As shown in Table 2, TAZ19 exhibited the highest inhibition rate against Verticillium dahliae, reaching 98.0%; followed by Phytophthora tobaccoii and Staphylococcus aureus, with TAZ19 showing inhibition rates of 94.25% and 92.26% against these two pathogens, respectively.

[0068] Table 2. Inhibition efficiency of TAZ19 strain against the growth of different pathogens.

[0069]

[0070] Example 4: Reparasitic vitality of the strain

[0071] 1. Experimental Methods

[0072] The TAZ19 strain was cultured in confrontation with Fusarium oxysporum tomatoense and Fusarium oxysporum tobaccoense on PDA medium, and the growth of TAZ19 on the colonies of these three pathogens and the growth and decline of the pathogen colonies were observed.

[0073] 2. Experimental Results and Analysis

[0074] The results are as follows Figure 5As shown, in the early stages, the colonies of the three bacteria were relatively far apart, and all colonies grew normally. When the TAZ19 colonies approached the pathogen colonies, the colonies of each pathogen were significantly inhibited. As time went on, the mycelia of the pathogens were completely parasitized by TAZ19, and the colonies gradually disappeared. These experimental results demonstrate that TAZ19 has a strong hyperparasitic effect on the mycelia of pathogens, and can eliminate pathogens in the environment in a short time, reducing or preventing the occurrence of diseases.

[0075] Example 5: Inhibitory activity of strain secretions against pathogens

[0076] 1. Experimental Methods

[0077] The TAZ19 strain was inoculated onto PDA plates lined with cellophane and incubated at 25°C. When the colonies grew to near the edge of the cellophane, the cellophane and the TAZ19 colonies on it were removed. Pathogens (*Sclerotium sclerotiorum* and *Dioscorea opposita*) were inoculated into the center of the PDA plates where TAZ19 colonies had been incubated. A control was prepared by inoculating pathogens into the center of PDA plates where no TAZ19 colonies had been incubated. The inhibitory activity of the secretions from the TAZ19 strain against *Sclerotium sclerotiorum* and *Dioscorea opposita* was then tested.

[0078] 2. Experimental Results and Analysis

[0079] The results are as follows Figure 6 As shown, neither of the tested pathogens could grow on plates containing secretions from the TAZ19 strain. The TAZ19 strain secretions were aligned with *Sclerotium truncatum* (see...). Figure 6 A) and Chromosporium (see Figure 6 B) Both exhibited strong inhibitory activity.

[0080] Example 6: Control effect of the strain on wheat stem base rot

[0081] 1. Experimental Methods

[0082] This embodiment uses a pot experiment to test the control effect of the TAZ19 strain on wheat stem base rot.

[0083] The specific method is as follows: Irrigate the roots of the Jimai 22 variety wheat seedlings with 10... 5 Fusarium pseudobulb / mL ( F. pseudograminearum 20 mL of conidia were collected from *Fusarium graminearum*, and then 20 mL of liquid YEPD medium was poured over the inoculation as a control; *Fusarium graminearum* was inoculated as a control. F. pseudograminearum Wheat seedlings after conidia should be irrigated with 10 5 A 20 mL suspension of conidia of the TaZ61 strain at a concentration of 1 / mL was used as a treatment. *Fusarium graminearum* (… F. pseudograminearum Both the conidia of ) and TAZ19 were prepared into spore suspensions using YEPD.

[0084] After treatment, the wheat seedlings were cultured at RH 95% and 25℃, and the disease incidence was investigated after 2 weeks.

[0085] 2. Experimental Results and Analysis

[0086] Experimental results showed that TAZ19 achieved a control effect of up to 90.22% against wheat stem rot. See the potted plant results for an example. Figure 7 This result indicates that Trichoderma echinosporum TAZ19 has great application potential in the control of wheat stem base rot and can be used as an active ingredient for the control of wheat stem base rot and other diseases.

[0087] In this embodiment, only wheat stem base rot is used as an example to illustrate the control effect of TAZ19 on plant diseases. In addition to this disease, based on its excellent antibacterial activity and broad lysis spectrum against various pathogens in Examples 3 and 5, those skilled in the art can expect that TAZ19 can be applied to the control of various plant diseases caused by the aforementioned pathogens.

[0088] It is understood that those skilled in the art can make equivalent substitutions or modifications to the technical solutions and concepts of this invention, and all such substitutions or modifications should fall within the protection scope of the appended claims.

Claims

1. A strain of Trichoderma acicularis ( Trichoderma asperellum TAZ19, characterized in that, Its accession number is CCTCC M20242341.

2. A biocontrol agent, characterized in that, Includes Trichoderma acicularis TAZ19 as described in claim 1.

3. The application of *Trichoderma hygroscopicum* TAZ19 as described in claim 1 or the biocontrol agent as described in claim 2 in the control of plant diseases, characterized in that... The plant diseases mentioned are: pine branch and trunk rot, wheat stem base rot, tomato wilt, cucumber wilt, tobacco root rot, and Verticillium wilt or white mold disease in solanaceous crops.

4. The application of *Trichoderma hydathodes* TAZ19 as described in claim 1 or the biocontrol agent as described in claim 2 in inhibiting plant pathogens, wherein the pathogen is: *Fusarium oxysporum* (Tobacco Fusarium). Fosarium oxysporum f. sp. nicotianae Fusarium oxysporum (tomato) Fosarium oxysporum f. sp. lycopersici), Fusarium solani ( Fusarium solani ), Colloidal anthrax bacteria ( Colletotrichumgloeosporioides Fusarium pseudograss () Fusarium pseudograminearum ), neat sclerotium ( Sclerotium rolfsii Verticillium dahliae Verticillium dahliae ), Pine-colored two-spore ( Diplodia sapinea ) or Fusarium oxysporum ( Fosarium oxysporum f. sp. arachidis).

Images