A CD99 gene molecular marker primer associated with duck egg yolk weight and its application

Abstract

This invention relates to primers for a CD99 gene molecular marker associated with duck egg yolk weight and its application, belonging to the field of biotechnology. The molecular marker of this invention is located at base 135221179 on chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version, exhibiting A / T polymorphism with three genotypes: A / A, A / T, and T / T, located within an intron region of the CD99 gene. Individuals with the CD99 gene A / A genotype have higher egg yolk weight than those with the A / T and T / T genotypes, while individuals with the A / T genotype have higher egg yolk weight than those with the T / T genotype. This invention uses the aforementioned molecular marker to screen for high-quality duck egg yolk weight indicators, improving the rate of high-quality duck eggs. It can be applied to the early selection of high-quality ducks, helping to accelerate breeding progress, improve breeding accuracy, and reduce breeding and production costs, thus having significant economic and breeding value for high-quality ducks.

Description

Technical Field

[0001] This invention relates to a CD99 gene molecular marker primer related to duck egg yolk weight and its application, belonging to the field of biotechnology. Background Technology

[0002] With economic development, the demand for high-quality duck eggs continues to increase, prompting the booming development of the duck egg industry. The egg-laying performance of ducks is a key indicator of their economic value, encompassing traits such as age at first laying, egg production, and egg quality. Yolk weight is an important parameter for assessing egg quality. Egg yolks are rich in high-quality protein and essential amino acids, playing a vital role in maintaining cell function and enhancing the immune system. Simultaneously, the fats in egg yolks include oleic acid, which helps regulate cholesterol levels, and linoleic acid, crucial for the development of the nervous system and vision. Egg yolks are also a good source of various vitamins, such as vitamin A, which plays a positive role in preventing night blindness and dry eye, and vitamin D, which promotes calcium absorption and bone health. Furthermore, egg yolks contain minerals such as iron, zinc, selenium, and phosphorus, trace elements indispensable for regulating various physiological functions. Therefore, a larger yolk weight generally indicates that the duck egg contains more nutrients, which is beneficial to consumers' health. In duck egg products, such as salted duck eggs and preserved eggs, yolk weight directly affects the quality and taste of the final product. Egg processing companies may select duck eggs suitable for specific uses based on yolk weight. At the same time, yolk weight is also related to the hatching ability of duck eggs. During the incubation process, the yolk provides nutrition for embryonic development, and duck eggs with larger yolk weights often have a higher hatching success rate.

[0003] In conclusion, yolk weight is a crucial component of duck egg production performance and is influenced by a variety of factors. Farmers need to implement meticulous management by selecting superior breeds, optimizing feed formulations, and improving the rearing environment to ensure high-quality egg production. Furthermore, methods for precisely controlling yolk weight under different environmental conditions should be further explored to promote the sustainable development of the duck egg industry.

[0004] CD99 is a transmembrane protein that plays a crucial role in cell-cell interactions, cell migration, and signal transduction. It is expressed in various cell types, including immune cells, nerve cells, and germ cells. Its normal function is essential for cell recognition, adhesion, and intercellular communication. The CD99 gene is involved in signal transduction between hypothalamic and pituitary cells. Studies have shown that abnormal expression of the CD99 gene may affect the function of GnRH neurons, thereby interfering with the normal secretion of gonadotropins. For example, in some experimental models, when CD99 gene expression is suppressed, GnRH neuron activity becomes abnormal, leading to a decrease in FSH and LH secretion from the pituitary gland. Gonadotropins stimulate ovarian follicle growth, causing the duck's body to transport more nutrients to the developing follicles. Nutrients such as proteins, fats, vitamins, and minerals gradually accumulate within the follicles, ultimately forming the main components of the egg yolk. As the follicle matures, the weight of the yolk continuously increases. When ducks have high levels of gonadotropins, their ovarian function is active, follicles develop fully, and more nutrients accumulate during yolk formation, resulting in larger yolk weights. Conversely, if gonadotropin levels are insufficient, follicle development is restricted, nutrient accumulation is less, and yolk weights may be smaller. Although further research is needed to confirm this, the CD99 gene may indirectly affect yolk weight through multiple pathways. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by proposing a primer for a CD99 gene molecular marker related to duck egg yolk weight and its application, further confirming the influence of the CD99 gene on duck egg yolk weight, enabling rapid and accurate identification of duck egg yolk weight and providing a new approach for screening related to duck egg yolk weight.

[0006] This invention first provides primers for a CD99 gene molecular marker associated with duck egg yolk weight. The invention measured egg yolk weight in 30-week-old female ducks, performed SNP genotyping using whole-genome resequencing, and screened for a CD99 gene molecular marker significantly associated with duck egg yolk weight through genome-wide association analysis. This provides a new gene and molecular marker resource for breeding ducks with egg yolk weight. This molecular marker is located at base 135221179 on chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version. The CD99 gene sequence with a base mutation is shown at base 174 in SEQ ID NO:3 or SEQ ID NO:4. The deoxyribonucleotide sequences of the duck DNA-specific primer pairs required for CD99 gene molecular marker detection are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0007] This invention further provides the application of primers for the CD99 gene molecular marker associated with duck egg yolk weight, used to detect SNP molecular marker genotypes associated with duck egg yolk weight in Jinding ducks. Specifically, the method for detecting duck egg yolk weight-related SNP genotypes using PCR amplification combined with Sanger sequencing includes the following steps:

[0008] The first step is to perform PCR amplification on the duck DNA sample to be tested using duck DNA-specific primers to obtain the amplification product;

[0009] The second step is to perform Sanger sequencing on the amplified products.

[0010] The third step is to determine the molecular marker genotype of the target site based on the sequencing results from the second step.

[0011] In the first step of the above method, the nucleotide sequence of the duck DNA-specific primer pair consists of the upstream primer 5'-TCGCCAACTGAAGGAGTC-3' (SEQ ID NO: 1) and the downstream primer 5'-TGTTTGTGCCCTGAGGAT-3' (SEQ ID NO: 2).

[0012] In the second step, the final concentration of the reaction system, expressed as 25 μl, is:

[0013] 50 ng of duck DNA to be tested

[0014] 2 x Accurate Taq Master Mix 12.5μl

[0015] 1 μl of upstream primer

[0016] 1 μl of downstream primer

[0017] Add sterile water to a final volume of 25 μl.

[0018] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; and storage at 20℃. The amplified product was 347 bp in length and contained base position 135221179 on chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version, with base mutations of A / A, A / T, and T / T. The nucleotide sequences of the amplified product are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0019] In the third step, the criterion is that the egg yolk weight of ducks with the CD99 gene SNP site A / A is higher than that of ducks with the A / T and T / T genotypes, and the egg yolk weight of ducks with the A / T genotype is higher than that of ducks with the T / T genotype.

[0020] This invention uses the CD99 gene molecular marker to detect the genotype of duck egg yolk weight. Individuals with the CD99 gene SNP site A / A have a higher egg yolk weight at 30 weeks of age than those with the A / T and T / T genotypes, and the A / T genotype individuals have a higher egg yolk weight than the T / T genotype individuals. Using the genomic DNA of the ducks to be tested as a template, PCR amplification is performed with specific primer pairs. The PCR amplification products are then subjected to Sanger sequencing and SNP molecular marker genotyping. Based on the genotype of this SNP molecular marker, selection of duck egg yolk weight can be achieved. In breeding, based on breeding objectives, this invention utilizes molecular markers to screen for high-quality duck egg yolk weight indicators by eliminating individuals with the CD99 gene A / T genotype, CD99 gene A / A genotype, and CD99 gene T / T genotype. The beneficial effects include efficient and rapid identification of duck egg yolk weight traits, increased high-quality egg rate, accelerated breeding progress, improved breeding accuracy, and reduced breeding and production costs. It has significant economic and breeding value for high-quality ducks, providing a scientific basis for early selection and breeding of superior ducks. Furthermore, the detection method disclosed in this invention is simple and easy to operate, can be carried out in a laboratory, and can also be applied to genomic breeding technology. Attached Figure Description

[0021] Figure 1 This is a Manhattan plot of GWAS analysis of duck egg yolk weight at 30 weeks of age.

[0022] Figure 2 These are Sanger sequencing results of PCR amplification products of the three genotypes of the CD99 gene. Figure 3 This is a phenotypic distribution map of individuals with three genotypes of the chr1:135221179 molecular marker. Detailed Implementation

[0023] The following examples are applicable to the breeding of Jinding ducks, which are commercially available and will not be described in detail. Example

[0024] In this embodiment, the yolk weight of eggs from Jinding female ducks at 30 weeks of age was measured. SNP genotyping was performed using whole-genome resequencing technology, and CD99 gene molecular markers significantly associated with yolk weight were identified through genome-wide association analysis. The results are as follows: Figure 1 As shown.

[0025] This embodiment uses the following experiments to identify and apply the CD99 gene molecular marker related to duck egg yolk weight.

[0026] 1. Phenotyping and Genotyping

[0027] (1) Experimental materials and determination of egg yolk weight phenotype

[0028] Fifty-eight female Jinding ducks were selected as experimental animals and raised under the same conditions, with free access to food and water throughout the process. At 30 weeks of age, the yolk weight of the eggs laid by each duck was recorded sequentially as phenotypic data of duck yolk weight.

[0029] (2) Extraction of genomic DNA

[0030] Blood was collected from the subwing vein of the individuals to be tested, and after anticoagulation, the blood was lysed, digested with proteinase K, extracted using the saturated sodium chloride method, dissolved in TE, and stored at -20°C.

[0031] (3) PCR amplification

[0032] Using the extracted genomic DNA as a template, the fragment containing the SNP molecular marker at position 135221179 of duck chromosome 1 was amplified.

[0033] Upstream primer: 5'-TCGCCAACTGAAGGAGTC-3' (SEQ ID NO:1)

[0034] Downstream primer: 5'-TGTTTGTGCCCTGAGGAT-3' (SEQ ID NO:2)

[0035] The final concentration of the reaction system (25 μl) is:

[0036] DNA to be tested 50ng

[0037] 2 x Accurate Taq Master Mix 12.5μl

[0038] 1 μl of upstream primer

[0039] 1 μl of downstream primer

[0040] Add sterile water to a final volume of 25 μl.

[0041] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; storage at 20℃; 10 μl was used for agarose gel assay, and an amplification product with a single target band of CD99 gene length of 347 bp was obtained, containing base position 135221179 of duck chromosome 1. The nucleotide sequence of the amplification product is shown in SEQ ID NO:3 or SEQ ID NO:4.

[0042] TCGCCAACTGAAGGAGTCTGTCATCAGAGGACAGTTTTCATTTCTGCAGCTTACACTGTAGCCCCACCTAAAAAAAATGAAGATTGAACGCTCATCATTTCTGCTACGGATATCCTTTGCCAGTTCTACATCAGCTGCTTTCCATGCCCTTTTTGCCCCCATCCCTTTGAGACATCAAGGGGGAACCCTGTACCCATAGAGAAGTATGGGCAGCCTTTCCCTTTTCCTCCATTTCACACCCCTTTTCAGAGGGCAGGTGGGTCACTGATTGCCTCATCATGCCTCAGTTACACCCCAGCTACAGAAACAGAGGGAAAAAAAGTGACAGGATCCTCAGGGCACAAACA (SEQ ID NO:3).

[0043] TCGCCAACTGAAGGAGTCTGTCATCAGAGGACAGTTTTCATTTCTGCAGCTTACACTGTAGCCCCACCTAAAAAAAATGAAGATTGAACGCTCATCATTTCTGCTACGGATATCCTTTGCCAGTTCTACATCAGCTGCTTTCCATGCCCTTTTTGCCCCCATCCCTTTGAGACTTCAAGGGGGAACCCTGTACCCATAGAGAAGTATGGGCAGCCTTTCCCTTTTCCTCCATTTCACACCCCTTTTCAGAGGGCAGGTGGGTCACTGATTGCCTCATCATGCCTCAGTTACACCCCAGCTACAGAAACAGAGGGAAAAAAAGTGACAGGATCCTCAGGGCACAAACA (SEQ ID NO:4).

[0044] (4)Sequencing verification and genotyping

[0045] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak maps are shown in Figure 2 、 Figure 3 as follows.

[0046] 2. Result analysis

[0047] Correlation analysis was performed on 511 Jinding female ducks at 30 weeks of age with clear records of yolk weight phenotype. The t-test function of R4.0 software was used for statistical testing. Pairwise comparison of means was selected to statistically test the genotype and yolk weight of the experimental duck flock. P < 0.05 indicated significant difference, and P < 0.01 indicated extremely significant difference. The results are shown in Tables 1 and 2. Figure 2 , Figure 3 As shown, among the tested individuals, there were 301 individuals with the CD99 gene A / A genotype, 113 with the A / T genotype, and 97 with the T / T genotype. The differences in yolk weight at 30 weeks of age among these three genotypes were highly significant (p<0.01). The average yolk weight at 30 weeks of age for individuals with the A / A genotype was 26.97 g / L, significantly higher than that of individuals with the A / T and T / T genotypes (p<0.01), exceeding the A / T genotype by 1.53 g / L and the T / T genotype by 2.62 g / L, respectively. The average yolk weight for individuals with the A / T genotype was 25.44 g / L, significantly higher than that of individuals with the T / T genotype (p<0.01), exceeding the T / T genotype by 1.09 g / L. The results showed that the CD99 gene molecular marker in ducks was significantly correlated with the yolk weight of duck eggs. Depending on the actual breeding goals, individuals with the CD99 gene A / A genotype can be bred to increase the yolk weight of duck eggs, or individuals with the CD99 gene T / T genotype can be bred to decrease the yolk weight of duck eggs, thereby improving the overall uniformity of yolk weight, increasing breeding efficiency, and meeting market demand.

[0048] Table 1. Association analysis of the molecular marker at position 135221179 on chromosome 1 with yolk weight.

[0049] genotype Quantity / piece 30-week-old egg yolk weight Standard deviation CV A / A 301 <![CDATA[26.97 a ]]> 0.77 2.86% A / T 113 <![CDATA[25.44 b ]]> 0.68 2.68% T / T 97 <![CDATA[24.35 c ]]> 0.67 2.75%

[0050] Note: Data with the same subtitle in the same column indicate no significant difference, while data with different subtitles indicate significant difference (P<0.05).

[0051] In addition to the above-described embodiments, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.

Claims

1. The application of primers for a molecular marker associated with duck egg yolk weight, characterized in that: The SNP molecular marker genotypes associated with yolk weight in duck eggs from the Jinding duck were detected; the detection method included the following steps. The first step is to perform PCR amplification on the DNA sample of the Jinding duck to be tested using duck DNA-specific primers to obtain the amplification product; The second step is to perform Sanger sequencing on the amplified product; the molecular marker is located at position 135221179 on chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version, with the base mutation being A or T; The third step is to determine the molecular marker genotype of the target site based on the sequencing results of the second step. The criteria for determination are that the egg yolk weight of A / A genotype ducks is higher than that of A / T genotype ducks and T / T genotype ducks, and the egg yolk weight of A / T genotype ducks is higher than that of T / T genotype ducks.

2. The application of the primers for the molecular markers related to duck egg yolk weight according to claim 1, characterized in that: In the first step, the nucleotide sequence of the duck DNA-specific primer pair consists of the upstream primer SEQ ID NO: 1 and the downstream primer SEQ ID NO:

2. The amplification product is 347 bp in length and contains the 135221179th base on chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version, with the base mutated to A or T.

3. The application of the primers for the molecular markers related to duck egg yolk weight according to claim 2, characterized in that: The final concentration of the PCR reaction system is 25 μl. 50 ng of duck DNA to be tested 2 x Accurate Taq Master Mix 12.5μl 1 μl of upstream primer 1 μl of downstream primer Add sterile water to a final volume of 25 μl. The PCR amplification reaction conditions are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; storage at 20℃; the nucleotide sequence of the amplification product is shown in SEQ ID NO: 3 and / or SEQ ID NO: 4.

Images