A SNP molecular marker combination, primer set and application for identifying the authenticity of the hybrid of mango 'Irwin' and 'Honey Gold'

Through the combination of SNP molecular markers and the design of specific primers, the problem of authenticity identification of "Aiwen" and "Jinhuang" hybrids in mango hybrid breeding was solved, and rapid and accurate hybrid identification was achieved, which improved the breeding efficiency and reliability of genetic research.

CN119410832BActive Publication Date: 2025-07-18SOUTH SUBTROPICAL CROP RES INST CHINA ACAD OF TROPICAL AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411868764.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-18
Publication Date
2025-07-18
Estimated Expiration
2044-12-18

AI Technical Summary

Technical Problem

In mango hybrid breeding, it is difficult to identify the authenticity of the hybrid "Aiwen" and "Jinhuang"; the existing technology mainly relies on morphological characteristics, has a long cycle and is susceptible to environmental and human factors, making it difficult to accurately identify.

Method used

Using a combination of SNP molecular markers, including Mgchr11_1781329 and Mgchr20_81237, specific amplification primers were designed to quickly and accurately identify hybrid authenticity through PCR amplification and genotyping.

Benefits of technology

The rapid and accurate identification of the authenticity of the hybrid "Aiwen" and "Jinhuang" has been achieved, the efficiency of mango breeding has been improved, and the foundation for genetic research has been laid.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119410832B_ABST
    Figure CN119410832B_ABST
Patent Text Reader

Abstract

The present invention discloses an SNP molecular marker combination, a primer set and their applications for identifying the authenticity of the hybrid of mango 'Irwin' and 'Honey Gold', belonging to the technical field of mango cross-breeding. It includes Mgchr11_1781329 and Mgchr20_81237; Mgchr11_1781329 is located at the 1781329th position of chromosome 11, the genotype of 'Irwin' is TT, the genotype of 'Honey Gold' is AA, and the genotype of the hybrid is T / A; Mgchr20_81237 is located at the 81237th position of chromosome 20, the genotype of 'Irwin' is AA, the genotype of 'Honey Gold' is TT, and the genotype of the hybrid F1 is A / T. The primer set designed based on this SNP marker can quickly and effectively identify the authenticity of the hybrid of mango 'Irwin' and 'Honey Gold', and the identification result is accurate and reliable, which is beneficial to the genetic breeding of mango.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of mango cross-breeding, and particularly relates to a SNP molecular marker combination, a primer set for identifying the authenticity of hybrids of mango 'Irwin' and 'Honey Gold', and their applications. Background Art

[0002] Mango is an important tropical fruit, known as the "King of Tropical Fruits" because of its beautiful appearance, sweet fruit, and strong aroma. The main growing areas of mango are between 30° north and south latitudes, including more than 100 countries and regions. Currently, there are more than 1,000 mango varieties in the world, and more than 100 of them are in China. However, many varieties are introduced from abroad. After decades of cultivation, these varieties are facing problems such as reduced yield, decreased resistance, and poor uniformity, that is, variety degradation problems. The problem of lack of excellent varieties is gradually emerging. The breeding and promotion of new varieties are effective means for variety structure adjustment and industrial quality improvement and efficiency increase. Currently, cross-breeding is the main method for mango new variety breeding. However, its breeding cycle is long, and due to open pollination, it is easy to produce false hybrids. And it is time-consuming and laborious to identify the authenticity of hybrids based on the phenotypic traits in the field for the hybrid offspring, and it is easily affected by environmental and human factors. With the concentrated use of parents, the morphological differences of hybrid offspring are getting smaller and smaller, and the difficulty of identifying true and false hybrids using morphological characteristics is also increasing. Due to the relatively long cycle required for identifying true and false hybrids, the identification work has become increasingly difficult in actual operation.

[0003] Identifying variety identity by DNA molecular markers has the advantages of accuracy, reliability, simplicity, rapidity, easy operation, good timeliness, etc. It is widely used in the variety authenticity identification of various fruit trees such as citrus, apple, grape, cherry, peach, kiwifruit, etc. The International Union for the Protection of New Varieties of Plants (UPOV) has recommended SSR marker technology and single nucleotide polymorphism technology (SNP) as two technologies for variety identification or seed purity identification in the BMT molecular test guidelines. However, SSR technology has defects such as fewer detected loci, low throughput, poor result representativeness, and difficulty in data sharing. SNP markers are highly and evenly distributed in the genome, can achieve high-throughput detection, and are more suitable for the integration and sharing of databases. Therefore, it is considered the most promising molecular marker technology.

[0004] Currently, the identification of mango hybrid offspring is mainly through the observation of morphological characteristics of varieties over many years and at many locations. There is no report on the identification of the authenticity of F1 hybrid populations with 'Irwin' and 'Honey Gold' as parents using molecular markers. Summary of the Invention

[0005] The object of the present invention is to provide an SNP molecular marker combination, a primer set and their applications for identifying the authenticity of hybrids of mango 'Irwin' and 'Honey Gold', so as to solve the problems existing in the above-mentioned prior art. The present invention provides an SNP marker that can be used for identifying the authenticity of hybrid offspring of 'Irwin' and 'Honey Gold', and conducts hybrid authenticity identification on the F1 population with 'Irwin' and 'Honey Gold' as parents, laying a foundation for improving the efficiency of mango cross-breeding and further carrying out genetic research.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is an SNP molecular marker combination for identifying the authenticity of hybrids of mango 'Irwin' and 'Honey Gold', including Mgchr11_1781329 and Mgchr20_81237;

[0008] The Mgchr11_1781329 is located at the 1,781,329th position of chromosome 11. The genotype of 'Irwin' is TT, the genotype of 'Honey Gold' is AA, and the genotype of the hybrid is T / A;

[0009] The Mgchr20_81237 is located at the 81,237th position of chromosome 20. The genotype of 'Irwin' is AA, the genotype of 'Honey Gold' is TT, and the genotype of the hybrid F1 is A / T.

[0010] Another technical solution of the present invention is primers for specifically amplifying the SNP molecular marker combination, including primers for specifically amplifying Mgchr11_1781329 and primers for specifically amplifying Mgchr20_81237.

[0011] Another technical solution of the present invention is the application of the SNP molecular marker combination and the primers in identifying the authenticity of hybrids of mango 'Irwin' and 'Honey Gold'.

[0012] Another technical solution of the present invention is a method for identifying the authenticity of hybrids of mango 'Irwin' and 'Honey Gold', including the following steps: using the primers to detect the genotypes of the SNP molecular marker combination, and judging the authenticity of the hybrids according to the genotypes.

[0013] Another technical solution of the present invention is the application of the SNP molecular marker combination and the primers in mango breeding.

[0014] Based on the above technical solutions, the present invention has the following technical effects:

[0015] The primer set designed based on the SNP markers for identifying the authenticity of the hybrids of mango 'Irwin' and 'Honey Gold' provided by the present invention can quickly and effectively identify the authenticity of the hybrids of mango 'Irwin' and 'Honey Gold', and the identification result is accurate and reliable, which is beneficial to the genetic breeding of mangoes. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0017] Figure 1 It is the genotyping result of primer screening for Mgchr3_9859221;

[0018] Figure 2 It is the genotyping result of primer screening for Mgchr4_9776523;

[0019] Figure 3 It is the genotyping result of primer screening for Mgchr10_989472;

[0020] Figure 4 It is the genotyping result of primer screening for Mgchr11_1781329;

[0021] Figure 5 It is the genotyping result of primer screening for Mgchr17_4602769;

[0022] Figure 6 It is the genotyping result of primer screening for Mgchr20_81237;

[0023] Figure 7 It is the genotyping result of 117 individual plants for Mgchr11_1781329.

[0024] Figure 8 It is the genotyping result of 117 individual plants for Mgchr20_81237.

[0025] Among them, Figures 1 to 8 The blue circles represent the genotype of 'Honey Gold', the red circles represent the genotype of 'Irwin', and the green circles represent the genotype of the hybrid F1 generation. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0026] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0027] It should be understood that the terms used in this invention are only for describing specific embodiments and are not intended to limit the invention. Additionally, for the numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0028] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0029] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the specification of this invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of this invention are obvious to those skilled in the art. The specification and examples of this application are merely exemplary.

[0030] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0031] The technical solutions described in this invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are all purchased from commercial channels or have been made public.

[0032] The embodiments of this invention provide a SNP molecular marker combination for identifying the authenticity of hybrids of mango 'Irwin' and 'Honey Gold', including Mgchr11_1781329 and Mgchr20_81237;

[0033] The Mgchr11_1781329 is located at the 1781329th position on chromosome 11. The genotype of 'Irwin' is TT, the genotype of 'Honey Gold' is AA, and the genotype of the hybrid is T / A;

[0034] The Mgchr20_81237 is located at the 81237th position on chromosome 20. The genotype of 'Irwin' is AA, the genotype of 'Honey Gold' is TT, and the genotype of the hybrid F1 is A / T.

[0035] It should be noted that mango 'Aiwen' and 'Jinhuang' are two mango varieties known in the art and have no specific meaning; in addition, the hybrid in the present invention is the F1 hybrid of mango 'Aiwen' and 'Jinhuang'. In addition, the mango reference genome GCF_011075055.1 / (https: / / www.ncbi.nlm.nih.gov / ) is used as the reference genome in the present invention.

[0036] The embodiment of the present invention also provides primers for specifically amplifying the SNP molecular marker combination, including primers for specifically amplifying Mgchr11_1781329 and primers for specifically amplifying Mgchr20_81237.

[0037] In some specific embodiments, the primers for specifically amplifying Mgchr11_1781329 consist of the sequences shown in SEQ ID NOs. 1 to 3.

[0038] In some specific embodiments, the primers for specifically amplifying Mgchr20_81237 consist of the sequences shown in SEQ ID NOs. 4 to 6.

[0039] It should be noted that the above primer set can be added with commonly used detection auxiliary reagents to prepare a detection reagent. Commonly used detection auxiliary reagents are known in the art, such as buffer solution and the like.

[0040] In some specific embodiments, the above detection reagents may also include fluorescent reagents. It should be noted that fluorescent reagents may be added to the above detection reagents. Specifically, the difference in the last base at the 3' end of the primer and the fluorescent signal value can be used to distinguish and amplify DNA fragments of specific alleles, and the fluorescent signal value of the site to be tested can be detected to perform genotyping.

[0041] The embodiment of the present invention also provides the application of the SNP molecular marker combination and the primers in identifying the authenticity of the hybrid of mango 'Aiwen' and 'Jinhuang'.

[0042] The embodiment of the present invention also provides a method for identifying the authenticity of a hybrid of mangoes 'Aiwen' and 'Jinhuang', comprising the following steps: using the primers to detect the genotype of the SNP molecular marker combination, and judging the authenticity of the hybrid according to the genotype.

[0043] In some specific embodiments, the method for judging the authenticity of the hybrid according to the genotype is:

[0044] If the genotype of Mgchr11_1781329 is TT, it is the 'Aiwen' mango; if the genotype is AA, it is the 'Jinhuang' mango; if the genotype is T / A, it is a hybrid;

[0045] If the genotype of the Mgchr20_81237 is AA, it is the 'Aiwen' mango; if the genotype is TT, it is the 'Jinhuang' mango; if the genotype is A / T, it is a hybrid.

[0046] The embodiment of the present invention also provides the application of the SNP molecular marker combination and the primer in mango breeding.

[0047] Example 1

[0048] With 'Aiwen' as the male parent and 'Jinhuang' as the female parent, hybridization was carried out by artificial pollination, and 115 hybrid offspring of 'Aiwen' and 'Jinhuang' were obtained and planted in the South Subtropical Crops Research Institute of the Chinese Academy of Tropical Agricultural Sciences.

[0049] 1. SNP Primer Screening

[0050] The DNA of the leaf base of mango parents and offspring was extracted by alkaline boiling. Based on the resequencing data of 'Aiwen' and 'Jinhuang', the homozygous SNP sites with differences between the parents were screened, and 6 sets of primers were designed (see Table 1) (3 specific primers were designed using Primer5, named primer X, primer Y and primer R, respectively, and the primers were sent to Shanghai Bio-Tech Synthesis).

[0051] Table 1 SNP marker information of homozygous sites with differences between 'Jinhuang' and 'Aiwen'

[0052]

[0053]

[0054] Note: The linker sequence matching FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the linker sequence matching HEX fluorescence is GAAGGTCGGAGTCAACGGATT.

[0055] According to the difference of the last base at the 3' end of the primer and the fluorescence signal value, the DNA fragment of the specific allele is distinguished and amplified, and the fluorescence signal value of the test site is detected to perform genotyping; 3 'Aiwen' and 3 'Jinhuang' and 16 hybrid F1 generations, a total of 22 individuals, were used as materials, and the PARMS-SNP labeling method was used to screen primers. The SNP typing reagent PARMS was purchased from Wuhan Jingtai Biological; the PCR amplification reaction system is shown in Table 2 below.

[0056] Table 2 PCR reaction system

[0057] Component Volume 2×PARMS 2.5 μL Primer X 0.075 μL Primer Y 0.075 μL Primer R 0.2 μL DNA template 1 μL Double-distilled water 2.5 μL

[0058] The PCR reaction was carried out on an ABI QuantStudio 6 QS6 instrument, and genotyping was performed on the instrument. The reaction procedure is shown in Table 3.

[0059] Table 3 PCR reaction procedure

[0060] Step Temperature Duration 1 94℃ 15 min 2 94℃ 20s 3 65 °C (decreasing by 0.7 °C per cycle) 1 min 4 Return to Step 2, 10 cycles 5 94℃ 20s 6 57℃ 1 min

[0061] The results showed that the 6 primer sets were respectively distributed on 6 chromosomes, namely chr3, chr4, chr10, chr11, chr17 and chr20. After PCR amplification, among the 6 primer sets, Mgchr11_1781329 and Mgchr20_81237 could effectively distinguish 22 materials, and these 22 materials could be divided into 3 types. Among them, blue represents the homozygous genotype of 'Jinhuang', red represents the homozygous genotype of 'Aiwun', and green represents the heterozygous genotype of the hybrid F1 generation. It indicates that Mgchr11_1781329 and Mgchr20_81237 can be used for the authenticity identification of the offspring of the cross between 'Jinhuang' and 'Aiwun' (Table 4).

[0062] Table 4 SNP markers for the authenticity identification of the hybrids of 'Aiwun' and 'Jinhuang'

[0063]

[0064] II. Identification of the authenticity of hybrids

[0065] PCR amplification was performed on 117 individual plants including 1 'Aiwun', 1 'Jinhuang' and 115 hybrid F1 generations using the selected primer sets, so as to perform genotyping on the genomic DNA; the genotypes of each sample were counted. When the genotype of the sample was a homozygous genotype, it was a false hybrid; when the genotype of the sample was a heterozygous genotype, it was a true hybrid.

[0066] The results showed that both of the 2 markers could divide the 117 individual plants into 3 genotypes. Both of the two markers identified 115 true hybrids, and the true hybrid rate was 100% (Table 5).

[0067] Table 5 Statistical results of the authenticity identification of the hybrids of 'Aiwun' and 'Jinhuang'

[0068] Hybrid combination (♀×♂) Primer <![CDATA[Total number of F1 (strains)]]> True hybrid (plant) True hybrid rate (%) ‘Aiwun’בJinhuang’ Mgchr11_1781329 115 115 100% ‘Aiwun’בJinhuang’ Mgchr20_81237 115 115 100%

[0069] Obviously, the above-mentioned embodiments of the present invention are merely examples for clearly explaining the present invention, rather than limitations on the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation manners here. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the claims of the present invention.

Claims

1. Application of a SNP locus combination for identifying the authenticity of the hybrid of mango 'Irwin' and 'Honey Gold' in identifying the authenticity of the hybrid of mango 'Irwin' and 'Honey Gold', characterized in that, The SNP locus combination includes Mgchr11_1781329 and Mgchr20_81237; the mango reference genome is GCF_011075055.1; The Mgchr11_1781329 is located at the 1781329th position on chromosome 11. The genotype of 'Irwin' is TT, the genotype of 'Honey Gold' is AA, and the genotype of the hybrid is T / A; The Mgchr20_81237 is located at the 81237th position on chromosome 20. The genotype of 'Irwin' is AA, the genotype of 'Honey Gold' is TT, and the genotype of the F1 hybrid is A / T.

2. Primers for specifically amplifying the SNP locus combination described in claim 1, characterized in that, It includes primers for specifically amplifying Mgchr11_1781329 and primers for specifically amplifying Mgchr20_81237; The primers for specifically amplifying Mgchr11_1781329 consist of the sequences shown in SEQ ID NO.1~3; The primers for specifically amplifying Mgchr20_81237 consist of the sequences shown in SEQ ID NO.4~6.

3. Use of the primers according to claim 2 in identifying the authenticity of the hybrid of mango 'Irwin' and 'Honey Gold'.

4. A method for identifying the authenticity of the hybrid of mango 'Irwin' and 'Honey Gold', characterized in that, It includes the following steps: Using the primers according to claim 2, detect the genotypes of the SNP locus combination described in claim 1, and judge the authenticity of the hybrid according to the genotypes; The method for judging the authenticity of the hybrid according to the genotypes is: If the genotype of Mgchr11_1781329 is TT, it is 'Irwin' mango; if the genotype is AA, it is 'Honey Gold' mango; if the genotype is T / A, it is a hybrid; If the genotype of Mgchr20_81237 is AA, it is 'Irwin' mango; if the genotype is TT, it is 'Honey Gold' mango; if the genotype is A / T, it is a hybrid.

Citation Information

Patent Citations

  • Application of glutathione S transferase gene in increasing vitamin C content of mangoes

    CN114891809A

  • Method for treating glorious flower spikes to promote fruit bearing

    CN118177021A