Pseudomonas putida YC15 and application thereof for promoting early growth of tobacco

Abstract

The application discloses a Pseudomonas putida YC15 strain resistant to low temperature and capable of promoting early growth and rapid development of tobacco and an application thereof. The Pseudomonas putida YC15 strain is preserved in the China General Microbiological Culture Collection Center, has a preservation address of Beijing, China, a preservation number of CGMCC No.29990, and a preservation date of March 11, 2024, and is classified and named as Pseudomonas putida. The strain YC15 has high activities of producing iron carrier, nitrogen fixation and phosphorus solubilization under low temperature, is efficiently and stably colonized on the root surface of tobacco seedlings, and significantly improves the biomass and plant height of the tobacco. The tobacco growth-promoting strain obtained by the method has the effects of promoting early growth and rapid development of tobacco and improving the agronomic characters of tobacco, and is easy to popularize.

Description

Technical Field

[0001] This invention relates to a low-temperature resistant Pseudomonas putidae YC15 strain that promotes early and rapid growth of tobacco and its applications, belonging to the field of tobacco production technology. Background Technology

[0002] The research and application of early and rapid vegetative growth in tobacco has not only brought technological innovation to the tobacco industry but also provided new ways to improve tobacco yield and quality. Studies have shown that environmental factors such as light, temperature, and soil moisture, as well as agricultural management factors such as tobacco variety and planting techniques, are key factors influencing early and rapid vegetative growth in tobacco. In terms of application, optimizing planting techniques, such as using appropriate sowing time, planting density, and fertilization methods, can effectively promote early and rapid vegetative growth in tobacco. Furthermore, tobacco varieties with superior traits such as disease and pest resistance, drought tolerance, and cold resistance, cultivated using biotechnology, also provide strong guarantees for early and rapid vegetative growth. The application of these technologies has not only improved tobacco yield and quality but also reduced production costs, enhancing the competitiveness of the tobacco industry. However, an excessive pursuit of early and rapid vegetative growth may shorten the tobacco growth cycle, thereby affecting the quality and yield of tobacco leaves. With increasingly fierce competition in the tobacco market, how to better adapt early and rapid vegetative growth technology to market demands and improve the competitiveness of tobacco products is also an urgent problem to be solved.

[0003] Utilizing microbial methods to address plant growth and health issues has gradually become a major trend. Microorganisms, as an important component of the ecosystem, possess unique ecological functions and biological activities. They can participate in the decomposition and transformation of soil organic matter, improve soil fertility, and provide essential nutrients for tobacco growth. By introducing microbial strains with growth-promoting and disease-resistant functions, the rhizosphere microecological environment can be effectively improved, promoting root development and nutrient absorption. However, there is currently a lack of microbial solutions specifically for the premature and rapid growth of tobacco plants. Therefore, applying microbial methods to address this problem is highly necessary and important. Furthermore, microbial technology offers advantages such as environmental friendliness, safety, and sustainability, aligning with current requirements for green agricultural development and playing a significant role in promoting the sustainable development of the tobacco industry. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a strain of *Pseudomonas putida* YC15 that is resistant to low temperatures and promotes early and rapid growth of tobacco, and its application.

[0005] Technical solution: To solve the above technical problems, the present invention provides a strain of *Pseudomonas putida* YC15, which is deposited at the China General Microbiological Culture Collection Center (CGMCC), Beijing, China, with accession number CGMCC No. 29990 and deposit date of March 11, 2024. Its classification name is *Pseudomonas putida*.

[0006] The *Pseudomonas putida* YC15 was isolated at 20°C.

[0007] The 16S rDNA sequence of Pseudomonas putida YC15 is shown in SEQ ID No. 1.

[0008] The present invention also provides a microbial agent or preparation containing one or more of the following: Pseudomonas putida YC15 or its fermentation broth, and sterile supernatant.

[0009] The present invention also provides the application of the aforementioned Pseudomonas putida YC15 or the aforementioned bacterial agent or preparation in promoting tobacco growth, thereby effectively improving the agronomic traits of tobacco plants and the quality of flue-cured tobacco. The method of the present invention is highly specialized and has stable effects.

[0010] This includes the following steps: applying the aforementioned *Pseudomonas putida* YC15 or a bacterial agent or preparation to tobacco.

[0011] The dosage of *Pseudomonas putida* YC15 was 4 × 10⁻⁶. 9 ~6×10 9 One per plant.

[0012] The concentration of *Pseudomonas putida* YC15 in the bacterial agent or preparation is 4 × 10⁻⁶. 8 cfu / ml ~6×10 8 cfu / ml.

[0013] This invention also provides the method for obtaining the YC15 strain from the root surface of tobacco:

[0014] (1) Tobacco seedlings were grown at low temperature (20℃) for 20 days. Well-grown tobacco plants were selected, the above-ground parts of the plants were cut off, and the roots were held with sterile forceps and vigorously stirred in an Erlenmeyer flask containing PBS buffer to ensure that all the soil on the surface of the roots was submerged in the buffer. The roots were then rinsed with PBS buffer and placed in a test tube containing surfactant (0.5 mmol / L Tween 80), with the surfactant just submerging the roots. The tube was ultrasonically cleaned twice in an ultrasonic cleaner with ice, for 30 seconds each time. The roots were then removed to obtain a suspension of tobacco root surface microbiome.

[0015] (2) Take 1 mL of tobacco root microbiome suspension and dilute it 10... -2 10 -3 10 -4 10 -5 and 10 -6 A series of gradients, each using 200 μL of 10 -4 10 -5 10 -6 Suspensions of various concentrations were evenly spread on 0.1 TSA medium (containing actinomycin, 100 mg / L), with each concentration gradient repeated twice. The suspensions were incubated in the dark at 20°C for 5 days. Single colonies were picked from plates of appropriate concentration gradients based on bacterial morphology, color, and size, and then streaked onto agar plates for purification. The purified strains were used as the test strains and temporarily stored by inoculating them onto beef extract peptone slants.

[0016] (3) Extract DNA from the test strains and perform 16S rRNA sequencing to determine the taxonomic position of the strains.

[0017] (4) The ability of the strain to promote growth at low temperature was determined, including nitrogen fixation, phosphorus solubilization and iron production.

[0018] The present invention also provides the method for determining the root surface colonization effect of the strain at low temperature through a sterile seedling colonization test.

[0019] (1) Prepare MS medium with 1 / 2 strength: Dissolve 2.2g of Murashige Skoog medium (containing vitamins) powder, 10g of sucrose, and 8g of agar powder in 1L of sterile deionized water, adjust the pH to 5.8, and autoclave at 121℃ for 15 minutes. Dispense 50ml into 13cm square petri dishes in a laminar flow hood.

[0020] (2) Tobacco seedling culture: Tobacco seeds were surface sterilized with 75% ethanol (30s) and 3% NaClO (15min, 3 times), and then placed in MS medium with a strength of 1 / 2. After germination for 7 days, the seedlings were transferred to MS medium, with 3 seedlings per medium. They were kept at 20℃ for 16h light and 8h dark for 7 days.

[0021] (3) Preparation of YC15 fermentation broth: YC15 was fermented at 20℃ and 170r / min for 2 days, and the bacterial concentration was adjusted to OD using sterile water. 600 =0.1. Inoculate each plant with 50 μl of bacterial suspension. Harvest bacteria weekly for 14–28 days post-inoculation, for a total of 3 times. Rinse tobacco roots with sterile water to remove floating bacteria. Then, place the roots in PBS buffer for 5 min to extract bacteria from the tobacco root surface. After removing the roots, dilute the suspension and plate it. The growth of strain YC15 on the plate indicates its ability to colonize the tobacco root surface.

[0022] This invention also provides verification of the early and rapid growth effect of the YC15 strain. Inoculation of the roots of sterile tobacco seedlings with YC15 bacterial solution significantly increased the biomass and plant height of tobacco plants compared to no inoculation. The YC15 strain can colonize the root surface, producing siderophores, fixing nitrogen, and solubilizing phosphorus, thus promoting tobacco growth.

[0023] This invention provides a screening system for a fast-growing strain, wherein the strain is isolated at a culture temperature of 20°C and the tobacco is a tobacco seedling transplanted 30-50 days ago.

[0024] The present invention also provides the application of the growth-promoting strain in promoting tobacco seedling growth and improving the agronomic traits of tobacco plants.

[0025] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The present invention is the first to isolate and screen a specific strain YC15 from the tobacco root surface at low temperature (20℃), and determines its growth-promoting characteristics based on IAA and siderophore production, nitrogen fixation and phosphorus solubilization capabilities; 2. At low temperature, YC15 significantly colonizes and proliferates 12 times on the tobacco root surface, has a significant effect on early and rapid growth of tobacco plants, and also has a significant effect on improving the agronomic traits of tobacco plants; 3. The strain described in the present invention has the effect of early and rapid growth and improves the agronomic traits of tobacco plants, and is easy to promote. Attached Figure Description

[0026] Figure 1 The growth effect of YC15 on nitrogen-fixing medium;

[0027] Figure 2 The growth effect of YC15 on phosphorus-solubilizing medium;

[0028] Figure 3 The growth effect of YC15 on CAS medium;

[0029] Figure 4 The colonization effect of sterile tobacco seedlings 4 weeks after inoculation with YC15;

[0030] Figure 5To verify the effects of growth-promoting strains on tobacco plant biomass and plant height in a pot experiment: (A) plant height; (B) aboveground dry weight; (C) underground dry weight. Detailed Implementation

[0031] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0032] Example 1:

[0033] (1) Soil sampling: Four representative soil samples were collected from Yongzhou, Hunan Province (26°42'N, 111°70'E), which had a history of rice and tobacco rotation. Samples were collected 20 days after tobacco sowing and transplanting. The above-ground parts of the plants were cut off, and the roots were held with sterile forceps and vigorously stirred in an Erlenmeyer flask containing PBS buffer to ensure that all soil on the root surface was submerged in the buffer. The roots were then rinsed with PBS buffer and placed in a test tube containing surfactant (0.5 mmol / L Tween 80), just submerging the roots. The tubes were ultrasonically cleaned twice in an ultrasonic cleaner with ice for 30 seconds each time. The roots were then removed to obtain a tobacco root microbiome suspension.

[0034] (2) Spreading, culture and purification: Take 1 mL of tobacco root surface microbiome suspension and dilute it 10... -2 10 -3 10 -4 10 -5 and 10 -6 A series of gradients, each using 200 μL of 10 -4 10 -5 10 -6 The suspensions of each concentration were evenly spread on 0.1 TSA medium (containing actinomycin, 100 mg / L), with each concentration gradient repeated twice, and incubated in the dark at 20°C for 5 days. Single colonies were picked from the plates of the appropriate concentration gradient based on bacterial morphology, color, and size.

[0035] (3) Determination of taxonomic position: Bacterial DNA was extracted using a DNA extraction kit (TIANamp Bacteria DNA Kit, TIANGEN). The extracted DNA was then subjected to PCR amplification of 16S rDNA. The fragment length of the PCR amplification product was detected by 1% agarose gel electrophoresis. Subsequently, the PCR amplification product was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared with BLAST on NCBI and compared with the gene sequences of other strains in GenBank for homology. The results are shown in SEQ ID No. 1:

[0036] TTGCTCCTTGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGGACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCAAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGA.

[0037] (4) This strain belongs to the phylum Proteobacteria, class Gamma-Proteobacteria, order Pseudomonas, family Pseudomonasceae, genus Pseudomonas. It was deposited at the China General Microbiological Culture Collection Center on March 11, 2024, with accession number CGMCC No. 29990, and its classification name is: Pseudomonas putida.

[0038] Experimental Example 2: Determination of the growth-promoting ability of bacterial strains

[0039] Growth-promoting ability assay was performed using the purified strain from Example 1: After culturing the strain in TSB medium at 20°C for 48 hours, the bacteria were collected by centrifugation and resuspended in appropriate sterile water until the final density was 10. 8The bacterial suspension was prepared at a concentration of cells / mL. 2 μL of the bacterial suspension was inoculated onto nitrogen-free medium, inorganic phosphorus medium, and CAS test medium to detect the nitrogen fixation, phosphorus solubilization, and siderophore production abilities of the strains, and cultured at 20°C for 7 days. The appearance of a distinct hydrolysis zone on nitrogen-free and inorganic phosphorus media, and an orange hydrolysis zone on CAS medium, were considered positive reactions indicating the corresponding growth-promoting ability of the strains. The strength of the bacterial growth-promoting ability was initially determined by the ratio of the diameter of the hydrolysis zone (D) to the colony diameter (d) (D / d), with four parallel experiments per group. The nitrogen fixation, phosphorus solubilization, and siderophore production abilities of YC15 were 2.00, 1.38, and 2.92, respectively. (See attached table for details.) Figure 1-3 .

[0040] Example 3: Colonization ability of YC15 on tobacco root surface

[0041] Tobacco seeds were surface sterilized with 75% ethanol (30s) and 3% NaClO (15min, 3 times), respectively, and then placed in 1 / 2 strength Murashige and Skoog (MS) complete medium (Solarbio) containing 2% (wt / vol) sucrose and 0.8% (wt / vol) agar.

[0042] Seven days after germination, seedlings were transferred to 1 / 2 MS medium, with three seedlings per medium. They were then kept at 20°C for 16 hours of light followed by 8 hours of darkness for 7 days. The growth-promoting bacterium YC15 was selected, and after fermentation, the bacterial concentration was adjusted to OD using sterile water. 600 =0.1. Inoculate each strain with 50 μL of bacterial suspension. After 14 days of inoculation, begin collecting bacteria once a week for a total of 3 times.

[0043] The tobacco roots were rinsed with sterile water to remove floating bacteria. The roots were then placed in PBS buffer for 5 minutes to extract bacteria from the root surface. After removing the roots, the suspension was diluted and plated to determine the bacteria colonizing the root surface.

[0044] Through Table 1 and Figure 4 It can be seen that YC15 significantly proliferated on the root surface two weeks after inoculation. The colonization rate stabilized three weeks after inoculation, with the number of bacteria on the root surface increasing 12-fold. The results indicate that YC15 can colonize the tobacco root surface and promote the growth of tobacco seedlings.

[0045] Table 1 shows the colonization rate of YC15 on tobacco root surfaces.

[0046] deal with 2 weeks 3 weeks 4 weeks YC15 408％ 1216％ 1263％

[0047] Example 4: Pot experiment to verify the growth-promoting effect of the strain on tobacco plants

[0048] After the strain was cultured in TSB medium at 20°C for 48 hours, the bacteria were collected by centrifugation and resuspended in appropriate sterile water to a final density of 102.8 100 cells / mL was used as the bacterial suspension. Uniformly growing tobacco seedlings were selected and planted in pots at low temperature (20°C) in a mixture of sterile soil and vermiculite (1:1, v / v).

[0049] On days 10 and 30, 10 mL of bacterial suspension was inoculated, while the control group was inoculated with an equal volume of sterile water. After 45 days of cultivation under low-temperature conditions, the increase in tobacco plant biomass and plant height was measured. The results are shown below. Figure 5 .

[0050] The results showed that YC15 significantly increased tobacco biomass and plant height, promoting tobacco growth.

Claims

1. A strain of *Pseudomonas putida* ( Pseudomonas putida YC15, characterized in that, It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.29990, deposited on March 11, 2024, and its classification name is: *Pseudomonas putida* (…). Pseudomonas putida ).

2. The *Pseudomonas putida* according to claim 1 (… Pseudomonas putida YC15, characterized in that, It was obtained by separation at 20℃.

3. The *Pseudomonas putida* according to claim 1 (… Pseudomonas putida YC15, characterized in that, Its 16S rDNA base sequence is shown in SEQ ID NO.

1.

4. A microbial agent or preparation, characterized in that, The bacterial agent or preparation contains *Pseudomonas putida* as described in any one of claims 1 to 3. Pseudomonas putida YC15.

5. The *Pseudomonas putida* as described in any one of claims 1 to 3 (… Pseudomonas putida The application of the microbial agent or preparation described in claim 4 or YC15 in promoting tobacco growth.

6. The application according to claim 5, characterized in that, Includes the following steps: Applying the *Pseudomonas putida* as described in any one of claims 1 to 3 to tobacco Pseudomonas putida YC15 or the bacterial agent or preparation described in claim 4.

7. The application according to claim 5 or 6, characterized in that, The putrid pseudomonads ( Pseudomonas putida The dosage of YC15 is 4 × 10⁻⁶. 9 ~6×10 9 One per plant.

8. The application according to claim 5 or 6, characterized in that, The bacterial agent or preparation contains *Pseudomonas putida* (…). Pseudomonas putida The concentration of YC15 is 4 × 10⁻⁶. 8 cfu / ml ~6×10 8 cfu / ml.

9. The application according to claim 8, characterized in that, The putrid pseudomonads ( Pseudomonas putida The application temperature of YC15 or the aforementioned microbial agent or preparation is 15-20 °C.

Images