A fluorescent PCR detection reagent, a kit and its application for detecting African swine fever virus

Abstract

The present invention discloses a fluorescent PCR detection reagent, a kit and an application thereof for detecting African swine fever virus. The fluorescent PCR detection reagent comprises a primer probe set, wherein the sequences of the primers in the primer probe set are shown in SEQ ID NO:1 and SEQ ID NO:2, and the sequence of the probe is shown in SEQ ID NO:3; the 12th nucleotide at the 3' end of the sequence of the probe is a locked nucleic acid. The fluorescent PCR detection reagent for detecting African swine fever virus provided by the present invention has good anti-interference effect, high sensitivity and good specificity, and can be effectively used for the detection of African swine fever virus.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a fluorescent PCR detection reagent, a kit and applications thereof for detecting African swine fever virus. Background Art

[0002] African swine fever (ASF) is a highly contagious disease of pigs caused by African swine fever virus (ASFV). African swine fever virus is an enveloped, linear, double-stranded DNA virus with a genome length of about 170kb to 193kb. ASF has the characteristics of high morbidity and mortality. Currently, there is a lack of effective vaccines and specific treatments, making ASF one of the most serious diseases currently endangering the pig industry.

[0003] Currently, the control of ASF can only rely on rapid laboratory diagnosis, the killing of diseased animals, and the adoption of effective quarantine measures and strict hygiene measures. Therefore, there is an urgent need to provide a highly sensitive African swine fever detection reagent. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a fluorescent PCR detection reagent for detecting African swine fever virus, which can quickly and sensitively detect African swine fever virus and has good anti-interference effect.

[0005] The present invention also provides a test kit having the fluorescent PCR detection reagent.

[0006] The present invention also provides the application of the fluorescent PCR detection reagent and kit.

[0007] According to one aspect of the present invention, a fluorescent PCR detection reagent for detecting African swine fever virus is proposed, the fluorescent PCR detection reagent comprising a primer probe set and a fluorescent quantitative PCR reaction solution; in the primer probe set, the sequences of the primers are as shown in SEQ ID NO:1 and SEQ ID NO:2; the sequence of the probe is as shown in SEQ ID NO:3; the 12th nucleotide at the 3' end of the sequence of the probe is a locked nucleic acid; the fluorescent quantitative PCR reaction solution comprises a stabilizer and an enhancer; the stabilizer comprises betaine; and the enhancer comprises Triton X-100 and tetramethylammonium chloride.

[0008] In some embodiments of the present invention, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0009] In some embodiments of the present invention, the fluorescent reporter group includes FAM and HEX.

[0010] In some embodiments of the present invention, the fluorescence quenching group includes super Quenther 1 and BHQ.

[0011] In some embodiments of the present invention, the concentration of betaine is 0.15-3.8M.

[0012] In some embodiments of the present invention, the concentration of betaine is 1.5M.

[0013] In some embodiments of the present invention, the concentration of Triton X-100 is 1.5%-17%.

[0014] In some embodiments of the present invention, the added concentration of Triton X-100 is 5%.

[0015] In some embodiments of the present invention, the concentration of tetramethylammonium chloride is 0.25-1.5M.

[0016] In some embodiments of the present invention, the concentration of tetramethylammonium chloride is 1M.

[0017] In some embodiments of the present invention, the fluorescent quantitative PCR reaction solution further includes DNA polymerase, Mg 2+ The fluorescent quantitative PCR reaction solution can be effectively used to resist the interference of physiological saline, hemoglobin, purified mucin and anhydrous ethanol by adding betaine, Triton X-100 and tetramethylammonium chloride.

[0018] In some embodiments of the present invention, the DNA polymerase is preferably a hot-start Taq DNA polymerase.

[0019] In some embodiments of the present invention, the fluorescent quantitative PCR reaction solution also includes a buffer solution, which includes a Tris-HCL solution with a concentration of 400-600mM, a NH4Cl solution with a concentration of 400-600mM, and a KCl solution with a concentration of 0.8-1.2M.

[0020] In some embodiments of the present invention, the fluorescent PCR detection reagent also includes a primer probe set for detecting an internal standard gene.

[0021] In some embodiments of the present invention, the primer sequences of the primer probe set for detecting the internal standard gene are shown in SEQ ID NO:19 and SEQ ID NO:20, and the probe sequence is shown in SEQ ID NO:21.

[0022] According to a second aspect of the present invention, a kit is provided, wherein the kit contains the above-mentioned fluorescent PCR detection reagent.

[0023] In the third aspect of the present invention, an application of the above-mentioned fluorescent PCR detection reagent and kit is proposed, and the application is an application in the preparation of products for detecting or assisting in the detection of African swine fever virus.

[0024] In some embodiments of the present invention, the product is selected from a kit or a chip.

[0025] In some embodiments of the present invention, the method for using the product for detecting or assisting in the detection of African swine fever virus comprises the following steps: using the above-mentioned fluorescent PCR detection reagent or kit to detect the DNA of the sample to be tested.

[0026] In some embodiments of the present invention, the detection is performed using fluorescent quantitative PCR.

[0027] In some embodiments of the present invention, the final concentration of the primer in the reaction system of the fluorescent quantitative PCR is 0.05-0.5 μM (for example, it may be 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM or 0.5 μM).

[0028] In some embodiments of the present invention, the final concentration of the probe in the fluorescent quantitative PCR reaction system is 0.01-0.5 μM (for example, it may be 0.01 μM, 0.05 μM, 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM or 0.5 μM).

[0029] In some embodiments of the present invention, the reaction system used in the fluorescent quantitative PCR is as follows:

[0030] The final concentration of Tris-HCl is 35-55 mM;

[0031] The final concentration of NH4Cl is 15-25mM;

[0032] The final concentration of KCl is 40-80 mM;

[0033] The final concentration of betaine was 10-250 mM;

[0034] The final concentration of Triton X-100 is 0.005%-0.05%;

[0035] The final concentration of tetramethylammonium chloride is 5-30 mM;

[0036] The final concentration of dNTP mix is ​​0.4-0.5mM;

[0037] The final concentration of the forward primer was 0.05-0.5 μM;

[0038] The final concentration of the reverse primer was 0.05-0.5 μM;

[0039] The final concentration of the probe was 0.01-0.5 μM;

[0040] The amount of Taq enzyme added is 8-12U;

[0041] The final concentration of MgCl2 is 0.001-0.1M;

[0042] The amount of sample to be tested is 8~12µL;

[0043] Add ddH2O to make up to 50 µL.

[0044] In some embodiments of the present invention, the amplification program of the fluorescent quantitative PCR is: 35-39°C 1-3min; 94-96°C 1-3min; then enter the cycling stage: 93-96°C 8-12s, 55-60°C 15-25s, 40-50 cycles, and collect fluorescence data.

[0045] In some embodiments of the present invention, the amplification program of the fluorescent quantitative PCR is: 37°C for 2 min; 95°C for 2 min; then enter the cycling stage: 95°C for 10 s, 56°C for 20 s, 45 cycles, and collect fluorescence data.

[0046] In some embodiments of the present invention, after the detection, the step of statistically analyzing the Ct value of the sample and interpreting the result is also included; the result interpretation is:

[0047] Positive: If the Ct value of the FAM channel of the sample is ≤40 and a typical S-shaped fluorescence curve appears, the sample is reported as positive for African swine fever virus;

[0048] Negative: If the sample FAM test has no Ct value, and the internal standard (HEX / VIC channel) test Ct value is <40, the sample is reported as negative for African swine fever virus.

[0049] According to some embodiments of the present invention, at least the following beneficial effects are achieved: the fluorescent PCR detection reagent for detecting African swine fever virus provided by the present invention has good anti-interference effect, high sensitivity, and good specificity, and can be effectively used for the detection of African swine fever virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0051] Figure 1 This is a diagram showing the detection results of the primer probe set 1 in Example 1 of the present invention;

[0052] Figure 2 This is a diagram showing the detection results of the primer probe set 2 in Example 1 of the present invention;

[0053] Figure 3 This is a diagram showing the detection results of the primer probe set 3 in Example 1 of the present invention;

[0054] Figure 4 This is a diagram showing the detection results of the primer probe set 4 in Example 1 of the present invention;

[0055] Figure 5 This is a diagram showing the detection results of the primer probe set 5 in Example 1 of the present invention;

[0056] Figure 6 This is a diagram showing the detection results of the primer probe set 6 in Example 1 of the present invention;

[0057] Figure 7 This is a diagram of the locked nucleic acid primer probe sequence detection result in Example 1 of the present invention;

[0058] Figure 8 This is a graph showing the detection results of amplifying a pig serum sample using the primer probe set 2 in Example 1 of the present invention;

[0059] Fig. 9 This is a test result diagram of the final concentration of betaine of 10 mM in Example 3 of the present invention;

[0060] Fig.10 This is a test result diagram of the final concentration of betaine of 50 mM in Example 3 of the present invention;

[0061] Fig.11 This is a test result diagram of the final concentration of betaine of 100 mM in Example 3 of the present invention;

[0062] Fig.12 This is a test result diagram of the final concentration of betaine of 250 mM in Example 3 of the present invention;

[0063] Fig.13 This is a test result diagram of the final concentration of betaine of 500 mM in Example 3 of the present invention;

[0064] Fig.14 This is a test result diagram of the final concentration of betaine of 1000 mM in Example 3 of the present invention;

[0065] Fig.15 This is a test result diagram of the final concentration of Triton X-100 of 0.005% in Example 3 of the present invention;

[0066] Fig.16 This is a test result diagram of the final concentration of Triton X-100 of 0.010% in Example 3 of the present invention;

[0067] Fig.17 This is a test result diagram of the final concentration of Triton X-100 of 0.015% in Example 3 of the present invention;

[0068] Fig.18 This is a test result diagram of the final concentration of Triton X-100 of 0.030% in Example 3 of the present invention;

[0069] Fig.19 This is a test result diagram of the final concentration of Triton X-100 of 0.05% in Example 3 of the present invention;

[0070] Fig. 20 This is a test result diagram of the final concentration of Triton X-100 of 0.1% in Example 3 of the present invention;

[0071] Fig.21 This is a graph showing the detection results of the tetramethylammonium chloride in Example 3 of the present invention with a final concentration of 5 mM;

[0072] Fig. 22 This is a graph showing the detection results of the tetramethylammonium chloride in Example 3 of the present invention with a final concentration of 10 mM;

[0073] Fig.23 This is a test result diagram of the final concentration of tetramethylammonium chloride of 20 mM in Example 3 of the present invention;

[0074] Fig.24 This is a test result diagram of the tetramethylammonium chloride in Example 3 of the present invention with a final concentration of 30 mM;

[0075] Fig.25 This is a test result diagram of the tetramethylammonium chloride in Example 3 of the present invention with a final concentration of 50 mM;

[0076] Fig.26 This is a graph showing the detection results of the tetramethylammonium chloride in Example 3 of the present invention with a final concentration of 100 mM;

[0077] Fig. 27 This is a test result diagram of the stabilizer and enhancer combination 1 in Example 3 of the present invention;

[0078] Fig.28 This is a test result diagram of the stabilizer and enhancer combination 2 in Example 3 of the present invention;

[0079] Fig.29 This is a test result diagram of the stabilizer and enhancer combination 3 in Example 3 of the present invention;

[0080] Fig.30 This is a test result diagram of the stabilizer and enhancer combination 4 in Example 3 of the present invention;

[0081] Fig.31This is a test result diagram of the stabilizer and enhancer combination 5 in Example 3 of the present invention;

[0082] Fig.32 This is a graph showing the test results of the stabilizer and enhancer combination 6 in Example 3 of the present invention. DETAILED DESCRIPTION

[0083] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0084] Example 1 Design of primers and probes for detecting African swine fever

[0085] (1) Design of primers and probes

[0086] The present invention compares and analyzes a large number of African swine fever virus gene sequences and makes selections, then uses the biological software Oligo 7.60 to analyze the selected conserved gene regions to determine whether suitable primer probes can be designed, repeatedly analyzes the data, screens multiple pairs of primer probes, and then performs a comprehensive analysis on the multiple pairs of primer probes screened, and finally screens to obtain primer probe groups 1-6, the specific sequences of which are shown in Table 1, and the sequences are synthesized by Bio-Tech (Shanghai) Co., Ltd.

[0087] Table 1

[0088]

[0089] (2) Optimization of primer and probe sets

[0090] Use different sets of primers and probes designed in step (1) (primer-probe sets 1-6, respectively) to conduct experiments and screen out the optimal detection primers and probes (set up 2 parallels for each set).

[0091] The preparation steps of the detection template are as follows: ① The original plasmid of African swine fever virus synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. (the template sequence of African swine fever virus is shown in SEQ ID NO: 22. The template sequence is connected to the pUC-57 plasmid to obtain the original plasmid of African swine fever virus. The original plasmid concentration is 0.03125µg / µL) has 8 tubes, each tube has about 10µL of liquid, and 90µL of 0.01% TE-SDS is added to each tube. After shaking and mixing, 10µL of each tube is taken into a new centrifuge tube to form 1 tube of mixed plasmid (i.e., the concentration is 3.125×10 -3②Take 10µL of the mixed plasmid and add 990µL 0.01% TE-SDS, marking it as 10 -2 (i.e., the concentration is 3.125×10 -5 µg / µL); ③ Take the concentration of 10 -2 10 µL of plasmid was added to 990 µL of 0.01% TE-SDS, marked as 10 -4 (i.e., the concentration is 3.125×10 -7 µg / µL); ④ Take the concentration of 10 -4 10 µL of plasmid was added to 990 µL of 0.01% TE-SDS, marked as 10 -6 (i.e., the concentration is 3.125×10 -9 µg / µL); ⑤ Take the concentration of 10 -6 100 µL of plasmid was added with 900 µL of 0.01% TE-SDS, marked as 10 -7 (i.e., the concentration is 3.125×10 -10 µg / µL); ⑥ Take the concentration of 10 -7 100 µL of plasmid was added with 900 µL of 0.01% TE-SDS, marked as 10 -8 (i.e., the concentration is 3.125×10 -11 µg / µL); ⑦ Take the concentration of 10 -8 100 µL of plasmid was added with 900 µL of 0.01% TE-SDS, marked as 10 -9 (i.e., the concentration is 3.125×10 -12 µg / µL, or 3.125 fg / mL).

[0092] Option 10 -7 , 10 -8 , 10 -9 The plasmid template was detected using the following reaction system and reaction procedure.

[0093] The reaction system is shown in Table 2.

[0094] Table 2

[0095]

[0096] The fluorescence PCR reaction cycle parameters were: 37°C for 2 min; 95°C for 2 min; then entering the cycling phase: 95°C for 10 sec, 56°C for 20 sec (collecting fluorescence), for 45 cycles.

[0097] Table 3

[0098]

[0099] Test results such as Figure 1-6 As shown in Table 3, it can be seen that primer probe sets 1-6 all have good detection effects. From the perspective of Ct values ​​and detection rates of low-concentration samples, primer probe set 2 is better than primer probe sets 1 and 3-6. Therefore, primer probe set 2 was selected for subsequent locked nucleotide design.

[0100] (3) Design of locked nucleic acid probes

[0101] For the above-selected primer probe set 2, the probe sequence is comprehensively analyzed, and a nucleotide is selected in a targeted manner and replaced with the corresponding locked nucleic acid. The specific locked nucleic acid primer probe sequence obtained is as follows:

[0102] ASFV-F: TAACGAGAACGTGAACCTTGC (SEQ ID NO: 1);

[0103] ASFV-R: GCGTATAAAAAGTCCAGGAAATTC (SEQ ID NO: 2);

[0104] ASFV-P: 5'6-FAM CCCTCGGTATCC +A ATTCCCT 3' super Quenther 1 (SEQ ID NO: 4).

[0105] in, +A It indicates a locked nucleotide modification by adding an LNA-A to the C base.

[0106] (4) Selection of locked nucleic acid primer probes and common primer probes

[0107] Sample source: pig serum sample.

[0108] Nucleic acid was extracted from pig serum samples and the Ct value was detected using a self-prepared reaction solution (the reaction system is shown in Table 2, and the reaction procedure is consistent with the optimization of the primer probe set (2)). A sample with a Ct value of 24.6 was obtained.

[0109] The sample with a Ct value of 24.6 was diluted 10 times to obtain a sample with a Ct value of approximately 27.9; the sample with a Ct value of approximately 27.9 was further diluted 100 times to obtain a sample nucleic acid with a Ct value of approximately 34.6 for LoD detection; the sample with a Ct value of approximately 34.6 was further diluted 2 times to obtain a sample nucleic acid with a Ct value of approximately 35.6 for low-concentration detection rate test.

[0110] The reaction system used in the low concentration detection rate test is shown in Table 4 below.

[0111] Table 4

[0112]

[0113] Table 5

[0114]

[0115] The results of low concentration detection rate determination are shown in Table 5 and Figure 7-8 As shown, it can be seen that the detection limit and detection accuracy of the modified locked nucleic acid primer probe sequence are significantly higher, so the locked nucleic acid primer probe sequence is selected for subsequent experiments.

[0116] Example 2 A Fluorescence Quantitative PCR Reaction Solution

[0117] The present embodiment provides a reaction solution for fluorescent quantitative PCR, which contains a Tris-HCL solution with a concentration of 500mM, an NH4Cl solution with a concentration of 500mM, a KCl solution with a concentration of 1M, a betaine solution with a concentration of 1.5M, a 5% Triton X-100 solution with a concentration of 1M, a tetramethylammonium chloride solution with a concentration of 1mol / L, a MgCl2 solution with a concentration of 5U / μL, and a Taq DNA polymerase with a concentration of 25mM.

[0118] Example 3 Optimization of Fluorescence Quantitative PCR Reaction Solution Components

[0119] This example optimizes the system of the fluorescent quantitative PCR reaction solution in Example 2, as follows:

[0120] 1. Optimization of betaine concentration

[0121] Compared with the fluorescent quantitative PCR reaction solution in Example 2, the only difference is that the concentration of the added betaine solution is different. The solvent in the betaine solution is water, so that the final concentration of betaine in the reaction solution in Table 6 is 10, 50, 100, 250, 500, and 1000 mM, respectively. The template used for detection is 10 in Example 1. -5 , 10 -6 , 10 -7 Plasmid template.

[0122] The reaction system is shown in Table 6.

[0123] Table 6

[0124]

[0125] The fluorescence PCR reaction cycle parameters were: 37°C for 2 min; 95°C for 2 min; then entering the cycling phase: 95°C for 10 sec, 56°C for 20 sec (collecting fluorescence), for 45 cycles.

[0126] Table 7

[0127]

[0128] The results are as follows Figure 9-14 As shown in Table 7, it can be seen that the final concentration range of the stabilizer betaine is 10-250mM, which can achieve the detection of African swine fever virus, and the final concentration of 100mM is the best, that is, the concentration of 1.5M betaine is the best.

[0129] 2. Optimization of Triton X-100 concentration

[0130] Compared with the fluorescent quantitative PCR reaction solution in Example 2, the only difference is that the concentration of the added Triton X-100 solution is different. The solvent of the Triton X-100 solution is water, so that the final concentration of Triton X-100 in the reaction solution is 0.005%, 0.01%, 0.015%, 0.03%, 0.05%, and 0.1%, respectively. The reaction system and reaction procedure are consistent with 1. The optimization of betaine concentration, and the template used for detection is 10 in Example 1. -4 , 10 -5 , 10 -6 Plasmid template.

[0131] Table 8

[0132]

[0133] Test results such as Figure 15-20 As shown in Table 8, it can be seen from the figure that the final concentration range of the enhancer Triton X-100 is 0.005%-0.05%, which can achieve the detection of African swine fever virus, and the best concentration is 0.015%, that is, the best concentration is 5% Triton X-100.

[0134] 3. Optimization of tetramethylammonium chloride concentration

[0135] Compared with the fluorescent quantitative PCR reaction solution in Example 2, the only difference is that the concentration of the added tetramethylammonium chloride solution is different, the solvent of the tetramethylammonium chloride solution is water, and the final concentration of tetramethylammonium chloride in the reaction solution is 5, 10, 20, 30, 50, and 100 mM, respectively. The reaction system and reaction procedure are consistent with 1. The optimization of betaine concentration is consistent with the template used in Example 1. -4 , 10 -5 , 10 -6 Plasmid template.

[0136] Table 9

[0137]

[0138] Test results such as Figure 21-26As shown in Table 9, it can be seen that the final concentration range of the enhancer tetramethylammonium chloride is 5-30mM, which can achieve the detection of African swine fever virus, and the final concentration is 20mM, that is, the best concentration is 1M tetramethylammonium chloride.

[0139] 4. Optimization of the combination of stabilizers and enhancers

[0140] The stabilizer and enhancer combinations 1-6 are different from the fluorescent quantitative PCR reaction solution in Example 2 only in that the concentration of betaine, the concentration of tetramethylammonium chloride and the final concentration of Triton X-100 are different, as shown in Table 10. The interfering substances physiological saline, heme, purified mucin and anhydrous ethanol are mixed in a volume ratio of 1:1:1:1 and then mixed with 10 -4 The sample nucleic acids were mixed in a volume ratio of 1:1, so that the final concentration of each interfering substance was 0.9% sodium chloride, 10 μg / mL heme, 20 μg / mL purified mucin, 20% (v / v) anhydrous ethanol, 5 μL of commercial sample lysate was added to 5 μL of nucleic acid and tested on the machine. The reaction system and reaction procedure were consistent with 1. Optimization of betaine concentration.

[0141] Table 10

[0142]

[0143] The test results are shown in Table 10 and Figure 27-32 As shown, it can be seen that combination 1 has the best anti-interference ability.

[0144] Example 4 Detection of Anti-interference Ability of Fluorescence Quantitative PCR Reaction Solution

[0145] The fluorescence quantitative PCR reaction solution in Example 2 was used to verify the anti-interference effect. The interference factors were physiological saline, heme, purified mucin and anhydrous ethanol. The plasmid 10 in Example 1 was -7 Mix with interfering substances in a ratio of 1:1 to obtain nucleic acids containing heme at a final concentration of 10 μg / mL, nucleic acids containing purified mucin at a final concentration of 20 μg / mL, nucleic acids containing anhydrous ethanol at a final concentration of 20%, and nucleic acids containing sodium chloride at a final concentration of 0.9% (v / v). 5 μL of nucleic acid releaser and 5 μL of nucleic acid were mixed and put on the machine. The reaction system and reaction procedure were consistent with 1. Optimization of betaine concentration.

[0146] Table 11

[0147]

[0148] The detection results are shown in Table 11. It can be seen from the table that the coefficient of variation < 5%, and common interfering substances such as normal saline, heme, purified mucin, and absolute ethanol have no significant effect on the Ct value.

[0149] Example 5 A kit for detecting African swine fever

[0150] This example provides a kit for detecting African swine fever. The kit contains the fluorescence quantitative PCR reaction solution in Example 2, and the locked nucleic acid primer probes ASFV-F, ASFV-R, and ASFV-P prepared in Example 1 with a concentration of 50 pmol / µL.

[0151] The fluorescence PCR reaction system for kit detection is the same as that in Table 6 of Example 3, and the optimal concentration of betaine is 1.5 M.

[0152] The fluorescence PCR reaction cycle parameters are: 37°C for 2 min; 95°C for 2 min; then enter the cycling stage: 95°C for 10 sec, 56°C for 20 sec (collect fluorescence), for 45 cycles.

[0153] The validity determination criteria are as follows:

[0154] Positive control: Specific amplification curves appear, and the Ct value in the FAM channel ≤ 35, and the Ct value in the HEX / VIC channel ≤ 35;

[0155] Negative control: There should be no Ct value in the FAM channel, and the Ct value in the HEX / VIC channel ≤ 35;

[0156] If the above conditions are not met, this experiment is regarded as invalid, and the instrument, reagents, amplification conditions, experimental operations, etc. should be checked.

[0157] Sample result determination criteria:

[0158] 1. When the Ct value detected by FAM ≤ 40 and the Ct value detected by the HEX / VIC channel ≤ 35, it is reported as positive for African swine fever virus;

[0159] 2. When there is no Ct value detected by FAM and the Ct value detected by the HEX / VIC channel ≤ 35, it is reported as negative for African swine fever virus;

[0160] 3. When 40 < Ct value detected by FAM ≤ 45 and the Ct value detected by the HEX / VIC channel ≤ 35, it is reported as suspicious for African swine fever virus, and it is recommended to recheck, with the recheck result as the standard (re-perform nucleic acid extraction and PCR detection);

[0161] 4. When there is no Ct value detected by FAM and no Ct value or Ct value > 35 is detected in the internal standard (HEX / VIC channel), the detection result of this sample is invalid, and the reasons should be found and excluded, and this sample should be re-detected or re-sampled and then re-tested.

[0162] Example 6 Optimization of the kit system

[0163] This example optimizes the amount of primers and probes in the fluorescent quantitative PCR reaction solution in the kit and the added volume ratio of the fluorescent quantitative PCR reaction solution and the target nucleic acid.

[0164] 1. Optimization of primer and probe dosage

[0165] The difference between the fluorescent quantitative PCR reaction solution in the kit of combination 1-4 and Example 5 is that the addition ratio of primers and probes is different, as shown in Table 12. The templates used for detection are sample nucleic acids of different concentrations, and the samples are the same as those in Example 1 (4).

[0166] Sample source: Nucleic acid was extracted from pig serum samples, and the Ct value was detected using a self-prepared reaction solution, resulting in a sample with a Ct value of 24.6.

[0167] The sample with a Ct value of 24.6 was diluted 10 times to obtain a sample with a Ct value of approximately 27.9; the sample with a Ct value of approximately 27.9 was diluted 100 times to obtain a sample nucleic acid with a Ct value of approximately 34.6 as the LoD; the sample with a Ct value of approximately 34.6 was diluted 2 times to obtain a sample nucleic acid with a Ct value of approximately 35.6 as LoD / 2 for low concentration detection rate test.

[0168] Table 12

[0169]

[0170] Table 13

[0171]

[0172] The results are shown in Table 13. It can be seen from the table that the primer and probe dosage of combination 2 is obviously more effective, so the primer and probe dosage of combination 2 is selected.

[0173] 2. Optimization of the volume ratio of reaction solution to nucleic acid addition

[0174] The difference between system 1-4 and the fluorescent quantitative PCR reaction system in the kit in Example 5 (Table 6) is that the added volume ratio of the reaction solution to the nucleic acid is different, as shown in Table 14. The template used in the detection is consistent with 1. The optimization of the amount of primers and probes.

[0175] Table 14

[0176]

[0177] Table 15

[0178]

[0179] The results are shown in Table 15. It can be seen from the table that the amount of reaction solution in system 2 is obviously better, so the amount of reaction solution and nucleic acid in combination 2 is selected.

[0180] 3. Screening of reaction procedures

[0181] The detection procedure is specifically shown in Tables 16 to 18. The template used in the detection is consistent with 1. Optimization of the amount of primers and probes in Example 6, and the fluorescence quantitative PCR reaction system is consistent with Example 5. The template used in the detection is consistent with 1. Optimization of the amount of primers and probes.

[0182] Table 16 Reaction Procedure 1

[0183]

[0184] Table 17 Reaction Procedure 2

[0185]

[0186] Table 18 Reaction Procedure 3

[0187]

[0188] Table 19

[0189]

[0190] The results are shown in Table 19. It can be seen from the table that the detection rate of program 1 is obviously better, so program 1 is selected for amplification.

[0191] Example 7 Sensitivity Test

[0192] The sensitivity test was performed using the kit prepared in Example 5 and the method for using the kit.

[0193] Preparation of gradient DNA template:

[0194] ① There are 8 tubes of African swine fever virus original plasmid in Example 1, each tube has about 10μL of liquid, add 90μL of 0.01% TE-SDS to each tube, shake and mix, take 10μL from each tube into a new centrifuge tube, and form 1 tube of mixed plasmid. ② Take 10μL of the above mixed plasmid, add 990μL 0.01% TE-SDS, and mark it as 10 -2 ; ③ Take the concentration of 10 -2 10 µL of plasmid was added to 990 µL of 0.01% TE-SDS, marked as 10 -4 ④ Take the concentration of 10 -4 10 µL of plasmid was added to 990 µL of 0.01% TE-SDS, marked as 10 -6⑤ Take the concentration of 10 -6 100 µL of plasmid was added with 900 µL of 0.01% TE-SDS, marked as 10 -7 ⑥ Take the concentration of 10 -7 100 µL of plasmid was added with 900 µL of 0.01% TE-SDS, marked as 10 -8 ⑦ Take the concentration of 10 -8 100 µL of plasmid was added with 900 µL of 0.01% TE-SDS, marked as 10 -9 (i.e., the concentration is 3.125×10 -12 µg / µL, i.e. 3.125fg / mL);⑧ Take the concentration of 10 -9 500 µL of plasmid, add 500 µL of 0.01% TE-SDS, marked as 10 -9-1:1 (i.e., the concentration is 1.5625×10 -12 µg / µL, or 1.5625 fg / mL).

[0195] The above gradient DNA template was used to perform sensitivity detection using the kit prepared in Example 5 and the method for using the kit.

[0196] Table 20

[0197]

[0198] The results are shown in Table 20. It can be seen from the table that the sensitivity of the kit prepared in Example 5 is 1.5625 fg / mL.

[0199] Example 8 Specificity Test

[0200] The specific detection was performed using the kit prepared in Example 5 and the method for using the kit.

[0201] Sample source:

[0202] The genome of porcine reproductive and respiratory syndrome virus was extracted from pig serum and reverse transcribed into cDNA using Random Primer as primer. The genomes of porcine circovirus type 2, pseudorabies virus and pig liver samples were extracted and diluted to 40 ng / μL with 1×TE buffer for sample detection.

[0203] Table 21

[0204]

[0205] The results are shown in Table 21. It can be seen from the table that the kit prepared in Example 5 has good specificity.

[0206] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A fluorescent PCR detection reagent for detecting African swine fever virus, characterized in that: The fluorescent PCR detection reagent contains a primer probe set and a fluorescent quantitative PCR reaction solution; in the primer probe set, the sequences of the primers are shown in SEQ ID NO:1 and SEQ ID NO:2, and the sequence of the probe is shown in SEQ ID NO:3; the 12th nucleotide at the 3' end of the sequence of the probe is a locked nucleic acid; the fluorescent quantitative PCR reaction solution contains a stabilizer and an enhancer; the stabilizer contains betaine; the enhancer contains Triton X-100 and tetramethylammonium chloride; the betaine, the Triton X-100 and the tetramethylammonium chloride are used to resist the interference of physiological saline, hemoglobin, purified mucin and anhydrous ethanol; the fluorescent PCR detection reagent is detected by fluorescent quantitative PCR, and the reaction system used in the detection is: 。 2. The fluorescent PCR detection reagent for detecting African swine fever virus according to claim 1, characterized in that: The 5' end of the sequence of the probe is labeled with a fluorescent reporter group, and the 3' end of the sequence of the probe is labeled with a fluorescent quencher group.

3. A kit, characterized in that: The kit comprises the fluorescent PCR detection reagent for detecting African swine fever virus as described in any one of claims 1-2.

4. Use of the fluorescent PCR detection reagent for detecting African swine fever virus according to any one of claims 1 to 2 or the kit according to claim 3 in the preparation of products for detecting or assisting in the detection of African swine fever virus.

5. The use according to claim 4, characterized in that: The method for using the product for detecting or assisting in detecting African swine fever virus comprises the following steps: using the fluorescent PCR detection reagent for detecting African swine fever virus as described in any one of claims 1-2 or the kit as described in claim 3 to detect the DNA of the sample to be tested.

6. The use according to claim 5, characterized in that: The detection is performed using fluorescent quantitative PCR.

7. The use according to claim 6, characterized in that: The amplification program of the fluorescent quantitative PCR is: 35-39°C for 1-3 min; 94-96°C for 1-3 min; then enter the cycle stage: 93-96°C for 8-12 s, 55-60°C for 15-25 s, 40-50 cycles, and collect fluorescence data.

Images