A method for producing adipic acid by biological fermentation-whole cell catalytic cascade

Abstract

The present invention discloses a method for producing adipic acid by biological fermentation-whole cell catalytic cascade, and belongs to the field of biotechnology. The present invention discloses a method for producing adipic acid by biological fermentation-whole cell catalytic cascade, starting from the high-yield glutamic acid Corynebacterium glutamicum constructed in the early stage, combining biological fermentation with whole cell catalytic technology, that is, using the above-mentioned genetically engineered bacteria to produce high-yield adipic acid, and under the action of a whole cell catalyst, adipic acid is produced by biological fermentation-whole cell catalytic cascade; thus, a new green synthesis method of adipic acid by biological fermentation and whole cell catalytic coupling cascade is developed. The method of the present invention has high conversion rate, good economy, and is easy to realize the industrial production of biological synthesis of adipic acid.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and more particularly to a method for producing adipic acid by biological fermentation-whole cell catalysis cascade. Background Art

[0002] Adipic acid is commonly known as adipic acid, and its molecular formula is C 6 H 10 O 4 , with a relative molecular mass of 146.14. It is an important aliphatic dicarboxylic acid, which can be used as a raw material for nylon 66 and engineering plastics, and is also used to produce various ester products. It is also used as a raw material for polyurethane elastomers and an acidifier for various foods and beverages. Adipic acid is also a raw material for medicine, pesticides, adhesives, synthetic dyes and fragrances. In summary, adipic acid has important application value in the fields of medicine, food and chemical synthesis.

[0003] At present, the main method for industrial production of adipic acid is the nitric acid oxidation method using a mixture of cyclohexanol and cyclohexanone (also known as KA oil) as raw materials. However, the synthesis of adipic acid by this method has the disadvantages of severe pollution and high requirements for operating conditions. With the vigorous development of synthetic biology, the biosynthesis of adipic acid has attracted great attention. However, the current biosynthesis of adipic acid still has the disadvantages of low conversion rate and poor economic efficiency, making it difficult to achieve industrialization. Based on this, it is currently necessary to research and develop a biosynthesis technology of adipic acid with high conversion rate, good economic efficiency and easy industrial production.

[0004] Therefore, providing a method for producing adipic acid by biological fermentation-whole cell catalytic cascade is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a method for producing adipic acid by biological fermentation-whole cell catalysis cascade, which utilizes adipic acid-producing genetically engineered bacteria to produce adipic acid in high yield by biological fermentation, and produces adipic acid by biological fermentation-whole cell catalysis cascade under the action of a whole cell catalyst. The method has high conversion rate and good economy, and is easy to realize the industrial production of biosynthesized adipic acid.

[0006] A method for producing adipic acid based on biological fermentation-whole cell catalytic cascade of mucofuric acid-producing genetically engineered bacteria, using mucofuric acid produced by fermentation of mucofuric acid-producing genetically engineered bacteria as a raw material, and synthesizing adipic acid by hydrogenation reduction using a whole cell catalyst containing olefin reductase.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] A method for preparing a whole-cell catalyst, the specific steps are as follows:

[0009] (1) constructing recombinant plasmids pRSF-M8(G27M / I374S), pRSF-rhaB-M8(G27M / I374S) and pRSF-araB-M8(G27M / I374S) carrying the olefin reductase gene M8(G27M / I374S); the nucleotide sequence of the olefin reductase gene M8(G27M / I374S) is shown in SEQ ID NO.1;

[0010] (2) The recombinant plasmids constructed in step (1) were respectively transformed into Escherichia coli BL21 (DE3) by chemical transformation to prepare strains BL-M8 (G27M / I374S), BL-rhaB-M8 (G27M / I374S) and BL-araB-M8 (G27M / I374S) expressing olefin reductase;

[0011] or the recombinant plasmid pRSF-rhaB-M8(G27M / I374S) constructed in step (1) and the molecular chaperone plasmid are transformed into Escherichia coli BL21(DE3) to prepare strains BL-M8-Gro7, BL-M8-KJE7 and BL-M8-Tf16 expressing olefin reductase; the molecular chaperone plasmids are pGro7, pKJE7 and pTf16;

[0012] (3) activating the strains obtained in step (2), fermenting and induced expression of ene reductase; the induction expression temperature is 16-37°C; the induction expression time is 12-18h;

[0013] Inducer: strain BL-M8 (G27M / I374S) was induced with IPTG at a final concentration of 0.5-1 mM; strain BL-rhaB-M8 (G27M / I374S) was induced with rhamnose at a final concentration of 1-10 mM; strain BL-araB-M8 (G27M / I374S) was induced with arabinose at a final concentration of 1-10 mM;

[0014] The strains carrying the chaperone expression plasmid were induced by the additional addition of arabinose at a final concentration of 0.5 mg / ml;

[0015] (4) The bacterial liquid after fermentation culture is centrifuged and then the bacterial cells are washed 2 to 3 times with a buffer solution to remove the culture medium components and obtain a whole-cell catalyst containing olefin reductase.

[0016] The recombinant plasmid carrying the alkene reductase gene can be any expression plasmid of bacteria or fungi;

[0017] The host bacteria for transformation of the recombinant plasmid can be bacteria or fungi, including Escherichia coli, Corynebacterium glutamicum, yeast, and modified bacteria and fungi; preferably, the host bacteria is Escherichia coli BL21 (DE3).

[0018] Furthermore, a method for producing adipic acid by biological fermentation-whole cell catalytic cascade is provided, wherein the specific steps are as follows:

[0019] (1) Fermenting and culturing the genetically engineered bacteria MA2 (see patent: 202311253745.4) that produces muconic acid to obtain a muconic acid fermentation broth;

[0020] (2) centrifuging the fermentation broth to obtain a fermentation supernatant of the mucofuric acid;

[0021] (3) adding the prepared whole-cell catalyst to the fermentation supernatant of mucofuric acid to carry out a catalytic conversion reaction to obtain adipic acid;

[0022] Based on the volume of the whole cell catalytic system, the content of mucofuric acid is 40-100 g / L, and the dosage of the whole cell catalyst is 1-30 gCDW / L;

[0023] The whole-cell catalytic temperature is 20~37℃, the rotation speed is 100-200 rpm, and the catalytic conversion reaction time is 24~72h.

[0024] Furthermore, the whole cell catalyst or the method is used in the catalytic production of adipic acid.

[0025] The invention screens efficient promoters to enhance the transcription of ene reductase gene M8 (G27M / I374S) through promoter engineering, thereby enhancing its expression, and introduces molecular chaperones to promote the solubility of ene reductase, thereby strengthening the conversion of ene reductase catalyzed by mucofuric acid to adipic acid.

[0026] It can be seen from the above technical solution that, compared with the prior art, the present invention discloses a method for producing adipic acid by biological fermentation-whole cell catalytic cascade, which has the following beneficial effects:

[0027] (1) To achieve the goal of efficient biosynthesis of adipic acid, the present invention proposes for the first time a production process for preparing adipic acid by biofermentation and whole-cell catalytic cascade.

[0028] (2) The present invention uses a kind of glutamic acid-producing Corynebacterium glutamicum constructed and obtained in the early stage of this laboratory to achieve high production of glutamic acid (see patent: 202311253745.4).

[0029] (3) At the same time, in order to realize the production process of preparing adipic acid by biological fermentation and whole-cell catalytic cascade, the present invention artificially prepared a whole-cell catalyst containing olefin reductase to realize the conversion of mucofuric acid to adipic acid. The production method of preparing adipic acid by biological fermentation and whole-cell catalytic cascade provided by the present invention utilizes the above-mentioned genetically engineered bacteria to produce adipic acid in high yield, and under the action of the above-mentioned whole-cell catalyst, produces adipic acid by biological fermentation-whole-cell catalytic cascade; the method has high conversion rate and good economy, and is easy to realize the industrial production of biological synthesis of adipic acid.

[0030] (4) Whole-cell catalysis can be carried out at room temperature and pressure, reducing energy consumption and pollution, and providing a new option for green catalytic technology. The present invention combines biofermentation with whole-cell catalysis technology to develop a new green synthesis method of adipic acid by coupling cascade of biofermentation and whole-cell catalysis, which is of great significance for the sustainable development of synthesizing high molecular polymers such as nylon 66. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0032] Figure 1 The accompanying drawing is a schematic diagram of the mechanism of the present invention for biosynthesis of adipic acid by biological fermentation-whole cell catalytic cascade.

[0033] Figure 2 The accompanying drawing is a process diagram of producing mucofuric acid by biological fermentation of the present invention (the dissolved oxygen is controlled at 20%).

[0034] Figure 3 The accompanying drawing is a process diagram of the production of mucofuric acid by biological fermentation of the present invention (the dissolved oxygen is controlled at 30%).

[0035] Figure 4 The accompanying drawing is a comparison of adipic acid production by whole-cell catalysts obtained under the regulation of different promoters of the present invention.

[0036] Figure 5 The accompanying drawing shows the production of adipic acid by the whole-cell catalyst coupled with molecular chaperone expression of the present invention.

[0037] Figure 6 The accompanying drawing is a graph showing the yield of adipic acid at different whole cell catalyst dosages of the present invention.

[0038] Figure 7 The accompanying drawing is a process diagram of the whole-cell catalytic production of adipic acid by a high-concentration mucofuric acid reaction solution of the present invention. DETAILED DESCRIPTION

[0039] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0040] LBHIS medium: peptone 5 g / L, yeast powder 2.5 g / L, NaCl 5 g / L, brain heart extract (BHI) 18.5 g / L, sorbitol 91 g / L.

[0041] LBG medium: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L, glucose 20.0 g / L.

[0042] Fermentation medium: glucose 60 g / L, urea 5.0 g / L, corn extract 8.0 g / L, biotin 4×10 -4 g / L,VB 1 Biotin 4×10 -4 g / L,K 2 HPO 4 1.0 g / L, KH 2 PO 4 1.0 g / L, CaCl 2 •2H 2 O 29.4 mg / L, MgSO 4 •7H 2 O 1.2325 g / L, trace element solution 0.2%. (Preparation method of trace element solution: weigh 1g FeSO 4 7H 2 O, 1gMnSO 4 ·H 2 O, 0.1 g ZnSO 4 7H 2 O, 0.2 g CuSO 4 , 0.002g NiCl 2 6H 2 O, add water to make the volume 100 mL, then add 100 µl concentrated hydrochloric acid to adjust the pH, then filter the bacteria through a membrane, and add 0.2% to the fermentation medium system).

[0043] The characteristics of the relevant plasmids and strains used in the present invention are described in Table 1.

[0044] Table 1 Plasmids and strains

[0045]

[0046] Example 1 High yield of mucofuric acid by biological fermentation

[0047] See the schematic diagram of the mechanism of biosynthesis of adipic acid by biofermentation-whole cell catalytic cascade. Figure 1 .

[0048] The glutamicum MA2 produced by the laboratory was used as the fermentation strain. First, the preserved glycerol bacteria were streaked and activated, and then a single colony was picked and inoculated into 4 mL of LBHIS medium, and cultured at 30°C and 200 rpm for 12-16 hours; then, 5% of the inoculum was added to 20 mL of LBG medium, and cultured at 30°C and 200 rpm for 12-16 hours to obtain the fermentation seed liquid. Next, the 5 L bioreactor was expanded to produce high yields of mucofuric acid. The culture medium was the fermentation medium, the temperature was controlled at 30°C, the pH was controlled at 7.0, the aeration rate was 2 L / min, and the speed was maintained at 300 rpm-500 rpm. The dissolved oxygen was controlled to 20% and 30% respectively by the series stirring control strategy for comparison. The working volume was set to 2L, and 25% (v / v) NH 3 ·H 2 O was maintained at pH 7.0. Glucose concentration was maintained at 1-20 g / L by feeding glucose solution (800 g / L). In case of foaming, appropriate defoamer (DF-103) was added to control the foam. Samples were taken at appropriate time intervals for metabolite analysis. Dissolved oxygen was controlled at 20%. The results are shown in Tables 2 and Figure 2 ; dissolved oxygen was controlled at 30%, the results are shown in Table 3 and Figure 3 .

[0049] Table 2 Data of bio-fermentation production of mucofuric acid (dissolved oxygen controlled at 20%)

[0050]

[0051] Table 2 and Figure 2 The results showed that when the dissolved oxygen was controlled at 20%, the yield of mucocilic acid was 37.7 g / L.

[0052] Table 3 Data of bio-fermentation production of mucofuric acid (dissolved oxygen controlled at 30%)

[0053]

[0054] The results in Table 3 show that when the dissolved oxygen was controlled at 30%, the yield of mucofuric acid reached 58.2 g / L, an increase of 54.4% compared to when the dissolved oxygen was controlled at 20%.

[0055] Example 2 Recombinant plasmid construction

[0056] The synthetic enoate reductase gene M8 (G27M / I374S) (gene sequence as shown in SEQ ID NO.1) was used as a template and primers M8 (G27M / I374S)-F / R were used to amplify the target gene M8 (G27M / I374S); then the pRSFDuet-1 plasmid was digested with NcoI and PacI restriction endonucleases, and the digested fragments were recovered by gel excision; then the M8 (G27M / I374S) target gene was inserted into the Escherichia coli expression vector pRSFDuet-1 by seamless cloning to obtain the plasmid pRSF-M8 (G27M / I374S).

[0057] ATGAAATACAAAAAGCTATTTGAAAACTGTG GAAGTCGCGGCAAATCTGTAA ; SEQ ID NO.1.

[0058] Plasmid pRSF-M8 (G27M / I374S) was used as a template and primers pRSF-F / pRSF-R were used to linearize the plasmid to remove the T7 promoter and LacI gene to obtain the linearized plasmid pRSF-M8 (G27M / I374S) ΔT7ΔLacI.

[0059] Using plasmid pEcCas as a template, primers pRSF-rhaR-F / pRSF-rhaB-R were used to amplify the rhaB promoter element (the gene sequence is shown in SEQ ID NO.2); using plasmid pEcCas as a template, primers pRSF-araC-F / pRSF-araB-R were used to amplify the araB promoter element (the gene sequence is shown in SEQ ID NO.3). Then, the rhaB promoter element and the araB promoter element were connected to the linearized plasmid pRSF-M8(G27M / I374S)ΔT7ΔLacI by seamless cloning to obtain plasmids pRSF-rhaB-M8(G27M / I374S) and pRSF-araB-M8(G27M / I374S).

[0060] rhaB promoter element sequence:

[0061] TTAATCTTTCTGCGAATTGAGATGACG GGCGCTTTTTAGACTGGTCGTA ; SEQ ID NO.2.

[0062] araB promoter element sequence:

[0063] TTATGACAACTTGACGGCTACATCA GCAACTCTCTACTGTTTCTCCAT ; SEQ ID NO.3.

[0064] The primer sequences used are shown in Table 4.

[0065] Table 4 Primers for constructing recombinant plasmids

[0066]

[0067] The gene amplification system was as follows: 2× Primestar Max (purchased from Takara) 50 μL, upstream primer 4 μL, downstream primer 4 μL, template DNA 1 μL, ddH 2 O 41 μL.

[0068] The gene amplification program was as follows: 98°C for 3 min; 98°C for 10 s, 55°C for 5 s, 72°C for 5 s / kb, 34 cycles; 72°C for 5 min; 12°C ∞.

[0069] The enzyme digestion system is as follows: plasmid 16μL, 10× buffer (purchased from NEB) 2μL, NcoI (purchased from NEB) 1μL, PacI (purchased from NEB) 1μL. Enzyme digestion conditions: 37℃, 2-3 h.

[0070] The seamless cloning system is as follows: 1 x mol of gene fragment, 2 y mol of gene fragment, z mol of linearized vector, 5 μL of 2×Gibson Assemble Mix (purchased from Beijing Bomed Gene Technology Co., Ltd.). Note: x:z = 3:1; y:z = 3:1; the total volume of gene and plasmid is 5 μL. For the specific calculation method, please refer to the product manual of Beijing Bomed Gene Technology Co., Ltd. Connection conditions: 50℃, 15 min.

[0071] Example 3 Preparation of recombinant strains

[0072] Commercial Escherichia coli BL21 (DE3) competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) were used for chemical transformation, and the constructed pRSF-M8 (G27M / I374S), pRSF-rhaB-M8 (G27M / I374S) and pRSF-araB-M8 (G27M / I374S) recombinant plasmids were transferred into Escherichia coli BL21 (DE3) by chemical transformation to prepare strains BL-M8 (G27M / I374S), BL-rhaB-M8 (G27M / I374S) and BL-araB-M8 (G27M / I374S) expressing olefin reductase. The pRSF-rhaB-M8 (G27M / I374S) plasmid and the pGro7 plasmid were simultaneously transformed into Escherichia coli BL21 (BE3) to obtain the strain BL-M8-Gro7; the pRSF-rhaB-M8 (G27M / I374S) plasmid and the pKJE7 plasmid were simultaneously transformed into Escherichia coli BL21 (BE3) to obtain the strain BL-M8-KJE7; the pRSF-rhaB-M8 (G27M / I374S) plasmid and the pTf16 plasmid were simultaneously transformed into Escherichia coli BL21 (BE3) to obtain the strain BL-M8-Tf16; the addition amount of the above plasmids during chemical transformation was 100 ng, and the chemical transformation method was referred to the product manual of Beijing Quanshijin Biotechnology Co., Ltd.

[0073] Example 4 Preparation of a whole-cell catalyst containing olefin reductase

[0074] Fermentation medium TB: peptone 11.8 g / L, yeast powder 13.6 g / L, K 2 HPO 4 9.4g / L, KH 2 PO 4 2.2 g / L, glycerol 10 g / L.

[0075] The strain was streaked and activated, and then a single colony was picked and inoculated into 4 mL LB liquid medium and cultured at 37°C for 12-16 h. Then, the cultured bacterial solution was transferred into the fermentation medium TB at a 1% inoculation rate and cultured aerobically at 37°C until OD 600 =0.8-1, then add IPTG at a final concentration of 0.5-1mM or 1-10 mM rhamnose or 1-10 mM arabinose to induce the expression of ene reductase, adjust the temperature to 30°C, and transfer to an anaerobic bottle for 12-16h. The strain carrying the molecular chaperone expression plasmid needs to add arabinose at a final concentration of 0.5 mg / ml. Subsequently, centrifuge at 5000 rpm and 4°C for 10 min, and wash 2-3 times with PBS buffer (pH=8.0) to obtain a whole-cell catalyst containing ene reductase.

[0076] Example 5 Method for producing adipic acid by biological fermentation-whole cell catalytic cascade

[0077] A method for producing adipic acid by biological fermentation-whole-cell catalytic cascade: According to the method of Example 1, mucofuric acid is synthesized by microbial fermentation, the synthesized fermentation broth is centrifuged to separate the cells, and after obtaining the fermentation supernatant, 1-30 gCDW / L of a whole-cell catalyst containing olefin reductase is added to the supernatant. The catalytic conversion is carried out at a temperature of 30°C, under anaerobic conditions, at a stirring speed of 150 rpm, and for 24-72 hours.

[0078] Example 6 Comparison of adipic acid production by whole-cell catalysts obtained under the regulation of different promoters

[0079] The whole cell catalyst was prepared by using strains BL-M8 (G27M / I374S), BL-rhaB-M8 (G27M / I374S) and BL-araB-M8 (G27M / I374S) according to the method of Example 4. The specific amount of inducer is: for strain BL-M8 (G27M / I374S), IPTG with a final concentration of 0.5mM is used for induction; for strain BL-rhaB-M8 (G27M / I374S), rhamnose with a final concentration of 10 mM is used for induction; for strain BL-araB-M8 (G27M / I374S), arabinose with a final concentration of 10 mM is used for induction. Subsequently, whole cell catalysis was performed according to the method of Example 5, wherein the whole cell catalyst dosage was set to 1 gCDW / L and the initial concentration of mucofuric acid was 5 g / L. The results showed that the whole-cell catalysts obtained under the control of different promoters had significant differences in catalyzing the conversion of mucofuric acid to adipic acid ( Figure 4 ), after catalytic conversion for 72 h, the concentrations of adipic acid were 0.28 g / L (IPTG induction), 0.09 g / L (arabinose induction) and 0.68 g / L (rhamnose induction).

[0080] Example 7 Production of adipic acid by whole-cell catalyst coupled to molecular chaperone expression

[0081] The whole cell catalysts were prepared using strains BL-M8-Gro7, BL-M8-KJE7 and BL-M8-Tf16 according to the method of Example 4. Specifically, rhamnose with a final concentration of 10 mM was used to induce the expression of ene reductase, and arabinose with a final concentration of 0.5 mg / ml was used to induce the expression of molecular chaperone protein. Subsequently, whole cell catalysis was performed according to the method of Example 5, wherein the whole cell catalyst dosage was set to 1 g CDW / L and the initial concentration of mucofuric acid was 5 g / L. The results showed that the introduction of molecular chaperones promoted the soluble expression of olefin reductase, thereby effectively improving the conversion of mucofuric acid to adipic acid. After 72 h of catalytic conversion, the adipic acid yields were 1.95 g / L (coupled expression of groES-groEL molecular chaperone protein), 1.77 g / L (coupled expression of gnaK-dnaJ-grpE molecular chaperone protein) and 1.67 g / L (coupled expression of tig molecular chaperone protein), which were 1.87 times, 1.60 times and 1.46 times higher than those of the control (BL-rhaB-M8(G27M / I374S), adipic acid yield of 0.68 g / L) respectively. Figure 5 ).

[0082] Example 8 Production of adipic acid by whole-cell catalysis of high-concentration mucofuric acid reaction solution

[0083] According to the method of Example 5, the initial concentration of mucofuric acid was 37.7 g / L, and different whole-cell catalyst dosages (cell dry weight of 1g CDW / L, 2g CDW / L, 3g CDW / L, 4g CDW / L, 5g CDW / L, and 6g DW / L, respectively) were set. The whole-cell catalytic production of adipic acid was carried out at a temperature of 30°C, anaerobic conditions, and a stirring speed of 150 rpm. The results showed that the increase in the amount of whole-cell catalyst can promote the synthesis of adipic acid ( Figure 6 When the whole cell catalyst dosage was 6 g CDW / L, samples were taken at 24h, 48h and 72h to detect the concentrations of adipic acid and mucofuric acid. The adipic acid production reached 12.4 g / L at 72h ( Figure 7 ).

[0084] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for preparing a whole-cell catalyst, characterized in that: The specific steps are as follows: (1) The olefin reductase gene M8 (G27M / I374S) and the rhaB promoter were inserted into the Escherichia coli expression vector pRSFDuet-1 to construct a recombinant plasmid pRSF-rhaB-M8 (G27M / I374S) carrying the olefin reductase gene M8 (G27M / I374S); the nucleotide sequence of the olefin reductase gene M8 (G27M / I374S) is shown in SEQ ID NO.1; the nucleotide sequence of the rhaB promoter is shown in SEQ ID NO.2; (2) The recombinant plasmid pRSF-rhaB-M8 (G27M / I374S) and the molecular chaperone plasmid pGro7 constructed in step (1) were transformed into Escherichia coli BL21 (DE3) to prepare the strain BL-M8-Gro7 expressing olefin reductase; (3) activating the strain obtained in step (2), fermenting and induced expression of ene reductase; the induction expression temperature is 16-37°C; the induction expression time is 12-18 hours; Inducers: Use rhamnose at a final concentration of 1-10 mM and arabinose at a final concentration of 0.5 mg / ml; (4) The bacterial liquid after fermentation culture is centrifuged and then the bacterial cells are washed 2 to 3 times with a buffer solution to remove the culture medium components and obtain a whole-cell catalyst containing olefin reductase.

2. A method for producing adipic acid by biological fermentation-whole cell catalytic cascade, characterized in that: The specific steps are as follows: (1) Fermenting and culturing the genetically engineered bacteria MA2 that produces muconic acid to obtain a muconic acid fermentation broth; the genetically engineered bacteria MA2 is from a Chinese patent application with application number CN202311253745.4; (2) centrifuging the fermentation broth to obtain a fermentation supernatant of the mucofuric acid; (3) adding the whole cell catalyst prepared in claim 1 to the fermentation supernatant of mucofuric acid to carry out a catalytic conversion reaction to obtain adipic acid; Based on the volume of the whole cell catalytic system, the content of mucofuric acid is 40-100 g / L, and the dosage of the whole cell catalyst is 1-30 g CDW / L; The whole-cell catalytic temperature is 20~37℃, the rotation speed is 100-200 rpm, and the catalytic conversion reaction time is 24~72h.

3. Use of the whole cell catalyst according to claim 1 or the method according to claim 2 in catalytic production of adipic acid.

Images