Drug nanoparticle-loaded pluripotent stem cell-derived neutrophil expressing CAR and use thereof

Abstract

A neutrophil expressing a chimeric antigen receptor (CAR) and loaded with nanoparticles comprising a drug; and methods of treating cancer or other conditions in a subject comprising administering to the subject a therapeutically effective amount of a CAR-expressing neutrophil.

Description

priority

[0001] This application is related to and claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 351,906 filed on June 14, 2022 and U.S. Provisional Patent Application No. 63 / 416,026 filed on October 14, 2022. The contents of the above applications are incorporated herein by reference in their entirety. Technical Field

[0002] The present disclosure relates to neutrophils expressing a chimeric antigen receptor (CAR), which are differentiated from pluripotent stem cells engineered to express the CAR and loaded with nanoparticles containing drugs, and methods of using these neutrophils to treat cancer and other disorders. Description of Sequence Listing

[0003] A computer readable form (CRF) of the sequence listing is filed concurrently with this application. File, 69903-03_SeqListing.xml, generated on June 13, 2023, file size: 54 kilobytes, the entire contents of which are incorporated herein by reference. The contents of the computer readable form and the information recorded in the computer readable form are the same as those of the written sequence listing. background

[0004] Glioblastoma (GBM) is one of the most aggressive and lethal solid tumors in humans. GBM is characterized by poor prognosis, high recurrence rate, short life expectancy and high mortality. Yang et al., Synergistic immunotherapy of glioblastoma by dual targeting of IL-6 and CD40, Nature Communications 12: 3424 (2021); Lim et al., Current state of immunotherapy for glioblastoma, Nat'l Review Clinical Oncology 15: 422-442 (2018). The therapeutic effects of surgery and chemotherapeutic drugs may be largely hindered by specific delicate brain structures and the physiological blood-brain barrier (BBB) ​​or blood-brain tumor barrier (BBTB).

[0005] Agliardi et al.,,Intratumoral IL-12delivery empowers CAR-T cellimmunotherapy in a pre-clinical model of glioblastoma,Nature Communications12:444(2021;Németh et al.,Neutrophils as emerging therapeutic targets,NatureReviews Drug Discovery 19:253-275(2020);Subhan&Torchilin,Neutrophils as anemerging therapeutic target and tool for cancer therapy,Life Sciences 285(15):119952(2021)。

[0006] Since neutrophils have the natural ability to migrate to sites of inflammation and penetrate solid tumors through the BBB / BBTB, neutrophil-mediated delivery of nanoparticle chemotherapy drugs has been studied to enhance targeted drug delivery to brain tumors to improve therapeutic efficacy. Xue et al., Neutrophil-mediated anticancer drug delivery for suppression of postoperative malignant glioma recurrence, Nature Nanotechnology 12: 692-700 (2017); Chu et al., Photosensitization Priming of Tumor Microenvironments Improves Delivery of Nanotherapeutics via Neutrophil Infiltration, Advanced Materials 29 (27): 1701021 (2017); Wu et al., MR imaging tracking of inflammation-activatable engineered neutrophils for targeted therapy of surgically treated glioma, Nature Communications 9: 4777 (2018). However, before neutrophil / chemotherapy administration, invasive surgical resection of the tumor or activation of the tumor microenvironment (TME) is required to induce additional inflammation to recruit neutrophils, which results in limited recruitment of neutrophils in tumor sites outside the inflammatory surgical margin. Osuka & Van Meir, Cancer therapy: Neutrophils traffic in cancer nanodrugs, Nature Nanotechnology 12: 616-618 (2017). In addition, neutrophil-mediated chemotherapy drugs are mostly enriched in the spleen.

[0007] Although no necrosis was observed in major organs of mice bearing experimental brain tumors, there are still concerns about off-target tissue toxicity or even systemic toxicity in human patients. Lin et al., Roles of Neutrophils in Glioma and Brain Metastases, Frontiers in Immunology 12 (2021). In addition, the innate immunity and plasticity of neutrophils to various pathogens, including GBM, have not been well explored or neglected in these studies. Lin et al. (2021), supra; Fridlender et al., Polarization of tumor-associated neutrophil phenotype by TGF-beta: “N1” versus “N2” TAN, Cancer Cell 16(3):183-194(2009); Blaisdell et al., Neutrophils Oppose Uterine Epithelial Carcinogenesisvia Debridement of Hypoxic Tumor Cells, Cancer Cell 28(6):785-799(2015); Mahiddine et al., Relief of tumor hypoxia unleashes the tumoricidal potential of neutrophils, J Clinical Investigation 130(1):389-403(2020); Yan et al., Humanpolymorphonuclear neutrophils specifically recognize and kill cancerous cells, Oncoimmunology 3(7)(2014).

[0008] Given that previous studies have focused on mouse neutrophils, the feasibility and safety of using human neutrophils in drug delivery remains elusive, as extracting large numbers of neutrophils from preoperative patients may result in neutropenia or other risks. In addition, the intrinsic anti-tumor activity of natural neutrophils needs to be explored and, if possible, used as drug carriers in combination with chemotherapeutic drugs to promote optimal therapeutic effects.

[0009] Neutrophils circulating in the blood return to the hypoxic TME, where they become heterogeneous tumor-associated neutrophils (TANs), an important component of the immunosuppressive TME that contributes to cancer progression and tumor resistance to therapy. Lin et al. (2021), supra; Jaillon et al., Neutrophil diversity and plasticity in tumour progression and therapy, Nature Reviews Cancer 20:485-503 (2020). Similar to macrophages, anti-tumor N1 and pro-tumor N2 phenotypes of TANs have been discovered in the hypoxic TME. Li et al., Research Progress About Glioma Stem Cells in the Immune Microenvironment of Glioma, Frontiers in Pharmacology 12(2021); Gieryng et al., Immunemicroenvironment of gliomas, Laboratory Investigations 97(5):498-518(2017); Jung et al., Tumor cell plasticity, heterogeneity, and resistance in Crucial microenvironmental niches in glioma,Nature Communications 12:1014(2021);Dunnet al.,Sonabend,Emerging immunotherapies for malignant glioma:Fromimmunogenomics to cell therapy,Neuro-Oncology 22(10):1425-1438(2020).

[0010] A variety of therapeutic strategies have been developed to directly target neutrophils, mainly focusing on neutrophil depletion or inhibition, leading to multiple clinical trials (e.g., CCR5 inhibitor Maraviroc in NCT03274804). Lin et al. (2021), supra; Yee et al., Neutrophil-induced ferroptosis promotes tumor necrosis in glioblastoma progression, Nature Communications 11: 5424 (2020). However, the direct application of untreated neutrophils as nanocarriers may pose additional risks to cancer patients, where drug-carrying neutrophils may be reprogrammed to an immunosuppressive, tumor-promoting N2 phenotype within the TME after returning to the tumor site. Fridlender et al. (2009), supra; Sagiv et al., Phenotypic diversity and plasticity in circulating neutrophil subpopulations in cancer, Cell Reports 10 (4): 562-573 (2015).

[0011] Chimeric antigen receptor (CAR) modification significantly enhances the antitumor activity of immune T or natural killer (NK) cells, although their efficacy in solid tumors remains limited, partly due to their relatively low delivery and tumor penetration capabilities. Liet al.,Human iPSC-Derived Natural Killer Cells Engineered with ChimericAntigen Receptors Enhance Anti-tumor Activity,Cell Stem Cell 23(2):181-192(2018);Kim etal.,High-affinity mutant Interleukin-13targeted CAR T cellsenhance delivery of clickable biodegradable fluorescent nanoparticles toglioblastoma,Bioactive Materials 5(3):624–635(2020); Nguyen et al., Anovelligan and delivery system to non-invasively visualize and therapeutically exploit the IL13Rα2tumor-restricted biomarker, Neuro-Oncology 14(10):1239–1253(2012); Wang et al., Chlorotoxin-directed CAR T cells for specific and effective targeting of glioblastoma,Science Translational Medicine 12(533)(2020). Although effective therapeutic approaches, such as emerging CAR-T cells and chemotherapeutic drugs, have been developed for the treatment of various cancers, their efficacy in GBM treatment is largely hampered by the BBB or BBTB. Therefore, safer and more effective human neutrophil-mediated biomimetic drug delivery systems that rely primarily on the natural chemoattractant activity of GBM are urgently needed. summary

[0012] Provided are neutrophils expressing chimeric antigen receptors (CARs) loaded with nanoparticles containing drugs. Neutrophils expressing CARs can, and ideally have, differentiated from engineered pluripotent stem cells (PSCs) expressing CARs. PSCs can be human PSCs (hPSCs). HPSCs can include human embryonic stem cells (hESCs) and / or induced pluripotent stem cells (iPSCs).

[0013] The nanoparticles may include one or more rough silica nanoparticles, cytosine arabinoside-based liposomes (e.g. ), polyamidoamine (PAMAM) dendrimer-albumin nanoparticles and / or fullerene (such as gadolinium fullerenol / fullerenol). The rough silica nanoparticles can be biodegradable mesoporous organic silica.

[0014] The drug can be a prodrug (e.g., preclinical or clinical), a chemotherapeutic drug or a radiosensitizer. The prodrug can be activated by hypoxic conditions, acidic pH, an enzyme (e.g., horseradish peroxidase) or radiation. For example, the drug can be tirapazamine, temozolomide, climacostol or indole-3-acetic acid. The drug can be selected from the group consisting of everolimus, bevacizumab, belzutifan, carmustine, naxitamab-gqgk and lomustine.

[0015] The CAR of the neutrophil expressing CAR may include a neutrophil-specific transmembrane domain. The neutrophil-specific transmembrane domain may be a TLR4 polypeptide, a TLR2 polypeptide, a MET polypeptide, a granulocyte colony stimulating factor receptor (G-CSFR), a Myd88 polypeptide, a TRIF polypeptide, a Syk peptide, a CD40 polypeptide, a CD32a, a Dectin-1, an IL-6 receptor (IL6R), a FcEpsilon receptor Ig (FCER1G) polypeptide, a toll-like receptor 7 (TLR7), or a CD16 transmembrane aa CD8 polypeptide, a CD28 polypeptide, an OX40 polypeptide, an ICOS polypeptide, a CTLA-4 polypeptide, a PD-1 polypeptide, a LAG-3 polypeptide, a BTLA polypeptide, a natural killer group 2D (NKG2D), a Dectin-1, or a CD16.

[0016] CAR may comprise a 36 amino acid chlorotoxin peptide targeting glioblastoma (GBM), a CD4 transmembrane domain, and a CD3ζ intracellular domain. CAR may comprise a 36 amino acid chlorotoxin peptide targeting GBM, a C32a transmembrane domain, and a CD3ζ intracellular domain. CAR may comprise a 36 amino acid chlorotoxin peptide targeting GBM, one of the CD32a transmembrane domain or the CD16 transmembrane domain, and a CD3ζ intracellular signaling domain. CAR may comprise a 36 amino acid chlorotoxin peptide targeting GBM, one of the CD32a transmembrane domain or the CD16 transmembrane domain, and one of the CD32aγ intracellular signaling domain or the CD 16 intracellular signaling domain, and in different embodiments, may further comprise an additional CD3ζ intracellular signaling domain. The CAR of the CAR-expressing neutrophil may comprise a 36 amino acid GBM-targeting chlorotoxin peptide; one of a CD32a transmembrane domain or a CD16 transmembrane domain; and one of a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain.

[0017] CAR can contain a 36 amino acid chlorotoxin peptide targeting GBM, a NKG2D transmembrane domain, a 2B4 co-stimulatory domain, and a CD3ζ intracellular signaling domain. CAR can contain a quadruple mutant IL-13 (TQM13) T-CAR targeting IL-13 receptor α2 (IL-13Rα2), a scFV targeting GD2, a scFV targeting HER2, a scFV targeting vIII mutant epidermal growth factor receptor (EGFRvIII), or other scFVs targeting gliomas, a CD4 transmembrane domain, and a CD3ζ intracellular signaling domain.

[0018] Neutrophils can have an anti-tumor N1 phenotype. Neutrophils can exhibit anti-GBM activity in a hypoxic tumor microenvironment.

[0019] The CAR of the neutrophil can be encoded by SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or a functional variant of SEQ ID NO:2, 3 or 4.

[0020] Also provided are neutrophil-specific CAR constructs.In certain embodiments, the neutrophil-specific CAR constructs comprise one or more sequences encoding: a disease-targeting peptide, a neutrophil-specific transmembrane domain, and an intracellular domain.

[0021] The neutrophil-specific transmembrane domain may be CD32a. The neutrophil-specific transmembrane domain may be CD4. The neutrophil-specific transmembrane domain may be NKG2D, Dectin-1, IL-6 receptor or CD16. The disease-targeting peptide may be a 36-amino acid chlorotoxin targeting GBM. The intracellular domain may be a CD3ζ signaling domain. The intracellular domain may be a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain. In certain embodiments, CAR also includes a sequence encoding (i.e., additional) CD3ζ intracellular signaling domain. The construct may also include one or more sequences encoding a 2B4 costimulatory domain, for example, the intracellular domain may be a CD3ζ intracellular signaling domain.

[0022] In certain embodiments of the CAR construct, the transmembrane domain is a CD4 transmembrane domain, the intracellular domain is a CD3ζ intracellular signaling domain; and the CAR further comprises one or more sequences encoding: a quadruple mutant IL-13 (TQM13) T-CAR targeting IL-13 receptor α2 (IL-13Rα2), a single chain antibody (scFV) targeting GD2, a scFV targeting human epidermal growth factor receptor 2 (HER2), a scFV targeting vIII mutant epidermal growth factor receptor (EGFRvIII), or other scFVs targeting gliomas.

[0023] In certain embodiments, the CAR construct comprises SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or a functional variant of SEQ ID NO:2, 3, or 4.

[0024] Also provided is an engineered neutrophil cell line. In certain embodiments, the engineered neutrophil cell line comprises any CAR described herein. For example, CAR may include: a disease-targeting peptide, a neutrophil-specific transmembrane domain, and an intracellular domain. The neutrophil-specific transmembrane domain may be CD32a. The disease-targeting peptide may be a 36-amino acid chlorotoxin targeting GBM. The neutrophil-specific transmembrane domain may be a CD4 transmembrane domain. The transmembrane domain may be NKG2D, Dectin-1, IL-6 receptor, or CD16. The neutrophil-specific transmembrane domain may be a CD32a transmembrane domain or a CD16 transmembrane domain. The intracellular domain may be a CD3ζ intracellular signaling domain. In certain embodiments, the intracellular domain includes a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain. The CAR of the engineered neutrophil cell line can include one of the CD32a transmembrane domain or the CD16 transmembrane domain, and one of the CD32aγ intracellular signaling domain or the CD 16 intracellular signaling domain. CAR can also include a CD3ζ intracellular signaling domain. CAR can also include a 2B4 costimulatory domain.

[0025] In certain embodiments of the engineered neutrophil cell line, the disease-targeting peptide is a 36-amino acid chlorotoxin targeting GBM; the neutrophil-specific transmembrane domain is the CD4 transmembrane domain; the intracellular domain is the CD3ζ intracellular signaling domain; and the CAR also includes IL-13Rα2-TQM13 T-CAR, scFV targeting GD2, scFV targeting HER2, scFV targeting EGFRvIII, or other scFV targeting glioma.

[0026] Further, a pharmaceutical composition is provided. The pharmaceutical composition may include any neutrophils expressing CAR herein or neutrophils from any engineered neutrophil cell line herein; and a pharmaceutically acceptable carrier and / or diluent. The pharmaceutical composition may further include a pharmaceutically acceptable excipient.

[0027] In certain embodiments, there is provided any herein CAR-expressing neutrophils, herein engineered neutrophil cell lines, or herein pharmaceutical compositions for use in the preparation of a drug for treating a disease of a subject. The disease may be cancer (e.g., GLB). In certain embodiments, the disease is a neurological disorder (e.g., Parkinson's disease or Alzheimer's disease).

[0028] Also provided is a method for treating a subject's cancer. In certain embodiments, the method includes administering to the subject a first therapy comprising a therapeutically effective amount of any neutrophil population expressing CAR herein, a neutrophil nuclear population from any engineered neutrophil cell line herein, or a pharmaceutical composition herein; thereby the subject's cancer is treated. The cancer may be a brain cancer, such as GLB. The cancer may be prostate cancer.

[0029] Administering the first therapy may include a delivery route selected from the group consisting of intravenous, intraperitoneal, intramuscular, intradermal, subcutaneous, intrathecal, intraosseous, and any combination thereof. The first and second therapies may be administered sequentially and / or alternatingly.

[0031] The method may further include administering a second therapy to the subject. The second therapy may vary depending on the type of disease to be treated. In certain embodiments, the second therapy is and / or includes surgically removing cancer cells from the subject. Additionally or alternatively, the second therapy may include chemotherapy, radiotherapy, or both.

[0032] In certain embodiments, the method of treating cancer further comprises imaging the subject's cancer prior to or during administration of the first and / or second therapy.

[0033] Also provided is a method of delivering a therapeutic agent to a target location in a subject with a disease. In certain embodiments, this method includes administering a first therapy to a subject, the first therapy including a therapeutically effective amount of: any cell population of neutrophils expressing CAR herein; a neutrophil population from any engineered neutrophil cell line herein; or any pharmaceutical composition herein, wherein the target location passes through the subject's blood-brain barrier relative to the site of administration.

[0034] The disease may be cancer, such as brain cancer. The disease may be GLB. The disease may be a nervous system disorder. The nervous system disorder may involve protein aggregation of proteins that are prone to aggregation. The nervous system disorder may be a tauopathy. The nervous system disorder may be Alzheimer's disease or Parkinson's disease.

[0035] In certain embodiments, the method of delivering a therapeutic agent to a target location further comprises administering a second therapy to the subject.

[0036] The second therapy may include surgically removing cancer cells from the subject (e.g., wherein the disease is cancer). The second therapy may include chemotherapy, radiotherapy, or both. The method may also include imaging a target location in the subject before or during administration of the first and / or second therapy. The target location may include brain tissue. The second therapy may include a microtubule stabilizer. The first and second therapies may be administered sequentially and / or alternately. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The embodiments disclosed herein and other features, advantages and aspects included therein and their attainment will become apparent from the following detailed description of various exemplary embodiments of the present disclosure, which can be better understood in conjunction with the accompanying drawings.

[0038] Figure 1A and 1B Schematic diagram of the use of chimeric antigen receptor (CAR)-neutrophil and tumor microenvironment-responsive nanoprodrug combination immunotherapy to enhance anti-glioblastoma efficacy. Figure 1A Show that human pluripotent stem cells are engineered with CAR and differentiated into CAR-neutrophils for targeted nanoprodrug delivery, Figure 1B We show that CAR-neutrophil@R-SiO2-TPZ NPs loaded with hypoxia-targeting tirapazamine (TPZ) exhibit significantly enhanced anti-glioblastoma efficacy via combined CAR-neutrophil-mediated direct tumor killing and tumor microenvironment (TME)-responsive nanoprodrugs.

[0039] A-2F shows the results of screening for CAR structures with enhanced neutrophil-mediated anti-tumor activity, where Figure 2A This is a schematic diagram of various CAR structures. Figure 2B Schematic diagram of the CAR#1 construct and the targeted knock-in strategy at the AAVS1 safe harbor locus in human pluripotent stem cells (hPSCs) (vertical arrows indicate AAVS1-targeting sgRNAs, horizontal arrows indicate primers used to determine targeting efficiency and homozygosity, Figure 2C Schematic diagram of optimized neutrophil differentiation from hPSCs under chemically defined conditions. Figure 2D Graphical data showing cytotoxicity assays against U87MG glioblastoma cells using the indicated neutrophils at different ratios of neutrophils to tumor targets (data are presented as mean ± SD of five independent replicates, *p < 0.05), Figure 2E and 2F Shows the reactive oxygen species (ROS) production of different neutrophils after co-culture with U87MG cells ( Figure 2E ) and ELISA analysis of tumor necrosis factor α (TNFα) release ( Figure 2F ).

[0040] Figures 3A-3E Data showing that CAR neutrophils, but not primary neutrophils, maintain superior antitumor activity in the immunosuppressive tumor microenvironment, including Figure 3AData are shown for cytotoxicity assays against U87MG glioblastoma cells using CAR-neutrophils or peripheral blood (PB) neutrophils at different ratios of neutrophils to tumor target under the indicated conditions. Figure 3B Shows the generation of ROS, Figure 3C Shown is an ELISA analysis of TNFα release from different CAR- or PB-neutrophils after co-culture with U87MG cells under the indicated conditions. Figure 3D and 3E Flow cytometric analysis of arginase and inducible nitric oxide synthase (iNOS) expression on CAR- or PB-neutrophils under the indicated conditions is shown. Figure 3D Shown and in Figure 3E Medium quantitative.

[0041] Figures 4A-4L The preparation and characterization of hPSC CAR-neutrophils loaded with SiO2 nanoparticles containing tirapazamine (TPZ) are shown, wherein Figure 4A and 4B The rough SiO2 nanoparticles were shown in transmission electron microscopy (TEM) ( Figure 4A ) and elemental mapping images under energy dispersive spectroscopy (EDS) ( Figure 4B ), Figure 4C shows nitrogen adsorption-desorption isotherm data from rough silica nanoparticles and Barrett-Joyner-Halenda (BJH) pore size distribution plots, Figure 4D and 4E Figure 2 shows the TPZ loading content in SiO2 nanoparticles measured at the indicated time ( Figure 3D ) and glutathione (GSH)-responsive TPZ release ( Figure 4E ), Figure 4F and 4G Fluorescence images showing neutrophils loaded with smooth and rough SiO2-TPZ ( Figure 4F ) and flow cytometry analysis data ( Figure 4G ), Figure 4H Cellular SiO2 content measured in hPSC-derived CAR-neutrophils is shown. Figures 4I-4M The cell viability of hPSC-derived CAR-neutrophils loaded or not with rough SiO2-TPZ is shown ( Fig. 4I ),migrate( Figure 4J ), chemical attraction ability ( Figure 4K-4L ) and ROS production capacity ( Figure 4M ).

[0042] Figures 5A-5FSupporting data showing that CAR-neutrophils loaded with R-SiO2-TPZ nanoparticles effectively killed glioblastoma cells, where Figure 5A Representative images showing immune synapses indicated by polarized F-actin accumulation at the interface between CAR-neutrophils and tumor cells at 6, 12, and 24 hours, demonstrating that R-SiO2-TPZ nanoparticles released by CAR-neutrophils are taken up by tumor cells after engulfment of tumor cells. Figure 5B is a schematic diagram of the neutrophil-mediated antitumor cytotoxicity assay. Figure 5C-5E Displayed in 24 hours ( Figure 5C )、48 hours( Figure 5D ) and 72 hours ( Figure 5E ) Results of cytotoxicity studies on U87MG glioblastoma cells using the indicated neutrophils at different ratios of neutrophils to tumor targets ( Figure 5E The character descriptions in the Figure 5C-5E ), Fig. 5F Shown is a heat map of bulk RNA sequencing analysis of U87MG cells under various conditions, showing the expression levels of selected cytoplasmic, membrane, oxidative stress, apoptosis, and proliferation-related genes in the indicated glioblastoma cells.

[0043] Figures 6A-6I Data showing the functional evaluation of CAR-neutrophils loaded with R-SiO2-TPZ nanoparticles using a glioblastoma (GBM) microenvironment mimicking model in vitro, where Fig. 6A is a schematic diagram of the GBM in vitro tumor model with blood-brain barrier (BBB), Figure 6B The data of Transwell migration analysis of neutrophils at 12 hours are shown. Figure 6C Data are shown from the indicated neutrophil anti-GBM cytotoxicity studies, where cytotoxicity was measured and quantified at 24 hours. Fig.6D It is an enzyme-linked immunosorbent assay (ELISA) analysis of interleukin-6 (IL-6) and TNFα released by designated neutrophils at 36 hours. Fig. 6E Data from a second migration analysis of different neutrophils at 48 hours are shown. Fig. 6F Data are shown for the indicated neutrophil anti-GBM cytotoxicity assays, where cytotoxicity was measured and quantified at 60 hours. Figure 6G is a schematic diagram of a three-dimensional (3D) tumor model of neutrophil infiltration in vitro. Figure 6H Representative fluorescent images showing infiltrating neutrophils in a 3D tumor model (4'6-diamidino-2-phenylindole (DAPI) was used to stain cell nuclei and CD45 was used to stain neutrophils; scale bar, 200 μm). Fig.6I Data related to the corresponding tumor killing ability of the indicated neutrophils measured and quantified using a cytotoxicity kit are shown (data are expressed as the mean ± SD of five independent replicates, *p < 0.05). Figure 6B-6F The data are labeled as follows: A–CAR hPSC-neutrophils@R-SiO2 TPZ; B–CAR hPSC-neutrophils; C–PB neutrophils@R-SiO2-TPZ; D–PB neutrophils; E–R-SiO2-TPZ.

[0044] Figures 7A-7D In vivo distribution study of CAR neutrophil-delivered R-SiO2-TPZ nanoparticles (NPs), in which Fig. 7A Schematic diagram of intravenous injection of Cy5-labeled CAR neutrophils@R-SiO2 NPs and R-SiO2 NPs for in vivo cell tracking studies, where 5×10 5 Luciferase (Luci)-expressing U87MG cells were stereotaxically implanted into the right forebrain of NRG mice. Four days later, mice were intravenously injected with phosphate-buffered saline (PBS), 5×10 6 Cy5-labeled CAR Neutrophils@R-SiO2NP and R-SiO2 NP. The time-dependent biodistribution of Cy5+ neutrophils in the whole body, brain, and other organs was determined and quantified by fluorescence imaging at the indicated time ( Figure 7B ), Figure 7C Quantitative data related to the biodistribution of CAR-neutrophil@R-SiO2 NP and R-SiO2 NP in mice 24 h after injection were shown, analyzed by Si element-based coupled plasma optical emission spectrometry (ICP-OES), and the data are expressed as the percentage of injected dose per gram of tissue (%ID / g). Fig.7D Representative fluorescent images of CD45 and SiO2 in the indicated GBM xenografts isolated from tumor-bearing mice (scale bar, 100 μm).

[0045] Figures 8A-8E In vivo antitumor activity involving combined CAR neutrophils and R-SiO2-TPZ NPs assessed by intravenous injection. Fig. 8A Schematic diagram of intravenously administered PB neutrophils, PB neutrophil@R-SiO2-TPZ NPs, R-SiO2-TPZ NPs, CAR neutrophils, and CAR neutrophil@R-SiO2-TPZ NPs for in vivo tumor killing studies, where 5×10 5 Luciferase (Luci)-expressing U87MG cells were stereotaxically implanted into the right forebrain of NRG mice. Four days later, mice were intravenously injected with the indicated neutrophils weekly for one month. Figure 8B Images of NRG mice are shown to determine time-dependent tumor burden. Figure 8C Shown are the quantifications by bioluminescence imaging (BLI) on the indicated days. Figure 8B Data are the mean ± SD of mice in (B) (n = 5). Fig.8D is a Kaplan-Meier curve demonstrating the survival rate of a given experimental group, Fig. 8E and 8F Figure 2 shows the release of human TNFα and IL-6 in peripheral blood measured on the indicated days in different mouse groups. Fig. 8E ) and weight ( Figure 8F ) related graphic data.

[0046] Figures 9A-9F Genotyping studies involving CAR-engineered hPSCs. Figures 9A-9D is a gel image showing the effect of CAR#1 ( Fig. 9A )、CAR#2( Fig. 9B )、CAR#3( Fig. 9C ) and CAR#4( Fig.9D ) Genotyping data of hPSC clones from a single cell after puromycin selection, where the expected polymerase chain reaction (PCR) product correctly targeting the AAVS1 locus is 991 bp (indicated by the arrow and "991 bp"), and the knock-in clones were assayed for homozygosity, and those clones without the ~240 bp PCR product were homozygous (indicated by the arrow and "204"). Fig.9E and 9F Reverse transcriptase (RT)-PCR showing CLTX-IgG4 CAR expression in wild-type and CAR knock-in hPSCs ( Fig.9E ) and flow cytometry ( Fig.9F )Analysis results.

[0047] Fig.10 Flow cytometry data of CAR-neutrophils from various hPSCs are shown, with graphs showing unstained control (black and gray shading) and specific antibody (red and unshaded) histograms.

[0048] Fig.11A Graphical data related to the cytotoxic capacity of PB or CAR-neutrophils against the indicated tumor cells at an effector-target ratio of 10:1 are shown. U87MG cell lines, primary adult GBM43, and pediatric SJ-GBM2 cells were used to kill GBM cells. Data are presented as mean ± SD of five independent replicates.

[0049] Fig. 11BData are shown for quantification of cell survival of CAR neutrophils when incubated with normal SVG p12 glial cells, H9 hPSCs, hPSC-derived mesoderm, endoderm, and ectoderm at a neutrophil to target ratio of 10:1. Data are presented as mean ± SD of five independent replicates.

[0050] Fig. 12A is a TEM image of smooth (S-SiO2) silica NPs.

[0051] Fig. 12B are the nitrogen adsorption-desorption isotherm data and BJH pore size distribution diagram of S-SiO2 NP.

[0052] Fig. 12C is a graph of the measured TPZ loading content in SiO2 NPs.

[0053] Fig.12D is a TEM image of rough (R-SiO2) silica NPs.

[0054] Fig.12E is a graph of the measured hydrodynamic sizes of S-SiO2 NPs, S-SiO2-TPZ NPs, R-SiO2 NPs, and R-SiO2 silica NPs.

[0055] Fig.12F is a graph of the hydrodynamic size of TPZ containing R-SiO2 NPs (R-SiO2-TPZ NPs) measured in the presence of 10 mM GSH and at the indicated time points.

[0056] Figure 12G is the TEM image of R-SiO2-TPZ NPs incubated with 10 mM GSH for 50 h.

[0057] Fig.13 is the flow cytometry data of CD11b expression of CAR neutrophils before and after loading with R-SiO2-TPZ NPs.

[0058] Fig.14 It is the data related to the number of immune synapses formed between the specified neutrophils and tumor cells / normal somatic cells.

[0059] Figures 15A-15C Involving the stability of R-SiO2-TPZ NPs within CAR neutrophils. Fig.15A Schematic diagram of the experimental design to study the stability of R-SiO2-TPZ NPs within CAR neutrophils after loading. Fig. 15B is the relative TPZ intensity measured before and after centrifugation. Fig. 15Care flow cytometry data of the cellular content of R-SiO2-TPZNPs within tumor cells after co-culture with CAR-neutrophil@R-SiO2-TPZ NPs.

[0060] Fig.16A is a volcano plot of bulk RNA-Seq analysis of U87MG cells under indicated treatments. Fig. 16B and 16C Tumor lysis measurements of the indicated groups treated with 5 μM cytochalasin D (CytoD) or 5 mM N-acetylcysteine ​​(NAC), respectively, are shown.

[0061] Fig.17A are data related to the measured amounts of loading contents of temozolomide (TMZ) and JNJ64619187 in R-SiO2 NPs.

[0062] Fig. 17B is a schematic diagram of a 3D tumor model with neutrophil infiltration.

[0063] Fig. 17C is a graph of the quantitative, corresponding tumor killing ability of the indicated neutrophils, which were measured and quantified using a cytotoxicity kit (data are presented as mean ± SD of five independent replicates).

[0064] Fig.18 H&E images of major organs collected at the end of treatment (scale bar, 200 μm).

[0065] Fig.19A Schematic diagram of positron emission tomography (PSMA)-CAR design and knock-in strategy at the endogenous AAVS1 safe harbor locus via Cas9-mediated homology-directed repair (HDR). PSMA-CAR can be composed of a signal peptide, anti-PSMAJ591 scFV or nanobody, IgG4 Fc (EQ), CD4 transmembrane (tm), and CD3ζ (CD3z).

[0066] Fig.19B Figure 2 is a gel image of genotyping of CAR knock-in in hPSCs with on-target efficiencies of 12 out of 13 clones and 13 out of 15 clones, respectively.

[0067] Fig.19C is a graph of the cytotoxicity of CAR-neutrophils co-cultured with U87MG GBM and LNCaP prostate cancer cells at the indicated cell ratios for 16 hours.

[0068] Fig.19Dis a schematic diagram of the study protocol, which includes testing the enhanced anti-tumor cytotoxicity of anti-PSMAJ591 CAR-neutrophils loaded with SiO2-TPZ nanodrugs in a hypoxic tumor model in vitro, and the data related to such cytotoxicity measured at the indicated times.

[0069] Fig. 20A and 20B show Figures 8A-8F Antitumor activity with increasing dose frequency of CAR-neutrophils and R-SiO2-TPZ NPs studied is shown. Fig. 20A B is a Kaplan-Meier curve demonstrating the survival rate of the designated experimental groups (n=5) (Kaplan-Meier curve was analyzed by log-rank test).

[0070] While the disclosure is susceptible to various modifications and alternative forms, exemplary embodiments thereof have been shown by way of example in the drawings and are herein described in detail. Detailed Description

[0071] Although the concepts of the present disclosure are shown and described in detail in the description herein, the results in the description should be regarded as illustrative rather than restrictive; it should be understood that only exemplary embodiments are shown and described and that all changes and modifications consistent with the spirit of the present disclosure are desired to be protected.

[0072] In view of its innate immunity to pathogens and its natural ability to cross physiological barriers, the present disclosure provides human neutrophils engineered with synthetic chimeric antigen receptors (CAR). Neutrophils expressing CAR can provide improved direct anti-tumor cell lysis and enhanced non-invasive glioblastoma (GBM) targeted delivery of nanoparticle chemotherapy drugs without the need for additional inflammation-induced chemotaxis. Primary neutrophils have a short life span and cannot be genetically modified, which generally limits their wide application in CAR-directed immunotherapy. Roberts et al., Antigen-specific cytolysis by neutrophils and NK cells expressing chimeric immune receptors bearing zetaor gamma signaling domains, J Immunology 161 (1): 375-384 (1998). On the other hand, human pluripotent stem cells (hPSC) are more susceptible to gene editing, can be differentiated into neutrophils on a large scale, and can provide unlimited high-quality CAR-neutrophil sources for targeted immunotherapy under chemically defined, xeno-free conditions. Chang et al., Engineering chimeric antigen receptor neutrophils from human pluripotent stem cells for targeted cancer immunotherapy, Cell Reports 40(3)(2022).

[0073] The present disclosure utilizes the ability of self-renewal hPSC, allowing the production of unlimited de novo (de novo) human neutrophils expressing CAR, to provide a powerful, biomimetic neutrophil-mediated drug delivery system by CAR-engineering. Neutrophil-specific CAR expression constructs are provided, as well as neutrophils expressing CAR. In certain embodiments, there is provided a neutrophil (or CAR neutrophil) loaded with nanoparticles (e.g., comprising a drug) expressing CAR. The term "CAR neutrophil" refers to a neutrophil modified by a molecular biological method to express CAR on the surface of a neutrophil. The use of engineered CAR-neutrophils as nanocarriers (e.g., nanocarriers of drugs) is also provided. This engineered CAR-neutrophil can have significant anti-tumor activity and, in certain embodiments, can be used to treat and, optionally targeting, various disease states, including GBM.

[0074] CAR constructs and CAR-expressing neutrophils

[0075] In view of the above, a neutrophil-specific CAR expression gene construct and CAR-expressing neutrophils loaded with nanoparticles are provided.

[0076] CAR can be any suitable CAR known in the art. CAR is an artificially constructed hybrid receptor protein or polypeptide, and any specificity can be transplanted to immune effector cells, such as NK cells. See, for example, Sadelain et al., "The Basic Principles of Chimeric Antigen Receptor Design," Cancer Discovery OF1-11 (2013). Non-limiting examples of complementary determining regions (CDRs) include, but are not limited to, CD19 (USPN 7,446,190; and USPAPN2013 / 0071414)), HER2 (Ahmen et al., Clin Cancer Res (2010)), MUC16 (Chekmasova et al. (2011)), and PSMA (Zhong et al., Molec Ther 18 (2); 413-410 (2010)). CAR can have predefined binding specificity to the desired target, such as matrix metallopeptidase 2 (MMP2), such as MMP2 on glioma, such as GBM. The terms "polypeptide", "peptide" and "protein" are used interchangeably herein (unless otherwise expressly stated) to refer to a polymer, polypeptide, or fragment, peptide or fusion polypeptide of an amino acid residue. The term is applicable to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers.

[0077] In general, CAR is a fusion protein that may include a recognition region, a costimulatory domain, various signaling domains, a costimulatory domain, a spacer and / or a hinge. Desirably, CAR is suitable for treating cancer using CAR neutrophils, for example, CAR binds to cell surface antigens on cancer cells with high specificity.

[0078] In certain embodiments, CAR is encoded by SEQ ID NO:2 or a functional variant thereof. In certain embodiments, CAR is encoded by SEQ ID NO:3 or a functional variant thereof. In certain embodiments, CAR is encoded by SEQ ID NO:4 or a functional variant thereof. The term "functional variant" refers to a CAR, polypeptide or protein having substantial or significant sequence identity or similarity with the CAR, and the functional variant retains the biological activity of the CAR of which it is a variant. Functional variants encompass, for example, variants of the CAR (parent CAR), which retain the ability to recognize target cells similar to, identical to or higher than the parent CAR. With regard to the nucleic acid sequence encoding the parent CAR, in some embodiments, the nucleic acid sequence encoding the functional variant of CAR is about 10% identical, about 25% identical, about 30% identical, about 50% identical, about 65% identical, about 80% identical, about 90% identical, about 95% identical, or about 99% identical to the nucleic acid sequence encoding the parent CAR.

[0079] The use of terms and phrases regarding CAR binding specificity, such as "specifically binds," "binds with high affinity," "binds with high specificity," or "specifically" or "selectively" binds, refers to a binding reaction between a CAR on a neutrophil, such as a CAR comprising CLTX, and a target molecule, such as a protein (e.g., a receptor, an enzyme (e.g., MMP2), or a cell surface marker) present on a target cell, such as a cancer cell (e.g., a cell that makes up a tumor) or other diseased cell. Thus, under binding conditions that facilitate, promote, or otherwise cause the CAR neutrophil to bind to a target molecule present on a target cell, such as a cancer cell or other diseased cell, such a CAR neutrophil will not significantly bind to other molecules, if any, such as proteins (e.g., receptors, enzymes, and cell surface markers) present on normal, healthy cells. Specific binding or binding with high affinity can be at least 25% higher, more typically at least 50% higher, most typically at least 100% higher (2-fold), often at least 10-fold higher, more typically at least 20-fold higher, and most typically at least 100-fold higher than the binding of any other non-targeted molecule.

[0080] In certain embodiments, the CAR herein binds cancer cells (e.g., brain cancer cells) with high specificity. In certain embodiments, the CAR herein binds to amyloid beta with high specificity (e.g., for targeting / treating neurological disorders). CAR can be designed, for example, to target amyloid beta (e.g., soluble oligomers of amyloid-β peptide (AβO)). Since the accumulation of AβO in the brain is related to synaptic failure and memory impairment in Alzheimer's disease, targeting such AβO can be used to effectively deliver nanoparticles / drugs thereto, for example, to treat Alzheimer's disease and / or symptoms associated therewith. Selles et al., AAV-mediated neuronal expression of an scFv antibody selective for Aβoligomers protects synapses and rescues memory in Alzheimer models, Molecular Therapies 31(2): 409-419(2023). In certain embodiments, CAR may include a NUsc1 single-chain antibody (scFv) selectively targeting an AβO group in a subject.

[0081] CAR may include an extracellular domain, a transmembrane domain and an intracellular domain. The extracellular domain may include an antigen binding / recognition region / domain and / or an scFv derived from an antibody for targeting. The antigen binding domain of CAR may be combined with a specific antigen, such as a cancer / tumor antigen (e.g., for treating cancer), a pathogenic antigen, such as a viral antigen (e.g., for treating viral infection), or a CD4+ antigen.

[0082] Examples of tumor antigens include, but are not limited to, carbonic anhydrase IX (CAIX), carcinoembryonic antigen (CEA), CD5, CD7, CD10, CD19, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD123, CD133, CD138, antigens of cytomegalovirus-infected cells (e.g., cell surface antigens), epithelial glycoprotein 2 (EGP2), epithelial glycoprotein 40 (EGP40), epithelial cell adhesion molecule ( EpCAM), receptor tyrosine protein kinase erb-B2, 3 or 4, folate binding protein (FBP), fetal acetylcholine receptor (AChR), folate receptor α (FRα), folate receptor β (FRβ), ganglioside G2 (GD2), ganglioside G3 (GD3), human epidermal growth factor receptor 2 (HER2), human telomerase reverse transcriptase (hTERT), interleukin 13 (IL-13) receptor subunit α2 (IL-13Rα2), kappa light chain, kinase insert domain receptor (IDR), Lewis a (CA19.9), Lewis Y (LeY), L1 cell adhesion molecule (L1CAM), melanoma antigen family A1 (MAGE-A1), mucin 16 (Muc-16), mucin 1 (Muc-1), mesothelin (MSLN), natural killer group 2D (NKG2D) ligand, cancer testis antigen NY-ESO-1, carcinoembryonic antigen (h5T4), prostate stem cell antigen (PSCA), prostate specific membrane antigen (PSMA), tumor-associated glycoprotein 72 (TAG-72), vascular endothelial growth factor receptor (VEGF-R, such as R2), and Wilms tumor protein (Wt-1).

[0083] Some CARs are fusions of binding functions (e.g., scFv derived from monoclonal antibodies) with CD3ζ (CD3ζ) transmembrane and intracellular domains. Such molecules can lead to the transmission of ζ signals after being recognized by the recognition receptor binding function of their targets. However, there are many alternatives. As a non-limiting example, the antigen recognition domains of natural T cell receptors (TCR) α and β single chains can be used as binding functions. Alternatively, a receptor extracellular domain (e.g., CD4 extracellular domain) can be used. All that is required for the binding function is that it can bind to a given target with high affinity in a specific manner.

[0084] In certain embodiments, CAR includes a neutrophil-specific transmembrane domain. Examples of neutrophil-specific transmembrane domains include, but are not limited to, TLR4 polypeptides, TLR2 polypeptides, MET polypeptides, granulocyte colony stimulating factor receptors (G-CSFR), Myd88 polypeptides, TRIF polypeptides, Syk peptides, CD40 polypeptides, CD32a, Dectin-1, IL-6 receptors (IL6R), FcEpsilon receptor Ig (FCER1G) polypeptides, toll-like receptor 7 (TLR7) or CD16 transmembrane aa CD8 polypeptides, CD28 polypeptides, OX40 polypeptides, ICOS polypeptides, CTLA-4 polypeptides, PD-1 polypeptides, LAG-3 polypeptides and BTLA polypeptides. In certain embodiments, the neutrophil-specific transmembrane domain is CD32a. In certain embodiments, the neutrophil-specific transmembrane domain is CD4. In certain embodiments, the neutrophil-specific transmembrane domain is NKG2D, Dectin-1, IL-6 receptor or CD16.

[0085] The intracellular domain may include, for example, a CD3ζ polypeptide, and may further include at least one co-stimulatory signaling region including at least one co-stimulatory molecule."Co-stimulatory molecule" refers to a cell surface molecule or receptor different from the antigen receptor / ligand required for the effective response of lymphocytes to antigens. The co-stimulatory signaling region may include a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP-10 polypeptide, a PD-1 polypeptide, a LAG-3 polypeptide, a 2B4 polypeptide, a BTLA polypeptide, or a CTLA-4 polypeptide. Neutrophil-specific intracellular domains may also be used, which may be derived from FCER1G, CD32a, Dectin-1, IL6R, TLR4, or TLR2.

[0086] CAR can be produced by any method known in the art, although it is preferably produced using recombinant DNA technology. The nucleic acid sequences encoding several regions of CAR (ie, CAR constructs) can be prepared and assembled into complete coding sequences by standard techniques of molecular cloning and / or genetic engineering techniques (genomic library screening, PCR, primer-assisted ligation, site-directed mutagenesis, and gene editing techniques, such as CRISPR, etc.). Such techniques are generally known in the art (e.g., see Sambrook et al., "Molecular Cloning: A Laboratory Manual," 3 rd ed., Cold Spring Harbor Laboratory Press (2001); and Green and Sambrook, "Molecular Cloning: ALaboratory Manual," 4th ed., Cold Spring Harbor Laboratory Press (2012), both of which are expressly incorporated herein by reference for their teachings of such techniques) and / or are exemplified herein.

[0087] The resulting coding region can be inserted into an expression vector for subsequent introduction into a recipient cell, such as hPSC. The term "vector" refers to any nucleic acid having the function of carrying, accommodating or expressing a nucleic acid of interest. Nucleic acid vectors can have specialized functions, such as expression, packaging, pseudotype production or transduction. If suitable for use as a cloning or shuttle vector, the vector may also have a manipulation function. The structure of the vector may include any desired form that is manufacturable and suitable for a particular purpose. This form may include, for example, a circular form, such as a plasmid and a phagemid, and a linear or branched form. Nucleic acid vectors may consist of, for example, DNA or RNA, and may contain nucleotide derivatives, analogs or mimetics in part or in whole. Such vectors may be obtained from natural sources, recombinantly produced or chemically synthesized.

[0088] As a non-limiting example, a plasmid or viral expression vector (e.g., a lentiviral vector, a retroviral vector, Sleeping Beauty and piggyback (including a transposon / transposase system for a non-viral mediated CAR gene delivery system)) can be prepared to encode a fusion protein (i.e., a CAR construct) comprising a recognition region, one or more co-stimulatory domains and an activation signaling domain, which are fused in frame and linked in a 5' to 3' direction.

[0089] CAR expression can be driven using any suitable promoter, as exemplified herein. Examples of promoters include, but are not limited to, various constitutive and inducible promoters, such as constitutive CAG promoter, EF1a promoter, UBC constitutive promoter or Teton-3G inducible promoter.

[0090] The position of the recognition region in the fusion protein / construct usually causes the region to be displayed on the outside of the neutrophil. Where necessary, CAR may also include additional elements, such as a signal peptide (such as a CD8α signal peptide) to ensure that the fusion protein is correctly exported to the cell surface; a transmembrane domain to ensure that the fusion protein remains an intact membrane protein (such as a CD3ζ transmembrane domain); and a hinge domain that gives the recognition region flexibility and allows strong binding to the targeting portion.

[0091] T- and NK-cell-specific CAR constructs have been widely used to enhance the antitumor activity of T and NK cells, but neutrophil-specific CARs that improve the antitumor function of neutrophils have not been previously described. It has been previously reported that CD4ζ and CD4γ chimeric immunoreceptors can enhance cytolysis of HIVev-transfected cells by human neutrophils in vitro, but the lysis efficiency is only about 10% at an effector-target (E:T) ratio of 10:1. Roberts et al. (1998), supra. FcγRⅡA (CD32a) is a low-affinity single-chain transmembrane receptor for monomeric immunoglobulin G (IgG) that is highly expressed in neutrophils (30,000 to 60,000 molecules / cell), and its ligation in neutrophils induces Fcγ-dependent functions, such as release of granule contents, Ca 2+ Mobilization, antitumor cytotoxicity, and phagocytosis. Wang& Expression, role, and regulation of neutrophil Fcγreceptors, Frontiers Immunology 10 (2019); Nagarajan et al., Cell-specific, activation-dependent regulation of neutrophil CD32Aligand-binding function, Blood 95(3):1069-1077(2000).

[0092] In view of the prominent role of CD32a in the activation and function of neutrophils, in certain embodiments, a CAR construct based on CD32a is provided. As described in the following examples, this CAR construct has been screened and optimized, and the results show that when expressed in hPSC-derived neutrophils, CD3ζ can mediate significantly better cytolysis than CD32aγ. This may be partly due to the higher copy number of ITAM in CD3ζ than CD32aγ: 3 and 1 copies, respectively, and the higher expression level of ζ on the surface of neutrophils than γ. Roberts et al. (1998), supra.

[0093] Similar to CD32a, FcγRIII (CD16b) is another low-affinity receptor for monomeric IgG that is expressed on neutrophils at much higher levels than CD32a. Although crosslinking of CD16b induces only Ca 2+Mobilization and degranulation without inducing phagocytosis and cytolysis, but a systematic comparison of the ability of CD3ζ- and CD16bγ-CARs to trigger and enhance the anti-tumor function of neutrophils may be necessary. Roberts et al. (1998), supra; Fanger et al., Cytotoxicity mediated by human Fc receptors for IgG, Immunology Today 10(3):92-99(1989); Wang & (2019), ibid.

[0094] In certain embodiments, the CAR construct may include an antigen recognition domain containing a disease targeting peptide or a fragment thereof, for example, for a tumor-associated antigen, such as to promote binding affinity to a targeted disease site. In this way, neutrophils expressing the CAR construct herein can be used to target a specific site (e.g., TME) within a subject, which can reduce or eliminate the off-target effect of the drug thus carried. The antigen recognition domain of CAR can be a complete antibody or an antibody fragment (e.g., scFv). The peptide targeting disease can be, for example, a peptide targeting cancer, such as a peptide targeting GBM or a functional fragment thereof. The peptide targeting disease can be, for example, a peptide targeting fibrosis, such as fibroblast activation protein (FAP) or a functional fragment thereof. The terms "antibody fragment", "antibody fragment", "functional fragment of an antibody" and "antigen binding portion" are used interchangeably herein, referring to one or more fragments or portions of an antibody that retain the ability to specifically bind to an antigen.

[0095] In certain embodiments, the CAR construct is an anti-GBM CAR construct comprising a T or neutrophil-specific signaling domain (e.g., an anti-GBM chlorotoxin (CLTX)-CAR construct). Such anti-GBM CAR constructs can be optimized, and genetically engineered hPSCs with optimized CARs can be screened by CRISPR / Cas9-mediated gene knock-in at the AAVS1 safe harbor locus as described in the following examples, and CAR constructs optimized for neutrophil-mediated tumor killing are determined, Wang et al. (2020), supra.

[0096] In certain embodiments, the CAR construct encodes a neutrophil-specific transmembrane domain. The neutrophil-specific transmembrane domain may be CD32a. The neutrophil-specific transmembrane domain may be CD4. The neutrophil-specific transmembrane domain may be CD32a. The neutrophil-specific transmembrane domain may be NKG2D, Dectin-1, IL-6 receptor, or CD16.

[0097] In various embodiments herein, for example, when neutrophils expressing CAR are used to treat GBM, CAR may include a peptide targeting GBM, such as a 36 amino acid chlorotoxin (CLTX) peptide targeting GBM. In these embodiments, a peptide targeting GBM (e.g., a 36 amino acid chlorotoxin peptide targeting GBM) is coupled to a CD4 transmembrane domain and a CD3 ζ intracellular domain, so that CAR includes 36 amino acids of chlorotoxin peptide targeting GBM, CD4 transmembrane domain, and CD3 ζ intracellular domain. In other embodiments, a peptide targeting GBM (e.g., a 36 amino acid chlorotoxin peptide targeting GBM) is coupled to any one of (i) CD32a transmembrane domains or CD16 transmembrane domains and (ii) CD3 ζ intracellular signaling domains, so that CAR includes (i) 36 amino acids of chlorotoxin peptide targeting GBM, (ii) CD32a transmembrane domains or CD16 transmembrane domains, and (iii) CD3 ζ intracellular signaling domains. In yet other embodiments, a GBM targeting peptide (e.g., a 36 amino acid GBM targeting chlorotoxin peptide) is coupled to (i) either a CD32a transmembrane domain or a CD16 transmembrane domain and (ii) a CD3ζ intracellular signaling domain, such that the CAR comprises (i) a 36 amino acid GBM targeting chlorotoxin peptide, (ii) a CD32a transmembrane domain or a CD16 transmembrane domain, and (iii) a CD3ζ intracellular signaling domain. In yet other embodiments, a GBM targeting peptide (e.g., a 36 amino acid GBM targeting chlorotoxin (CLTX) peptide) is coupled to (i) either a CD32a transmembrane domain or a CD16 transmembrane domain and (ii) either a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain, alone or further in combination with (iii) a CD3ζ intracellular signaling domain, such that the CAR comprises (i) a 36 amino acid GBM targeting chlorotoxin peptide, (ii) either a CD32a transmembrane domain or a CD16 transmembrane domain, and (iii) either a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain, alone or further in combination with (iv) a CD3ζ intracellular signaling domain. In even other embodiments, a GBM-targeted peptide (e.g., a 36 amino acid GBM-targeted chlorotoxin peptide) is coupled to a NKG2D transmembrane domain, a 2B4 co-stimulatory domain, and a CD3ζ intracellular signaling domain such that the CAR comprises a 36 amino acid GBM-targeted chlorotoxin peptide, a NKG2D transmembrane domain, a 2B4 co-stimulatory domain, and a CD3ζ intracellular signaling domain.

[0098] The CAR construct may include SEQ ID NO:2 or a functional variant thereof. The CAR construct may include SEQ ID NO:3 or a functional variant thereof. The CAR construct may include SEQ ID NO:4 or a functional variant thereof. The term "functional variant" refers to a CAR, polypeptide or protein having substantial or significant sequence identity or similarity to the CAR, and the functional variant retains the biological activity of the CAR of which it is a variant. Functional variants encompass, for example, variants of the CAR (parent CAR), which retain the ability to recognize target cells similar to, identical to or higher than the parent CAR. With regard to the nucleic acid sequence encoding the parent CAR, in some embodiments, the nucleic acid sequence encoding the CAR functional variant is about 10% identical, about 25% identical, about 30% identical, about 50% identical, about 65% identical, about 80% identical, about 90% identical, about 95% identical, or about 99% identical to the nucleic acid sequence encoding the parent CAR.

[0099] In various other embodiments, for example, when CAR-expressing neutrophils are used to treat cancer, the CAR includes a quadruple mutant IL-13 (TQM13) T-CAR targeting interleukin 13 (IL-13) receptor α-2 (IL-13Rα2), a scFV targeting GD-2, a scFV targeting HER2, a scFV targeting vIII mutant epidermal growth factor receptor (EGFRvIII), or other scFVs targeting gliomas, a CD4 transmembrane domain, and a CD3ζ intracellular signaling domain.

[0100] In certain embodiments, there is provided (for example, optimized) CAR constructs, which include one or more sequences of CLTX peptides, CD4 transmembrane domains and CD3 ζ intracellular domains encoding 36 amino acids targeting GBM. In certain embodiments, neutrophil-specific CAR constructs include one or more sequences of CLTX peptides, NKG2D transmembrane domains and intracellular domains encoding 36 amino acids targeting GBM. Alternatively and in certain embodiments, the transmembrane domain can be any one of CD32a transmembrane domains or CD16 transmembrane domains.

[0101] The intracellular domain may be a CD3ζ signaling domain. The intracellular domain may be any one of a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain.

[0102] In certain embodiments, the CAR construct may also include one or more sequences encoding a 2B4 costimulatory domain, and optionally, the intracellular domain may be a CD3 ζ signaling domain. In certain embodiments of the CAR construct, the transmembrane domain is a CD4 transmembrane domain, the intracellular domain is a CD3 ζ intracellular signaling domain, and the CAR further includes a coding targeting IL-13 receptor α2 (IL-13Rα2) quadruple mutant IL-13 (TQM13) T-CAR, targeting GD2 scFV, targeting HER2 scFV, targeting EGFRvIII scFV, or other targeting glioma scFV One or more sequences.

[0103] As previously mentioned, the CAR constructs herein can be used to produce stable hPSCs expressing CAR, which can then be differentiated into a large number of neutrophils expressing CAR constructs (i.e., neutrophils expressing CAR or CAR neutrophils, which can be used interchangeably herein). In certain embodiments, neutrophils expressing CAR can have (and maintain) an anti-tumor N1 phenotype. For example, such neutrophils can exhibit anti-glioblastoma activity in a hypoxic tumor microenvironment (TME).

[0104] Any suitable method known in the art and illustrated herein can be used to deliver CAR encoding nucleic acid, such as plasmid, to hPSC. Examples of methods include, but are not limited to, nuclear transfection / electroporation, by Lipofectamine Stem (ThermoFisher, STEM00001) or similar transfection reagents, or slow virus, retrovirus, Sleeping Beauty, piggyback (transposon / transposase system, including non-viral mediated CAR gene delivery system) or adeno-associated virus (AAV) mediated delivery. A method using plasmid and CRISPR / Cas9 is illustrated, and transposons, ribonucleoproteins, and double-stranded DNA can also be used to integrate CAR into the hPSC genome, such as at AAVS1 safe harbor locus or CLYBL locus.

[0105] Neutrophils expressing CAR can, and ideally, have been differentiated from pluripotent stem cells (PSCs) engineered to express CAR. The use of "pluripotent" to describe stem cells refers to the ability of cells to form all cell lineages of an organism - in this case, all cell lineages of humans. Pluripotency characteristics include, but are not limited to, morphology (e.g., small, round, high nuclear-cytoplasmic ratio, obvious nucleoli and intercellular spacing), unlimited self-renewal potential, expression of pluripotent stem cell markers (e.g., SSEA3 / 4, SSEA5, TRA1-60 / 81, TRA1-85, TRA2-54, GCTM-2, TG343, TG30, CD9, CD29, CD133 / prominin, CD140a, CD56, CD73, CD90, CD105, OCT4, NANOG, SOX2, CD30 and / or CD50), the ability to differentiate into ectoderm, mesoderm and endoderm, teratoma formation and embryoid body formation.

[0106] PSC can be engineered to express CAR using methods known in the art and methods exemplified herein. Although CRISPR / Cas9-mediated gene knock-in technology is exemplified herein to introduce constructs into AAVS1 safe harbor loci to genetically modify hPSC, any suitable genome editing method can be used. Genome editing (genomeediting), also known as genome editing (genomic editing) or genetic editing (genetic editing), is a genetic engineering, wherein DNA is inserted, deleted and / or replaced in the genome of the target cell. Targeted editing can be achieved by nuclease-independent or nuclease-dependent methods. Nuclease-independent editing involves homologous recombination guided by homologous sequences flanking the exogenous polynucleotides to be inserted into the genome. Alternatively, a specific endonuclease can be used to introduce double-strand breaks into DNA and then repaired. CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats related 9) is a nuclease guided by RNA. Other endonucleases include, but are not limited to, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). Another system is DICE (double integrase cassette exchange), which utilizes phiC31 and Bxb1 integrases for targeted integration.

[0107] Although the adeno-associated virus site 1 (AAVS1) safe harbor locus is exemplified herein, other sites for targeted integration include, but are not limited to, other safe harbor loci or genomic safe harbors (GSHs), which are intragenic / extragenic regions of the human genome that can theoretically provide predictable expression of newly integrated DNA without adversely affecting host cells or recipient organisms. Useful safe harbors must allow sufficient transgene expression to produce the desired level of vector-encoded protein or non-coding RNA. Safe harbors must also not make cells susceptible to malignant transformation or alter cell function. Ideally, the safe harbor locus is characterized by the absence of regulatory elements or gene disruption, an intergenic region in a gene-dense region or a junction between two genes transcribed in opposite directions, a distance is maintained to minimize the possibility of long-range interactions between the promoters of vector-encoded transcriptional activators and adjacent genes (particularly cancer-related genes and microRNA genes), and has ubiquitous transcriptional activity. The position should also be free of repetitive elements and conserved sequences, and allow primers for amplification to be easily designed. In addition to AAVS1, sites suitable for human genome editing include the chemokine (CC motif) receptor 5 locus, the human ortholog of the mouse ROSA26 locus, the human ortholog of the mouse H11 locus, the collagen locus, and the HTRP locus. The selected site must be validated for specific integration and, usually, the insertion strategy, promoter, gene sequence, and construct design all require optimization.

[0108] Neutrophils can be differentiated from PSC using methods known in the art and / or exemplified herein. PSC can be hPSC. hPSC can include human embryonic stem cells (hESC) and / or induced pluripotent stem cells (iPSC). In one embodiment, hPSC can be autologous cells, but heterologous cells can also be used, for example when the patient receiving treatment receives high-dose chemotherapy or radiotherapy to destroy the patient's immune system. In one embodiment, allogeneic cells can be used. Where appropriate, hPSC can be obtained from a subject by methods well known in the art.

[0109] The neutrophils expressing CAR can be loaded with any suitable nanoparticles, i.e., nanoparticles containing drugs or prodrugs, as known in the art. The nanoparticles can be loaded into the neutrophils expressing CAR using any suitable method known in the art and / or exemplified herein.

[0110] In certain embodiments, the nanoparticles are biodegradable. In certain embodiments, the nanoparticles are biocompatible. The nanoparticles may include biodegradable mesoporous organic silica nanoparticles. In certain embodiments, the nanoparticles include biodegradable mesoporous organic silica nanoparticles with a rough surface (R-SiO2). In certain embodiments, the nanoparticles include biodegradable mesoporous organic silica nanoparticles with a smooth surface (S-SiO2). Examples of suitable nanoparticles include, but are not limited to, rough silica nanoparticles, liposomes based on cytosine arabinoside, such as ), polyamidoamine (PAMAM) dendrimer-albumin nanoparticles, and fullerenes (such as gadolinium fullerenol / fullerenol). The rough silica nanoparticles can be biodegradable mesoporous organic silica. In certain embodiments, the nanoparticles include one or more of rough silica nanoparticles, cytosine arabinoside-based liposomes, PAMAM dendrimer-albumin nanoparticles and / or fullerenes. In certain embodiments, the nanoparticles are biodegradable mesoporous organic silica.

[0111] The nanoparticles may contain any drug (e.g., a therapeutic compound or agent) that can be used for therapeutic or preventive treatment (e.g., as a carrier thereof), such as therapeutic treatment of cancer. Such a drug may be a prodrug. The drug may be a preclinical or clinical drug or prodrug, an anti-tumor / chemotherapeutic drug, or a radiosensitizer.

[0112] Anti-tumor / chemotherapeutic drugs can be divided into alkylating agents, antimetabolites, natural products, hormones and antagonists, and other drugs (see, for example, Antineoplastic Agents, LiverTox: Clinical and Research Information on Drug-Induced Liver Injury [Internet publication], which can be obtained publicly through the U.S. National Library of Medicine, National Center for Biotechnology Information website). Such drugs can also be classified according to indications, mechanism of action, chemical structure, or cytotoxicity / non-specificity compared to non-cytotoxicity / targetedness. Examples of alkylating agents include, but are not limited to, hexamethylmelamine, bendamustine, busulfan, carmustine, chlorambucil, cyclophosphamide, dacarbazine, ifosfamide, lomustine, nitrogen mustard, melphalan, procarbazine, streptozotocin, temozolomide, thiotepa, trabectedin and platinum coordination complexes (e.g., carboplatin, cisplatin (radiosensitizer) and oxaliplatin). Examples of antibiotics and cytotoxic agents include, but are not limited to, bleomycin, catinomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, mitomycin (radiosensitizer), mitoxantrone, plicamycin and valrubicin. Non-limiting examples of antimetabolites include antifolates (e.g., methotrexate, pemetrexed, pralatrexate and trimetrexate), purine analogs (e.g., azathioprine, cladribine, fludarabine (radiosensitizer), mercaptopurine and thioguanine) and pyrimidine analogs (e.g., azacytidine, capecitabine, cytarabine, decitabine, floxuridine, fluorouracil (radiosensitizer), gemcitabine (radiosensitizer) and trifluridine / tipracil). Biological response modifiers include aldesleukin (IL-2), denileukin diftitox and interferon gamma (IFNγ) as examples. Histone deacetylase inhibitors include belinostat, panobinostat, romidepsin and vorinostat as examples. Hormonal agents include anti-androgens (e.g., abiraterone, apalutamide, bicalutamide, cyproterone, enzalutamide, flutamide and nilutamide), anti-estrogens and aromatase inhibitors (e.g., anastrozole, exemestane, fulvestrant, letrozole, raloxifene, tamoxifen and toremifene), gonadotropin-releasing hormone analogs (e.g., degarelix, goserelin, histrelin, leuprolide and triptorelin) and peptide hormones (e.g., lanreotide, octreotide and pasireotide).Examples of monoclonal antibodies are numerous and include alemtuzumab, atezolizumab, bevacizumab, blinatumomab, cemiplimab, cetuximab, daratumumab, dinutuximab, elotuzumab, gemtuzumab, and inotuzumab, among others. Likewise, there are many examples of protein kinase inhibitors, including abemaciclib, acalabrutinib, binimetinib, bortezomib, cabozantinib, carfilzomib, dabrafenib, dacomitinib, enasidenib, encorafenib, fedratinib, gefitinib, ibrutinib, lapatinib, midostaurin and neratinib, etc. Taxanes include, but are not limited to, cabazitaxel, docetaxel (radiosensitizer) and paclitaxel (radiosensitizer). Topoisomerase inhibitors include, but are not limited to, etoposide, irinotecan, teniposide (radiosensitizer) and topotecan. Vinca alkaloids include, but are not limited to, vinblastine, vincristine and vinorelbine. Other anti-tumor / chemotherapeutic agents include asparaginase, bexarotene, eribulin, everolimus, hydroxyurea (radiosensitizer), ixabepilone, lenalidomide, mitotane, omacetin, pomalidomide, tagraxofusp, telotristate, temsirolimus, thalidomide and venetoclax. In various embodiments, the drug is tirapazamine (radiosensitizer), temozolomide, climacostol or indole-3-acetic acid. In other embodiments, the drug is everolimus, bevacizumab, belzutifan, carmustine, naxitamab-gqgk or lomustine. In certain embodiments, the drug is the hypoxia-activated prodrug tirapazamine (TPZ) or the clinical chemotherapy drug temozolomide (TMZ). In certain embodiments, the drug is compound JNJ64619187.

[0113] In embodiments where the nanoparticles comprise a prodrug, the prodrug can be activated by anaerobic conditions, acidic pH, enzymes (eg, horseradish peroxidase), radiation, and the like.

[0114] As described in more detail in the Examples, the hPSC-derived CAR-neutrophils herein are not damaged by the nanoparticle cargo and retain the original neutrophil ( The inherent biological and physiological characteristics of neutrophils Figure 1A For example, CAR-neutrophils loaded with SiO2 nanoparticles containing TPZ or TMZ showed excellent antitumor activity against GBM through a combination of CAR-enhanced direct cytolysis and chemotherapy-mediated tumor killing based on cellular uptake and intracellular release of TPZ or TMZ induced by nanoparticle degradation of glutathione (GSH) in targeted tumor cells ( Figure 1B ). In an orthotopic GBM xenograft model, hPSC-derived CAR neutrophils specifically and efficiently delivered TPZ-loaded SiO2 nanoparticles to brain tumors without the need for invasive surgical resection to amplify inflammation, significantly inhibiting tumor growth and prolonging animal survival. Anti-GBM activity was superior and specific, with significantly reduced off-target drug delivery.

[0115] Furthermore, the CAR-neutrophil-mediated drug delivery system in this article can rely solely on the natural chemical attraction of GBM without amplifying postoperative inflammatory signals, which demonstrates its high specificity and therapeutic potential in eradicating deeply infiltrating gliomas that cannot be surgically removed. Since surgical resection and adjuvant chemotherapy / radiotherapy are the main clinical interventions for GBM, the combination of CAR-neutrophil nanocarriers and surgery / radiotherapy may achieve the best efficacy and deserves further study. Linet al. (2021), ibid.

[0116] The hPSC-neutrophil drug delivery platform of this article can be modular and universal, so that CAR constructs, and ultimately, neutrophils expressing CAR can be reengineered and adjusted to support other neutrophil-based efforts to treat devastating human diseases. As described above, CAR engineering is easier to achieve in hPSC than in primary immune T / NK cells, and only one-time genome editing is required to achieve stable and homogeneous expression of various CARs. In addition to CLTX-CAR, stable hPSC lines expressing universal anti-fluorescein (FITC) or anti-PD-L1 CARs were constructed, both of which can be used to obtain universal nanocarrier CAR-neutrophils targeting solid tumors. Lee et al., Regulation of CAR T cell-mediated cytokine release syndrome-like toxicity using low molecular weight adapters, Nature Communications 10: 2681 (2019); Kagoya et al., A novel chimeric antigen receptor containing a JAK-STAT signaling domain mediates superior antitumor effects, Nature Medicine 24: 352-359 (2018). Other genetic modifications, such as anti-FAP CARs targeting fibrosis, can also be used to guide neutrophil nanocarriers to treat fatal regenerative diseases, including brain trauma and cardiac fibrosis. Aghajanian et al., Targeting cardiac fibrosis with engineered T cells, Nature 573: 430-433 (2019). Therefore, in certain embodiments, the CAR constructs herein include anti-FAP CAR constructs targeting fibrosis.

[0117] Furthermore, CAR-expressing hPSCs can also be easily adapted to generate CAR-T or NK cells, and the combination of these immunotherapies with CAR-neutrophil nanocarriers could have significant therapeutic anti-tumor benefits.

[0118] In summary, the CAR constructs and CAR-expressing biomimetic neutrophils (e.g., loaded with nanoparticles) provided herein provide a safe, effective and universal platform for the treatment of GBM and other devastating diseases. In addition, given that neutrophils also prefer to engulf microbial pathogens with rough or long surfaces, such as Staphylococcus aureus (S. aureus) and Escherichia coli (E. coli), this property can be considered when designing nanoparticles for neutrophil-mediated drug delivery. Safari et al., Neutrophils preferentially phagocytose elongated particles-An opportunity for selective targeting in acute inflammatory diseases, Science Advances 6(24)(2020). In fact, it has recently been reported that preferential phagocytosis of intravenously administered elongated particles without complex surface modifications is carried out by circulating neutrophils. Safari et al. (2020), ibid.; Chang et al., Crystallographic facet-dependent stress responses by polyhedral leadsulfide nanocrystals and the potential "safe-by-design" approach, Nano Research 9: 3812-3827 (2016); Chang et al., Achievement of safer palladium nanocrystals by enlargement of {100} crystallographic facets, Nanotoxicology 11 (7): 907-922 (2017). This approach can maximize the drug load in neutrophils and enable therapeutic levels of drug delivery to be achieved at the target site. In fact, the findings presented herein demonstrate that treatments including the combined administration of functional CAR-neutrophils and chemoimmunotherapy herein can exhibit excellent specific anti-GBM activity in tumor-bearing mice, significantly reducing off-target drug delivery and prolonging life.

[0119] In addition, while the present disclosure describes the introduction of CAR into hPSCs followed by differentiation into neutrophils, one of ordinary skill in the art will understand and appreciate that hemogenic endothelial cells, hematopoietic progenitor cells, and neutrophils derived from hPSCs, such as cells produced according to the methods described herein, can be directly targeted to produce CAR neutrophils.

[0120] Furthermore, the CAR-mediated drug delivery system herein is modular, so that they are not limited to application to any specific disease or condition, but can be customized as needed. For example, the CAR neutrophils herein can be prepared using any desired CAR (e.g., a CAR comprising a targeting peptide with binding affinity to a disease or condition-specific target), and loaded with nanoparticles comprising a drug or prodrug selected for treating a target disease or condition. Considering the ability of CAR neutrophils to pass through the blood-brain barrier (BBB) ​​and other biophysical barriers in a subject, this may be particularly beneficial, because such CAR neutrophils can deliver nanoparticles to a site of interest in a subject, regardless of whether there is a BBB or other biophysical barrier.

[0121] Engineered Neutrophil Cell Lines

[0122] Also further provided is an engineered neutrophil cell line (e.g., derived from hPSC). In certain embodiments, the engineered neutrophil cell line comprises a CAR having / comprising a 36 amino acid targeting GBM chlorotoxin peptide, CD4, NKG2D, CD32a or CD16 transmembrane domain and an intracellular domain (e.g., CD3ζ intracellular signaling domain). The transmembrane domain may be a CD4 transmembrane domain. The transmembrane domain may be a NKG2D transmembrane domain. The transmembrane domain may be a CD32a transmembrane domain or a CD16 transmembrane domain.

[0123] The intracellular domain can be a CD3 ζ intracellular signaling domain. The intracellular domain can include a CD32a γ intracellular signaling domain or a CD16 intracellular signaling domain. In certain embodiments, CAR also includes a CD3 ζ intracellular signaling domain (e.g., in addition to other intracellular domains of CAR). CAR can also further include a 2B4 costimulatory domain.

[0124] In certain embodiments, the transmembrane domain is a CD4 transmembrane region, the intracellular domain is a CD3ζ intracellular signaling domain, and the CAR further has / comprises a quadruple mutant IL-13 (TQM13) T-CAR targeting IL-13Rα2, a scFV targeting GD2, a scFV targeting HER2, a scFV targeting EGFRvIII, or other scFVs targeting gliomas.

[0125] In certain embodiments, the engineered neutrophil lineage CAR comprises one of a CD32a transmembrane domain or a CD16 transmembrane domain and one of a CD32a gamma intracellular signaling domain or a CD16 intracellular signaling domain.

[0126] The engineered neutrophil cell line may comprise a chlorotoxin peptide targeting GBM with / comprising 36 amino acids, a CD4 transmembrane domain, and a CAR of a CD3ζ intracellular signaling domain. In certain embodiments, the engineered neutrophil cell line comprises a chlorotoxin peptide targeting GBM with / comprising 36 amino acids, one of a CD32a transmembrane domain or a CD16 transmembrane domain, and a CAR of a CD3ζ intracellular signaling domain. In certain embodiments, the engineered neutrophil cell line comprises a chlorotoxin peptide targeting GBM with / comprising 36 amino acids, one of a CD32a transmembrane domain or a CD16 transmembrane domain, and one of a CD32aγ intracellular signaling domain or a CD 16 intracellular signaling domain. In certain embodiments, the engineered neutrophil cell line comprises a chlorotoxin peptide targeting GBM with / comprising 36 amino acids, a NKG2D transmembrane domain, a 2B4 costimulatory domain, and a CAR of a CD3ζ intracellular signaling domain. In certain embodiments, the engineered neutrophil cell line comprises a quadruple mutant IL-13 (TQM13) T-CAR targeting IL-13 receptor α2 (IL-13Rα2), a scFV targeting GD2, a scFV targeting HER2, a scFV targeting EGFRvIII, or other scFVs targeting gliomas; a CD4 transmembrane domain; and a CAR of a CD3ζ intracellular signaling domain. The engineered neutrophil cell line may include a CAR additionally comprising a CD3ζ intracellular signaling domain.

[0127] Composition

[0128] Even further provided is a pharmaceutical composition. The pharmaceutical composition may comprise a population of isolated CAR neutrophils as described herein or obtained according to the methods herein, or a population of neutrophils from the above-mentioned cell lines. The pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or diluent.

[0129] The term "isolated" refers to the removal of a material from its original environment (e.g., the natural environment if it occurs naturally). For example, a neutrophil naturally occurring in vivo is not isolated, but the same neutrophil separated from some or all of the coexisting materials in the natural system is isolated.

[0130] The term "pharmaceutically acceptable" and its grammatical variants, when they refer to compositions, carriers, diluents, agents, etc., are used interchangeably, which means that these materials can be administered to or on mammals without excessive toxicity, irritation, allergic response and / or undesirable physiological effects, such as nausea, dizziness, stomach discomfort, etc., which is commensurate with a reasonable benefit / risk ratio. In other words, it is a material that will not have adverse effects biologically or otherwise, that is, the material can be administered to an individual together with CAR neutrophils, for example, without causing any undesirable biological effects or interacting with any other components of the pharmaceutical composition in a significantly harmful manner.

[0131] The term "pharmaceutically acceptable carrier" is generally recognized and refers to a pharmaceutically acceptable material, composition or vehicle involved in carrying or transporting a composition or its components, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material. Each carrier must be "acceptable" in the sense of being compatible with the subject composition and its ingredients and not harmful to the patient. Some examples of materials that can be used as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn starch, etc. oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) phosphate buffer solution; and (21) other nontoxic, compatible substances used in pharmaceutical preparations.

[0132] The choice of carrier will be determined in part by a specific CAR, a nucleic acid sequence encoding CAR, a vector or a host cell expressing CAR, and a specific method for administering a nucleic acid sequence encoding CAR, a vector or a host cell expressing CAR. Therefore, there are a variety of different suitable formulations for the pharmaceutical composition. For example, the pharmaceutical composition may contain a preservative. Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate and benzalkonium chloride. A mixture of two or more preservatives may optionally be used. The preservative or a mixture thereof is typically present in an amount of about 0.0001% to about 2% by weight of the total composition.

[0133] The specific formulation used will also depend, at least in part, on the specific route of administration. For example, a formulation suitable for systemic administration such as intravenous administration may be different from a formulation suitable for intracranial administration. Such modifications are within the ordinary skill of the art.

[0134] Treatments and uses

[0135] Provided is any neutrophil expressing CAR provided herein, any engineered neutrophil cell line herein, or neutrophil from the cell line, or the pharmaceutical composition herein for use in the preparation of a drug for treating a subject's disease. In certain embodiments, the disease is cancer. In certain embodiments, the disease is fibrosis.

[0136] Also provided is a method for treating a cancer in a subject (e.g., in need thereof). The method may include administering to the subject a first therapy comprising a therapeutically effective amount of (a) a cell population of any CAR neutrophils described herein or a pharmaceutical composition comprising any CAR neutrophils described herein and a pharmaceutically acceptable carrier and / or diluent, or (b) a cell population of neutrophils from the above-mentioned cell line or a pharmaceutical composition comprising the cell population and a pharmaceutically acceptable carrier and / or diluent.

[0137] In certain embodiments, the methods may include a synergistic combination therapy, such that the method further comprises administering to the subject a second therapy (e.g., using a therapeutically effective amount) and provides an increased cytotoxic effect on the cancer in the subject compared to administering a single compound or therapy of the combination alone to the subject.

[0138] The second therapy may include surgically removing one or more cancer cells, chemotherapy, and / or radiotherapy (e.g., a therapeutically effective amount thereof) from the subject. In certain embodiments, the method further includes administering a therapeutically effective amount of chemotherapy to the subject. In certain embodiments, the method further includes administering a therapeutically effective amount of radiotherapy to the subject. In certain embodiments, the method further includes administering a therapeutically effective amount of chemotherapy and radiotherapy to the subject.

[0139] In certain embodiments, before administering CAR neutrophils or neutrophil compositions expressing CAR to a subject, additional imaging is performed on the cancer. Additionally or alternatively, cancer can be imaged during or after administration to assess, for example, metastasis and therapeutic effects. In certain embodiments, imaging is performed by positron emission tomography (PET) imaging, magnetic resonance imaging (MRI) or single photon emission computed tomography (SPECT) / computed tomography (CT). The imaging method can be any suitable imaging method known in the art.

[0140] In certain embodiments, the method further comprises imaging the solid tumor cancer prior to or during administration of the CAR neutrophils, the composition comprising the CAR neutrophils, and / or the second therapy.

[0141] Cancer can be any cancer. "Cancer" includes any neoplastic condition, whether malignant, pre-malignant or non-malignant, and includes a group of diseases involving abnormal cell growth, which, in some cases, has the potential to invade or spread (i.e., metastasize) to other parts of the body. However, in general, neoplastic conditions are malignant. Both solid tumors and non-solid tumors are included, and "cancer (sexual) cells" can be used interchangeably with "tumor (sexual) cells".

[0142] Examples of cancer include, but are not limited to, leukemias (e.g., ALL, AML, CLL, and CML), adrenocortical carcinoma, AIDS-related cancers (e.g., Kaposi's sarcoma), lymphomas (e.g., T-cell, Hodgkins, and non-Hodgkins), astrocytomas, basal cell carcinomas, bladder cancer, bone cancer, brain cancer (e.g., GBM), breast cancer, prostate cancer, lung cancer, cervical cancer, colon cancer, colorectal cancer, DCIS, esophageal cancer, gastric cancer, glioma, head and neck cancer, liver cancer, gastric cancer, pancreatic cancer, kidney cancer (e.g., renal cell and Wilms), oral cancer, oropharyngeal cancer, ovarian cancer, testicular cancer, and pharyngeal cancer.

[0143] The cancer may be a brain cancer. The brain cancer may be a GBM. The cancer may be a prostate cancer. The cancer may express the protein matrix metallopeptidase 2. The neutrophil population (e.g., CAR neutrophils and / or neutrophils from an engineered neutrophil cell line) or a pharmaceutical composition comprising the same may be administered systemically or intracranially.

[0144] Also provided is a method for delivering a therapeutic agent to a subject to a target position in a subject (e.g., suffering from a disease). In certain embodiments, the method includes administering a first therapy to a subject, the therapy comprising a therapeutically effective amount of any neutrophil cell population of the present invention expressing CAR; a cell population of neutrophils from any engineered neutrophil cell line herein; or any pharmaceutical composition herein, wherein relative to the administration site, the target position passes through the blood-brain barrier of the subject.

[0145] The disease can be cancer (e.g., brain cancer or prostate cancer). Cancer can be any cancer described herein. This disease can be glioblastoma. In embodiments where the disease is cancer, the CAR of the neutrophil expressing CAR used in the method may include a peptide targeting cancer, such as chlorotoxin peptide, FAP, or other currently known or below developed peptides targeting cancer.

[0146] This disease can be a nervous system disorder. Nervous system disorders (e.g., neurodegenerative disorders) can involve protein aggregation of proteins that are prone to aggregation. Nervous system disorders can be tau diseases. In certain embodiments where the disease is a nervous system disorder, the CAR of the neutrophil expressing CAR used in the method can include a peptide targeting the brain (i.e., brain specific) known now or developed later.

[0147] Aggregable proteins include, but are not limited to, amylin, amyloid beta, alpha-synuclein (α-syn), tubulin-associated units (tau) and transthyretin. Tau can be tau isoform 2N4R or 1N4R. Neutrophils expressing CAR described herein can be used to inhibit such aggregation by loading compounds that inhibit α-syn aggregation. Diseases involving protein aggregation include, but are not limited to, AA amyloidosis, Alzheimer's disease, monoclonal immunoglobulin light chain amyloidosis, Huntington's disease, Parkinson's disease, Creutzfeldt-Jakob disease, prion disorders, amyotrophic lateral sclerosis, type 2 diabetes, or transthyretin amyloidosis.

[0148] The neutrophils expressing CAR herein can be used to suppress the aggregation of α-syn in subjects with Alzheimer's disease, Lewy body dementia (DLB) or multiple system atrophy (MSA) or with its risk of illness, especially because neutrophils can pass through the blood-brain barrier and other biophysical barriers in the subject. The neutrophils expressing CAR herein can be used to suppress the formation of α-syn inclusion bodies in subjects with neuroblastoma, for example, when the nanoparticles containing compounds that suppress the formation of α-syn inclusion bodies are loaded. In certain embodiments, the nanoparticles expressing CAR neutrophils are selected from the group consisting of donepezil, galantamine, aducanumab (aducanumab) and monoclonal antibodies (e.g., donanemab (donanemab)).

[0149] The neutrophils expressing CAR herein can be used to inhibit the aggregation of tau proteins in tau diseases and the nanoparticles loaded therein can include any drug or prodrug suitable for treating this tau disease. In certain embodiments, the drug or prodrug includes a Fyn inhibitor (e.g., saracatinib), a GSK-3β inhibitor (e.g., tiglucibu), or a p75 inhibitor (e.g., LM11A). Tau diseases are a group of diseases caused by, for example, abnormal tau phosphorylation, abnormal tau levels, abnormal tau splicing, and tau gene mutations. Neurodegenerative diseases have been classified according to this protein accumulation. Tau diseases include more than 20 clinical pathological conditions, including Alzheimer's disease (AD), which is the most common tau disease. Other tau diseases include, but are not limited to, familial AD, primary age-related tau diseases (PART), Creutzfeldt-Jakob disease, boxing dementia (dementia pugilistica), Gerstmann-Straussler-Schenck disease (GSS), inclusion body myositis, corticobasal degeneration (CBD), Pick's disease (PiD), progressive supranuclear palsy (also known as Stille, Richardson, and Olszewski disease), Down syndrome, Parkinson's disease with dementia, myotonic dystrophy, prion protein cerebral amyloid angiopathy, traumatic brain injury (TBI), amyotrophic lateral sclerosis (ALS), Guam Parkinson-dementia complex, non-Guam motor neuron disease with neurofibrillary tangles, argyrophilic grain disease, diffuse neurofibrillary tangles with calcifications, frontotemporal dementia with Parkinsonism associated with chromosome 17 (FTDP-17), Haller-vorden-Spatz disease, multiple system atrophy (MSA), Niemann-Pick disease type C, globus pallidus-cerebral Pontine-nigral degeneration, progressive subcortical gliosis, progressive supranuclear palsy (PSP), subacute sclerosing panencephalitis, dementia with tangles, postencephalitic Parkinson's disease, myotonic dystrophy, subacute sclerosing panencephalitis, LRRK2 mutations, chronic traumatic encephalopathy (CTE), familial British dementia, familial Danish dementia, other frontotemporal lobar degeneration, Guadeloupe Parkinson's disease, neurodegeneration with brain iron accumulation, SLC9A6-related mental retardation, white matter tauopathy with globular glial inclusions, epilepsy, Lewy body dementia (LBD), mild cognitive impairment (MCI), multiple sclerosis, Parkinson's disease, HIV-associated dementia, adult-onset diabetes, senile cardiac amyloidosis, glaucoma, ischemic stroke, Alzheimer's disease psychosis, Huntington's disease, and prion diseases with tangles. Most neurodegenerative diseases are characterized by the deposition of insoluble proteins in cells of the neuromuscular system.

[0150] Thus, in certain embodiments of the method for delivering a therapeutic agent to a subject having a disease, the disease is Alzheimer's disease. In certain embodiments of the method for delivering a therapeutic agent to a subject having a disease, the disease is Parkinson's disease.

[0151] The method of delivering a therapeutic agent to a subject with a disease may further include administering a second therapy to the subject. The second therapy may be, for example, surgical removal of cancer cells (for example, in the case where the disease is cancer) from the subject. The second therapy may include chemotherapy, radiotherapy, or both. The second therapy may include, for example, in the case where the disease is cancer, imaging of the target position (for example, cancer (for example, TME) or brain tissue) in the subject before or during administration of the first and / or second therapy. In certain embodiments, for example, when the disease is a neurological disorder, the second therapy may include a microtubule stabilizer, such as, but not limited to, docetaxel, epothilone D and / or paclitaxel. In certain embodiments, the first and second therapies are sequentially and / or alternately administered relative to each other.

[0152] The methods herein can reduce, or even greatly reduce, systemic and off-target toxicity. "Off-target toxicity" refers to organ or tissue damage or subject weight loss that the treating physician or other individuals do not want to see, or any other effect on the subject that may be an unfavorable indicator for the treating physician (e.g., B cell aplasia, fever, decreased blood pressure, or pulmonary edema).

[0153] The terms "treat, treating, treated, treatment" (with respect to a disease or condition, such as cancer) are used to describe methods of obtaining a beneficial or desired result (such as a clinical result), which may include, but are not limited to, one or more of improving a condition associated with the disease condition, curing the disease, reducing the severity of the disease, improving the quality of life of a person suffering from the disease, prolonging survival, and / or preventive treatment. With respect to cancer, in particular, the terms "treat, treating, treated, treatment" may additionally mean reducing the size of a tumor, completely or partially removing a tumor (e.g., a complete or partial response), stabilizing the disease, preventing the progression of cancer (e.g., progression-free survival), or any other effect on cancer that is considered by a physician to be a therapeutic or preventive treatment of cancer. More specifically, curative treatment refers to any relief, improvement and / or elimination, reduction and / or stabilization (e.g., failure to progress to a more advanced stage) of signs / symptoms, and a delay in the progression of signs / symptoms of a particular condition. Preventive treatment refers to any situation: stopping the onset of disease, reducing the risk of progression, reducing the incidence of disease, delaying the onset of disease, reducing the progression, increasing the time to the onset of symptoms of a particular condition. The desired effects of treatment may include, but are not limited to, preventing the occurrence or recurrence of the disease, alleviating symptoms, alleviating any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, improving or alleviating the disease state, and alleviating or improving prognosis. In certain embodiments, the composition is used to delay the development of the disease and / or tumor, or slow down (or even stop) the progression of the disease and / or tumor growth.

[0154] The term "patient" or "subject" includes humans and non-human animals, such as companion animals (dogs and cats, etc.) and livestock animals. Livestock animals are animals raised for food production. The subject to be treated is preferably a mammal, particularly a human.

[0155] As used herein, the term "administering" includes all methods of introducing neutrophils and pharmaceutical compositions comprising the neutrophils into a patient. Examples include, but are not limited to, oral (po), parenteral, systemic / intravenous (iv), intramuscular (im), subcutaneous (sc), transdermal, intrathoracic, intraarterial, intraperitoneal, epidural, intraurethral, ​​intranasal, buccal, ocular, sublingual, vaginal, rectal, etc. Routes of administration to the brain include, but are not limited to, intraparenchymal, intraventricular, intracranial, etc.

[0156] Exemplary methods of parenteral administration include needle (including microneedle) syringes, needle-free syringes and infusion techniques, as well as any other parenteral administration methods recognized in the art. Parenteral formulations are typically aqueous solutions that may contain excipients such as salts, carbohydrates, and buffers (preferably at a pH in the range of about 3 to about 9). Preparation of parenteral formulations under sterile conditions can be easily accomplished using standard pharmaceutical techniques well known to those skilled in the art.

[0157] Neutrophils can be formulated as pharmaceutical compositions and administered to mammalian hosts, such as human patients, in a variety of forms suitable for the selected route of administration. For example, pharmaceutical compositions can be formulated for oral or parenteral, intravenous, intraarterial, intraperitoneal, intrathecal, epidural, intraventricular, intraurethral, ​​intrasternal, intracranial, intratumoral, intramuscular, topical, inhaled, and / or subcutaneous routes and administered by these routes. In fact, neutrophils or compositions comprising the neutrophils can be administered directly into the bloodstream, muscle, or internal organs.

[0158] Neutrophils / compositions can be administered by infusion or injection (e.g., using a needle (including microneedle) syringe and / or a needle-free syringe). Solutions of the composition can be aqueous, optionally mixed with a non-toxic surfactant and / or can contain carriers or excipients such as salts, carbohydrates, and buffers (preferably at pH 3 to 9).

[0159] The percentage of neutrophils, compositions and formulations can vary and can be between about 1 to about 99% by weight of active ingredient and binders, excipients, disintegrants, lubricants and / or sweeteners (as known in the art). The amount of neutrophils in such therapeutically useful compositions is such that an effective dosage level is achieved.

[0160] In some embodiments, the neutrophils are administered as a composition comprising one or more pharmaceutically acceptable carriers, adjuvants, diluents, excipients, vehicles, or any combination thereof.

[0161] The term "therapeutically effective amount" as used herein refers to the amount of engineered neutrophils that trigger a biological or drug response (e.g., desired therapeutic effect) in a tissue system, animal or human sought by a researcher, veterinarian, doctor or other clinician, including the alleviation of the symptoms of the treated disease or condition. In one aspect, a therapeutically effective amount is an amount that can treat or alleviate the symptoms of a disease or condition at a reasonable benefit / risk ratio applicable to any medical treatment. However, it should be understood that the total daily usage of engineered neutrophils may be determined by the attending physician within the scope of reasonable medical judgment. In the treatment of cancer, the desired therapeutic effect may be to inhibit the progression of cancer, such as the proliferation and / or metastasis of cancer cells. Desirably, a sufficient amount is administered to kill cancer cells, thereby reducing the number of cancer cells, and desirably reaching the extent of eradication.

[0162] The specific therapeutically effective dose level of CAR neutrophils for any particular patient will depend on a variety of factors, including the condition being treated and the state / severity of the condition; the specific ingredients used; the patient's age, weight, general health, sex and diet; the time and route of administration; the duration of treatment; the drugs used in combination or concurrently with the engineered neutrophils; and similar factors known to researchers, veterinarians, doctors or other clinicians with ordinary skills. For example, the dose of CAR-expressing neutrophils can be 10 per square meter of patient body surface area or 10 per kilogram of patient body weight. 5 Up to 10 12 Therefore, the absolute number of engineered neutrophils contained in a given unit dosage form can vary greatly and depends on factors such as the age, weight and physical condition of the subject and the method of administration.

[0163] Depending on the route of administration, a wide range of permissible doses are contemplated herein. The dose may be single or divided, and may be administered according to a variety of different regimens, including qd (once a day), bid (twice a day), tid (three times a day), or even every other day, once a week, once a month, once a quarter, etc. In each case, it is understood that the therapeutically effective amount described herein corresponds to the circumstances of administration, or corresponds to the total daily, weekly, monthly or quarterly dose determined by the dosing regimen.

[0164] In order to effectively treat the subject, multiple infusions may be required. For example, 2, 3, 4, 5, 6 or more separate infusions may be administered to the patient at intervals of about 24 hours to about 48 hours, or every 3, 4, 5, 6 or 7 days. Infusions may be administered weekly, biweekly or monthly. Monthly administration may be repeated for 2-6 months or longer, such as 9 months to a year.

[0165] The dosage of engineered neutrophils for treating cancer, such as brain tumors, gliomas, GBM, or cancers expressing MMP2, or other diseases or conditions is consistent with the dosage and schedule practiced by those skilled in the art. Typically, the dosage for patients receiving adoptive cell transfer therapy is >10 9 Determination of an effective amount or dosage is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0166] The engineered neutrophils administered to a subject may contain approximately 1×10 5 About 1×10 15 or 1×10 6 About 1×10 15 In various embodiments, about 1×10 5 About 1×10 10 , about 1×10 6 About 1×10 10 , about 1×10 6 About 1×10 9 , about 1×10 6 About 1×10 8 , about 1×10 6 About 2×10 7 , about 1×10 6 About 3×10 7 , about 1×10 6 About 1.5×10 7 , about 1×10 6 About 1×10 7 , about 1×10 6 About 9×10 6 , about 1×10 6 About 8×10 6 , about 1×10 6 About 7×10 6 , about 1×10 6 About 6×10 6 , about 1×10 6 About 5×10 6 , about 1×10 6 About 4×10 6 , about 1×10 6 About 3×10 6 , about 1×10 6 About 2×10 6 , about 2×10 6 About 6×10 6 , about 2×10 6 About 5×10 6 , about 3×10 6About 6×10 6 , about 4×10 6 About 6×10 6 , about 4×10 6 About 1×10 7 , about 1×10 6 About 1×10 7 , about 1×10 6 About 1.5×10 7 , about 1×10 6 About 2×10 7 , about 0.2×10 6 About 1×10 7 , about 0.2×10 6 About 1.5×10 7 , about 0.2×10 6 About 2×10 7 , or about 5×10 6 cells.

[0167] The engineered neutrophils administered to a subject may comprise about 1 million, about 2 million, about 3 million, about 4 million, about 5 million, about 6 million, about 7 million, about 8 million, about 9 million, about 10 million, 11 million, about 12 million, about 12.5 million, about 13 million, about 14 million, or about 15 million cells. Cells may be administered in a single dose or multiple doses. Engineered neutrophils may be administered in the number of neutrophils expressing CAR per kilogram of subject body weight.

[0168] CAR-expressing neutrophils can be administered by any suitable route. Such routes include, but are not limited to, intravenous injection and intratumoral injection. The preparation of compositions suitable for administering CAR-expressing neutrophils (including compositions suitable for administration by intravenous and intratumoral routes) is within the ordinary skill of the art. The neutrophil composition expressing CAR may include one or more pharmaceutically acceptable carriers, diluents, and / or other pharmaceutically acceptable components. The carrier, diluent, and / or other components may be determined in part by a specific route of administration (see, e.g., Remington's Pharmaceutical Sciences, 17 th ed. (1985)). The components of the composition must be of sufficiently high purity and sufficiently low toxicity to make the composition suitable for administration to humans. The composition is ideally stable.

[0169] Overview

[0170] All patents, patent application publications, journal articles, textbooks, and other publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the present disclosure pertains.

[0171] In the foregoing description, many specific details are set forth to provide a thorough understanding of the present disclosure. Specific examples may be implemented without including some or all of these specific details, and it should be understood that the present disclosure is not limited to specific biological systems, specific cancers, or specific organs or tissues, which may of course vary but still apply in view of the data provided herein.

[0172] In addition, various techniques and mechanisms of the present disclosure sometimes describe the connection or link between two components. Words such as attachment, link, coupling, connection and similar terms with inflectional morphemes can be used interchangeably unless noted in the context or otherwise indicate differences. These words and expressions do not necessarily represent direct connections, but also include connections through intermediary components. It should be noted that the connection between two components does not necessarily mean a direct, unhindered connection, because various other components may exist between the two components noted. Therefore, unless otherwise stated, connection does not necessarily mean a direct, unhindered connection.

[0173] In addition, it should be understood that the disclosure presented in this manner is for illustrative purposes only, and the principles and embodiments described herein can be applied to compounds and / or composition components having different configurations than those specifically described herein. In fact, it is expressly contemplated that the components of the compositions and compounds of the present disclosure can be customized to achieve the desired application.

[0174] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of chemistry and biology. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the subject matter of the present application, preferred methods and materials are described herein.

[0175] The term "about", when referring to a number or value or range (including, for example, integers, fractions, and percentages), means that the referenced number or range is an approximation within the experimental variability (or within statistical experimental error), and thus the number or range may vary between 1% and 15% of the stated number or range (e.g., + / - 5% to 15% of the recited value) provided that it is considered by one of ordinary skill in the art to be equivalent to the recited value (e.g., to have the same function or result).

[0176] When ranges are used herein for physical properties, such as molecular weight, or chemical properties, such as chemical formula, all combinations and subcombinations of ranges and specific embodiments therein are intended to be included.

[0177] The present disclosure may be appropriately implemented without any elements or limitations not specifically disclosed herein. Thus, for example, each instance of any term "comprising," "consisting essentially of," and "consisting of" (and related terms such as "comprise, comprises," or "having" or "including") herein may be replaced with the other term mentioned. Likewise, unless the context clearly indicates otherwise, the singular forms "a," "an," and "the" include plural references. Thus, for example, reference to a "method" includes one or more methods and / or steps of the type that are described and / or will become apparent to one of ordinary skill in the art upon reading this disclosure. The term "substantially" may allow for a degree of variability in values ​​or ranges, for example, within 90%, within 95%, or within 99% of a specified value or specified limit.

[0178] The term "receptor" refers to a chemical structure in biological systems that receives and transmits signals.

[0179] Unless otherwise specifically stated, depicted structures include all stereochemical forms of the structure, i.e., right-hand (R) and left-hand (S) configurations for each asymmetric center. Therefore, single stereochemical isomers as well as enantiomeric and diastereomeric mixtures are within the scope of the present disclosure.

[0180] It will be further appreciated by those of ordinary skill in the art that the above-described SMDCs may be "deuterated," meaning that one or more hydrogen atoms may be replaced by deuterium. Since deuterium and hydrogen have nearly identical physical properties, deuterium substitution is the smallest structural change that can be made. Replacing hydrogen with deuterium can increase stability in the presence of other drugs, thereby reducing unwanted drug interactions, and can significantly reduce metabolic rates (due to kinetic isotope effects). By reducing metabolic rates, half-life can be increased, the formation of toxic metabolites can be reduced, and dosage and / or frequency can be reduced.

[0181] Pharmaceutical compositions are also provided. As used herein, the term "composition" generally refers to any product comprising more than one component, for example, one or more CAR neutrophil populations and a vector.

[0182] It should be appreciated that various modifications may be made within the scope of the present disclosure. Therefore, although the present disclosure has been specifically disclosed in the context of preferred embodiments and optional features, those skilled in the art may modify and change the concepts disclosed herein. These modifications and changes are considered to fall within the scope of the disclosure claimed herein.

[0183] Therefore, this specification and the appended claims are intended to cover all modifications and variations that would be obvious to one of ordinary skill in the art based on the present disclosure. For example, when the method of treatment or therapy includes administering more than one treatment, compound or composition to a subject, it should be understood that the order, timing, number, concentration and volume of administration are limited only by the medical requirements and limitations of the treatment (i.e., two treatments can be administered to a subject, e.g., simultaneously, consecutively, sequentially, alternatingly or according to any other regimen).

[0184] In addition, when describing representative embodiments, the present disclosure may have presented methods and / or processes as a specific sequence of steps. In the case where the method or process does not rely on the specific order of the steps set forth herein, the method or process should not be limited to the specific order of the steps described. As will be appreciated by those of ordinary skill in the art, other orders of steps are also possible. Therefore, the specific order of the steps disclosed herein should not be regarded as a limitation on the claims. In addition, claims relating to methods and / or processes should not be limited to performing their steps in the order written, and those skilled in the art can easily understand that the order can be changed and still be within the spirit and scope of the present disclosure.

[0185] Additionally, given the length of the document, headings and subheadings are used for ease of reference. The description under a heading or subheading (such as a subheading in the Detailed Description) is not intended to be limited to the subject matter set forth under that particular heading or subheading.

[0186] Although the present disclosure is made with reference to humans and human cells and genes, it is contemplated that neutrophils expressing CARs can be generated from other species, such as other species of mammals, using cells and genes from that species. Such neutrophils expressing CARs can then be used to treat members of that species according to the teachings provided herein. Example

[0187] The following examples are provided to illustrate the present disclosure. These examples are not intended to limit the scope of the claimed invention in any way. Materials and methods

[0188] This section provides general methods and materials used in the examples described herein. Any research-specific modifications to these general materials and methods will be described in specific examples. Table 1. Antibodies used in these examples

[0189] Synthesis of degradable dendritic mesoporous organosilica nanoparticles (DDMON). DDMON was synthesized by a one-pot method using NaSal and cationic surfactant hexadecyltrimethylammonium bromide (CTAB) as structure directing agents, tetraethyl orthosilicate (TEOS) and bis[3-(triethoxysilyl)propyl]tetrasulfide (BTES) as silica sources, and triethanolamine (TEA) as catalyst. The synthesis was carried out in a 50 mL flat-bottom glass bottle with a 3 cm stirring bar. Typically, 0.034 g of triethylamine (TEA) was added to 12.5 mL of water and gently stirred (~700 rpm) in an 80 °C oil bath under a magnetic stirrer for 0.5 h. Then, 190 mg of CTAB and 42 mg of NaSal were added to the above solution and stirred for another hour. After CTAB and NaSal were completely dissolved, a mixture of 1 mL of TEOS and 0.8 mL of BTES was added to the mixture solution, which was then vigorously stirred for 12 h. The nanoparticles were collected by centrifugation at 20,000 rpm for 5 minutes and washed with ethanol three times to remove residual reactants. The powder was then dried in a vacuum oven at 40 °C for 6 hours.

[0190] The collected products were extracted with HCl and methanol solution for 3 times at 60 °C for 6 h to remove the template and then dried under vacuum at room temperature overnight.

[0191] Preparation of Spherical Mesoporous Silica Nanoparticles (SMSN). To prepare SMSN, 240 mL of an aqueous solution containing 0.5 g of CTAB was prepared in a conical flask. Then 1.5 mL of NaOH (2 mol L -1 ) was added to the CTAB solution and stirred for 10 minutes. Once the mixture temperature was adjusted to 80°C, 2.5 mL of TEOS was added dropwise to the solution and stirred for 2 hours. The resulting SMSN was then centrifuged and washed several times with ethanol and deionized water to remove the surfactant template. The remaining powder was dried in a vacuum oven at 40°C for 6 hours. The collected product was extracted 3 times with HCl and methanol solution at 60°C for 6 hours to remove the residual template, and then dried in vacuum at room temperature overnight.

[0192] Flow cytometry analysis. The cell culture was gently pipetted and filtered through a 70 or 100 μm filter placed on a 50 mL tube. The cells were then pelleted by centrifugation and washed twice with PBS- / - solution containing 1% bovine serum albumin (BSA). The cells were stained with appropriate conjugated antibodies for 25 minutes at room temperature in the dark and analyzed in an Accuri C6 plus cell counter (Beckton Dickinson) after washing with PBS- / - solution containing BSA. Flow data analysis was performed using FlowJo software.

[0193] Measurement of reactive oxygen species (ROS) production. U87MG cells (100 μL; 30,000 cells / mL) were seeded into wells of a 96-well plate for 12 h, and then neutrophils were added at a ratio of 10:1 neutrophils to tumor. After 12 h of co-incubation, the resulting cell mixture was treated with 10 μM H2DCFDA at 37°C for 50 min, and the fluorescence emission signal ((480-600 nm) with an excitation wavelength of 475 nm) was collected in a SpectraMax iD3 microplate reader (Molecular Devices, Sunnyvale, CA).

[0194] Statistical analysis. Data are presented as mean ± standard deviation (SD). Statistical significance between two groups was determined by Student's t-test (two-tailed), and three or more groups were analyzed by one-way analysis of variance (ANOVA). P < 0.05 was considered statistically significant. Example 1 Screening for CAR constructs with enhanced neutrophil-mediated anti-tumor activity

[0195] First designed, screened and optimized for four different CAR structures of anti-tumor activity of hPSC-neutrophils. The construction of the donor plasmid targeting the AAVS1 locus is as previously described in Chang et al., Fluorescent indicators for continuous and lineage-specific reporting of cell-cycle phases in human pluripotent stem cells, Biotechnology & Bioengineering 117 (7): 2177-2186 (2020). In short, the chlorotoxin (CLTX) sequence and IgG4 hinge containing the granulocyte-macrophage colony stimulating factor receptor (GM-CSFR) signal peptide, and CD3ζ and / or CD32aγ with CD4 or CD32a transmembrane domains are directly synthesized (GeneWiz) and cloned into AAVS1-Puro CAG-FUCCI donor plasmid (Addgene # 136934). Wang et al. (2020), ibid. The resulting CLTX CAR constructs were sequenced and submitted to Addgene (#171963 to #171865; SEQ ID NOs. 1-3).

[0196] As mentioned above, all four CAR constructs have the same extracellular granulocyte-macrophage colony-stimulating factor receptor (GM-CSFR) signal peptide (SP), glioblastoma-targeting domain CLTX, and IgG4 hinge ( Figure 2A ). Wang et al. (2020), supra. Chang et al. (2022), supra.

[0197] CAR#1 (SEQ ID NO:1) is a first generation T cell specific CAR that uses a CD4 transmembrane (tm) domain and a CD3ζ intracellular signaling domain. CAR#2 (SEQ ID NO:2), CAR#3 (SEQ ID NO:3), and CAR#4 (SEQ ID NO:4) differ from CAR#1 in that they use a transmembrane domain from neutrophil-specific CD32a (or FcγRIIA), a single-chain transmembrane receptor highly expressed in neutrophils (30,000 to 60,000 molecules / cell) that is essential for neutrophil activation. Wang & (2019), supra; Németh et al., Importance of fcreceptorγ-chain ITAM Tyrosines in neutrophil activation and in vivo autommune arthritis, Frontiers in Immunology 10 (2019); Role of neutrophil FcγRIIa(CD32)and FcγRIIIb(CD16)polymorphic forms in phagocytosis of human IgG1-and IgG3-opsonized bacteria and erythrocytes, Transfusion Medicine Reviews 9(4):343(1995); Tsuboi et al., Human Neutrophil FcγReceptors Initiate and PlaySpecialized Nonredundant Roles in Antibody-Mediated Inflammatory Diseases, Immunity 28(6):833-846(2008).

[0198] CAR#3 and CAR#4 also include the Fc domain gamma chain of CD32a, which relies on a highly conserved tyrosine-based immunoreceptor activation motif (ITAM) for expression and signaling in neutrophils. Notably, CAR#3 also contains a combined signaling domain by fusing CD32a-ITAM to the CD3ζ intracellular domain.

[0199] Since primary neutrophils are short-lived and resistant to genome editing, hPSCs were engineered with these CARs and the CAR constructs were knocked into the AAVS1 safe harbor locus via CRISPR / Cas9-mediated homology-directed repair, resulting in stable and universal immune receptor expression on differentiated neutrophils ( Figure 2B ). Briefly, the H9 hPSC line was obtained from WiCell and maintained in mTeSR plus medium on Matrigel-coated plates. For neutrophil differentiation, hPSCs were dissociated with 0.5 mM ethylenediaminetetraacetic acid (EDTA) and plated at 10,000 to 80,000 cells / cm 2 Cells were seeded at a density between 50 and 100 μM on iMatrix 511-coated 24-well plates in mTeSR plus medium containing 5 μM Y27632 for 24 h (Day -1).

[0200] On day 0, cells were treated with 6 μM CHIR99021 (CHIR) in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 100 μg / mL ascorbic acid (DMEM / Vc), and the medium was then replaced with LaSR basal medium from day 1 to day 4. Vascular endothelial growth factor (VEGF) (50 ng / mL) was added to the medium from day 2 to day 4. On day 4, the medium was replaced with Stemline II (Sigma) supplemented with 10 μM SB431542, 25 ng / mL SCF, and FLT3. On day 6, the medium containing SB431542 was aspirated, and the cells were maintained in Stemline II medium containing 50 ng / mL SCF and FLT3L.

[0201] On days 9 and 12, the upper half of the culture medium was aspirated and replaced with 0.5 ml of fresh Stemline II containing 50 ng / mL SCF, 50 ng / mL FLT3L and 25 ng / mL GM-CSF. On day 15, floating cells were gently harvested and filtered, and terminal neutrophil differentiation was performed in Stemline II supplemented with 1X GlutaMAX, 150 ng / mL G-CSF and 2.5 μM retinoic acid agonist AM580. Half of the culture medium was replaced every 3 days, and mature neutrophils were harvested starting from day 21.

[0202] To improve cell survival, hPSCs were treated with 10 μM Y27632 for 3-4 hours or overnight before nucleofection. The cells were then singularized with Accutase for 8-10 minutes and transfected with 6 μg SpCas9AAVS1gRNAT2 (Addgene #79888) and 6 μg CAR donor plasmid in 100 μl human stem cell nucleofection solution (Lonza #VAPH-5012) in Nucleofector2b using program B-016. 6 hPSCs were nucleofected.

[0203] The nucleofected cells were seeded into one well of a Matrigel-coated 6-well plate with 3 ml pre-warmed mTeSR plus and 10 μM Y27632. After 24 hours, the medium was replaced with fresh mTeSR plus containing 5 μM Y27632, and then the medium was changed daily. When the cell confluence exceeded 80%, drug selection was performed with 1 μg / ml puromycin (Puro) for about 1 week until nickel-sized hPSC clones were visible. Single clones were then picked and amplified in each well of a 96-well plate pre-coated with Matngel for 2-5 days, followed by PCR genotyping. The culture medium was then purified using QuickExtract TMGenomic DNA from hPSCs of monoclonal clones was extracted using DNAExtraction Solution (Epicentre #QE09050). 2×GoTaq Green Master Mix (Promega #7123) was used to perform genomic DNA PCR. For positive genotyping, the following primer pairs were used with an annealing temperature Tm of 65°C: CTGTTTCCCCTTCCCAGGCAGGTCC (SEQ ID NO: 5) and TCGTCGCGGGTGGCGAGGCGCACCG (SEQ ID NO: 6). For homozygous screening, we used the following primer sequence set: CGGTTAATGTGGCTCTGGTT (SEQ ID NO: 7) and GAGAGAGATGGCTCCAGGAA (SEQ ID NO: 8) with an annealing temperature Tm of 60°C.

[0204] After nucleofection, hPSC clones from single cells were isolated and selected with puromycin (puromycm) for about 2 weeks. Genotyping successfully identified targeted hPSCs with an average CAR knock-in efficiency of >90%, and most targeted clones were heterozygous ( Figures 9A-9D CAR expression on engineered hPSCs was further confirmed by RT-PCR and flow cytometric analysis of CLTX-IgG4 (performed according to the methods described above) ( Fig.9E and 9F ).

[0205] To generate de novo CAR neutrophils, hPSCs expressing CAR were first differentiated into multipotent hematopoietic progenitors by stage-specific cytokine treatment and then into myeloid progenitors ( Figure 2C)。 Chang et al., Chemically-defined generation of human hemogenic endothelium and definitive hematopoietic progenitor cells, Biomaterials 285: 121569 (2022). G-CSF and retinoic acid agonist AM580 were then used to promote the massive production of neutrophils. Brok-Volchanskaya et al., Effective and Rapid Generation of Functional Neutrophils from Induced Pluripotent Stem Cells Using ETV2-Modified mRNA, Stem Cell Reports 13 (6): 1099-1110 (2019).

[0206] Similar to their counterparts in peripheral blood (PB), hPSC-derived CLTX-CAR neutrophils exhibited typical neutrophil morphology and surface markers CD16, CD11b, MPO, CD15, CD66b, and CD 18 ( Fig.10 ).

[0207] The effect of CAR expression on the anti-tumor cytotoxicity of hPSC-derived neutrophils was determined by co-culturing with glioblastoma (GBM) U87MG cells in vitro, and cell viability was analyzed by flow cytometry. In brief, 100 μL of GBM U87MG cell tumor cells (50,000 cells / mL) were mixed with 100 μL of 150,000, 250,000 and 500,000 cells / mL of CAR neutrophils in a 96-well plate and then incubated at 37 ° C, 5% CO2 for 24 hours. In order to harvest all cells, the culture medium containing the cells was first transferred to a new round-bottom 96-well plate, and 50 μL of trypsin-EDTA was added to the empty wells. After incubation for 5 minutes, the adherent cells were separated and transferred to the same well of the round-bottom 96-well plate with suspension culture. All cells were pelleted by centrifugation of the 96-well plate at 300 xg, 4°C for 4 minutes and washed with 200 μL of PBS- / - solution containing 0.5% BSA.

[0208] For cytotoxicity analysis, use live / dead cell staining and CytoTox-Glo TM Cytotoxicity Assay Kit (Promega, Madison, WI). CytoTox-Glo TMCytotoxicity analysis and quantification were determined by SpectraMax iD3 microplate reader (Molecular Devices, LLC, Sunnyvale, CA).

[0209] As expected, hPSC-derived CLTX-CAR neutrophils exhibited improved tumor killing capacity compared with PB neutrophils ( Figure 2D ), which is consistent with the results previously observed in CLTX CAR-T cells. Wang et al. (2020), supra.

[0210] Among these different CARs, CAR#1 mediated excellent tumor killing activity in hPSC-neutrophils. It is worth noting that CAR#4 based on the γ chain was the least effective in triggering neutrophil-mediated tumor killing, which may be due to the lower copy number of ITAM in γ than in the ζ-subunit and the lower expression of CAR carrying γ on the cell surface. Roberts et al. (1998), supra. Neutrophils can also release cytotoxic reactive oxygen species (ROS) and tumor necrosis factor-α (TNF-α) to kill target cells, and the ROS and TNF-α ( Figure 2E and 2F ) is consistent with their increased cytolytic effect, suggesting that ROS and inflammatory cytokines are involved in neutrophil-mediated cytotoxicity against GBM cells.

[0211] Furthermore, enhanced antitumor cytotoxicity of CAR-neutrophils was observed only when co-incubated with GBM cells, including U87MG, primary adult GBM43, and pediatric SJ-GBM2 cells ( Fig.11A ), indicating that CLTX-CAR has high specificity. Notably, CAR-neutrophils showed high biocompatibility with normal SVG p12 glial cells, hPSCs, or hPSC-derived cells ( Fig. 11B ), which is consistent with previous observations that primary neutrophils do not kill healthy cells. Yan et al. (2014), supra. Overall, hPSC-derived CAR-neutrophils, especially those carrying CD3ζ, exhibited enhanced anti-tumor cytotoxicity and produced more ROS and TNF-α in vitro, highlighting their potential in targeted immunotherapy. Example 2 CAR-neutrophils maintain excellent anti-tumor activity in the immunosuppressive tumor microenvironment

[0212] Similar to macrophages, anti-tumor N1 and pro-tumor N2 phenotypes of tumor-associated neutrophils are found in the immunosuppressive tumor microenvironment (TME). Jaillon et al. (2020), supra. Pro-tumor N2 neutrophils play a key role in tumor angiogenesis, metastasis, and immunosuppression, but therapeutic targeting of this cell type has been challenging. In contrast to systemic depletion strategies, CAR engineering has been evaluated for its potential to maintain the anti-tumor phenotype of neutrophils. Yee et al. (2020, supra.

[0213] CAR hPSCs and PB neutrophils were treated with hypoxia and transforming growth factor β (TGFβ) to assess their sustained tumor-killing activity, both of which contribute to the immunosuppression of the TME. Emami Nejad et al., The role of hypoxia in the tumor microenvironment and development of cancer stem cells: a new approach to developing treatment, Cancer Cell Int'l 21: 63 (2021); Lequeux et al., Impact of hypoxic tumor microenvironment and tumor cell plasticity on the expression of immune checkpoints, Cancer Letters 458: 13-20 (2019).

[0214] Although the cytolytic activity of PB neutrophils on GBM cells was significantly reduced under immunosuppression compared with normal conditions, CAR-neutrophils maintained high tumor killing activity under hypoxia (3% O2) and TGFβ conditions ( Figure 3A TNFα release and ROS generation by PB or CAR-neutrophils under immunosuppressive and normal conditions ( Figure 3B and 3C ) also made similar observations.

[0215] To further confirm the neutrophil phenotype under hypoxia and TGFβ conditions, the expression of N1-specific iNOS and N2-specific arginase on isolated neutrophils was detected by flow cytometry ( Figure 3D and 3E). Compared with normoxia, immunosuppressive hypoxia and TGFβ significantly reduced the expression level of iNOS and increased the level of arginase in PB neutrophils, while CAR-neutrophils retained high expression levels of iNOS under hypoxia and TGFβ. In conclusion, CAR-neutrophils maintained an anti-tumor phenotype and high anti-tumor activity under in vitro TME-mimicking conditions, highlighting their potential in targeted immunotherapy. Example 3 Preparation and characterization of hPSC CAR-neutrophils loaded with SiO2 nanoparticles containing tirapazamine (TPZ)

[0216] PB neutrophils have been used as cellular carriers to deliver imaging and therapeutic drugs into brain tumors, although targeting neutrophil infiltration requires surgery or light-induced inflammation, and off-target drug delivery can be a problem. Xue et al., Xue et al. (2017), supra; Wu et al. (2018), supra; Chu et al. (2017), supra; Osuka & Van Meir (2017), supra. To further improve the antitumor activity of CAR-neutrophils, silica nanoparticles (SiO2-NPs) with rough or smooth surfaces were prepared (according to the protocol described in the Materials and Methods section above) to load chemotherapeutic or radioactive drugs into neutrophils.

[0217] Transmission electron microscopy (TEM) images show that both rough and smooth SiO2 nanoparticles are well dispersed and present a spherical morphology with uniform size ( Figure 4A and 12A ). Compositional distribution analysis by scanning TEM (STEM) and energy dispersive X-ray spectroscopy (EDS) showed that sulfur (S) was uniformly distributed throughout the rough SiO2 nanoparticles (R-SiO2) ( Figure 4B ). Through nitrogen (N2) adsorption-desorption isotherms and corresponding pore size distribution analysis, the pore sizes of rough (R-) and smooth (S-) SiO2NPs were measured to be 25nm and 35nm, respectively ( Figure 4C and 12B Given the high surface area and large pore size, therapeutic drugs can be effectively loaded into R- and S-SiO2 NPs, as exemplified by the hypoxia-responsive prodrug tirapazamine (TPZ) ( Figure 4D and 12C ).

[0218] Briefly, for tirapazamine (TPZ) loading, 5 mL of 1 mg mL -1 TPZ and 5 mL SiO2 suspension (5 mg mL-1 ) were mixed, and the resulting solution was stirred continuously at 37°C for different time points (0.5, 1, 2, 4, 6, 12 and 24 hours). Unloaded TPZ was removed by centrifugation at 8000 rpm for 10 minutes, and the precipitate was washed three times with phosphate buffer. TPZ in the supernatant was determined by UV-visible spectroscopy. The TPZ loading (LC) was calculated as follows: LC = (total TPZ - TPZ in supernatant) / (total TPZ) × 100%. For glutathione (GSH) stimulated release analysis, 10 mL phosphate buffer solution (1 mg mL -1 ) were incubated with 10 mM GSH at different time points (10, 20, 30, 40, 50 and 60 hours). 1 mL of the complex dispersion was taken out and centrifuged at 8000 rpm for 10 minutes, and the TPZ released into the supernatant was quantified by UV-visible spectroscopy. A similar procedure was performed to load TMZ and JNJ64619187.

[0219] After loading TPZ, no significant changes in the dispersion, morphology, and size of R-SiO2-TPZ were observed by TEM and dynamic light scattering analysis ( Fig.12D and 12E ). The tetrasulfide bonds in R-SiO2 NPs are sensitive to reducing environments and can be rapidly degraded by the large amount of glutathione (GSH) present in tumor cells. Liu et al., A Tumor-Microenvironment-Responsive Nanocomposite for Hydrogen Sulfide Gas and Trimodal-Enhanced Enzyme Dynamic Therapy, Advanced Materials 33(30):2101223(2021).

[0220] Next, the GSH-responsive degradation capacity of R-SiO2-TPZ NPs in the presence of 10 mM, 1 mM, and 10 μM GSH was determined, which are the same as the intracellular conditions and extracellular environment of cancer cells and normal cells, respectively. Liu et al (2021), supra. After treatment with 10 mM GSH, the initial spherical structure of R-SiO2-TPZ NPs was severely destroyed after 24 hours ( Fig.12F and 12G ), and the nanoparticles completely disintegrated into small fragments after 48 h, resulting in the release of TPZ in a GSH-responsive manner ( Figure 4E ).

[0221] The feasibility of using SiO2-TPZ NPs to load therapeutic drugs into CAR-neutrophils as a combined chemoimmunotherapy to enhance the therapeutic effect was investigated. Briefly, nanodrug loading was prepared by incubating neutrophils with TPZ@SiO2 or nanoparticles loaded with TMZ or JNJ64619187. (TMZ and JNJ64619187 were loaded into SiO2 NPs separately using a similar procedure as described above for TPZ).

[0222] Briefly, hPSC-derived neutrophils were placed in a DNA low-binding tube and incubated with the nanodrug for 1 hour. After centrifugation and PBS washing three times, the nanodrug / neutrophils were resuspended in PBS and ready for subsequent experiments. The cellular uptake efficiency of SiO2-TPZ NPs by neutrophils was measured by flow cytometry analysis, indicating that the cellular uptake of R-SiO2-TPZ NPs by neutrophils was greater than that of S-SiO2-TPZ NPs. The location of the nanodrug within the neutrophils was determined by fluorescence microscopy. The viability of neutrophils after 4 and 8 hours of incubation with the nanodrug was measured by Zombie Green Fixable Viability Kit (BioLegend, San Diego, CA). ( Figure 4F-4G ).

[0223] To quantify the SiO2 loading content, the nanodrug / neutrophil samples were digested by tetramethylammonium hydroxide and high pressure, and the Si concentration of the digested samples was measured by inductively coupled axial plasma optical emission spectrometry (ICP-OES). The cellular Si content in neutrophils was measured to be 11.3 and 19.1 ngSi / μg protein for smooth and rough SiO2 NP@TPZ, respectively ( Figure 4H ). Given its high loading capacity in neutrophils, R-SiO2-TPZ NPs were used in subsequent experiments.

[0224] The physiological function of CAR-neutrophils after loading R-SiO2-TPZ NP was then tested. First, cell viability was analyzed by flow cytometry. In addition, Transwell migration assays were performed. Neutrophils were resuspended in HBSS buffer and allowed to migrate to fMLP (10nM and 100nM) for 2 hours. Cells that migrated to the lower chamber were released with 0.5M EDTA and quantified by Accuri C6 plus cell counter (Beckton Dickinson & Company, Franklin Lakes, NJ). Live neutrophils were gated and analyzed in FlowJo software. Neutrophil counts were then standardized with the total number of cells added to each well.

[0225] 2D chemotaxis assays were also performed. Neutrophils were resuspended in HBBS containing 20mM HEPES and 0.5% fetal bovine serum (FBS), and loaded into collagen-coated IBIDI chemotaxis μ-slides, then incubated at 37°C for 30 minutes to allow cells to adhere. 15 μL 1000nM A-formylmethionyl-leucyl-phenylalanine (fMLP) was loaded into the right reservoir to make the final concentration of fMLP reach 187nM. Cell migration was recorded every 60 seconds at 37°C using LSM 710 (equipped with Ziess EC Plan-NEOFLUAR 10X / 0.3 objective lens) for a total of 120 minutes. Cells were tracked using ImageJ plugin MTrackJ (publicly available).

[0226] Cell viability of CAR-neutrophils before or after loading with R-SiO2-TPZ NPs ( Fig. 4I )、Transwell migration ability( Figure 4J ), chemotaxis and response speed ( Figure 4K-4L ), which demonstrates their high biocompatibility. The expression level of CD11b (a neutrophil surface protein that mediates adhesion and migration functions upon stimulation by inflammatory molecules) was not altered on CAR-neutrophils with or without R-SiO2-TPZ loading ( Fig.13 ) (determined by flow cytometry).

[0227] Activated neutrophils release superoxide or reactive oxygen species (ROS) to kill microorganisms and tumor cells. Nguyen et al., Neutrophils to the ROScue: Mechanisms of NADPH oxidase activation and bacterial resistance, Frontiers in Cellular & Infection Microbiology 7 (2017). Therefore, ROS production was assessed using protocols known in the art. As expected, ROS production by CAR-neutrophils was significantly increased after treatment with N-formylmethionine-leucyl-phenylalanine (fMLP), and no significant difference was observed in ROS production by CAR-neutrophils before and after loading with R-SiO2-TPZ ( Figure 4M ).

[0228] In summary, our data demonstrate that CAR neutrophils loaded with R-SiO2-TPZ retain the physiological activity of wild-type neutrophils and can actively migrate toward inflammatory stimuli, highlighting their potential in targeted cancer chemoimmunotherapy. Example 4 CAR-neutrophils loaded with R-SiO2-TPZ nanoparticles effectively kill GBM cells

[0229] Evaluation of the effect of R-SiO2-TPZ on the tumor killing ability of CAR-neutrophils. Tight effector-target interaction is a prerequisite for neutrophil-mediated cytolysis.

[0230] To visualize the immune synapse, 100 μL of U87MG cells (50,000 cells / mL) were seeded into the wells of a 96-well plate and incubated at 37°C for 12 hours to allow the cells to adhere. Neutrophils (100 μL; 500,000 cells / mL) were then added to the target U87MG cells and incubated for 6 hours, followed by fixation with 4% paraformaldehyde (in PBS). Cytoskeleton staining was then performed using an F-actin Visualization Biochem Kit (F-actin Visualization Biochem Kit, Cytoskeleton Inc., Denver, CO). Somatic cells were also used as controls, following a similar protocol as described above.

[0231] As expected, CAR-neutrophil@R-SiO2-TPZ formed immune synapses with tumor cells within 2 h and exhibited a similar number of effector-target interactions as drug-free CAR-neutrophil ( Figure 5A and Fig.14 ). Notably, no observable interactions were observed between CAR neutrophils@R-SiO2-TPZ and normal somatic cells ( Fig.14 ), highlighting the specificity of CLTX-CAR against brain tumors.

[0232] Furthermore, after 12 h of co-culture, R-SiO2-TPZ NPs were released from neutrophils into the culture medium with intact morphology ( Fig.15A and 15B ) and is partially taken up by the remaining tumor cells ( Figure 5A After CAR neutrophils loaded with SiO2-TPZ NPs were co-incubated with tumor cells for 24 hours, up to 95% of tumor cells took up R-SiO2-TPZ NPs ( Figure 5A and 15C ), indicating a successful delivery cascade involving rupture of carrier neutrophils, exerting effector cell functions, releasing and delivering R-SiO2-TPZ NPs to target tumor cells. To determine the cytolytic effect of CAR-neutrophils loaded with R-SiO2-TPZ NPs, an in vitro normoxic-hypoxic tumor rechallenge model ( Figure 5B ). After 24 h of normoxic co-culture, CAR-neutrophils loaded with or without R-SiO2-TPZ NPs showed similar anti-tumor cytotoxicity ( Figure 5C ), and were higher than the antitumor cytotoxicity of PB-neutrophils loaded or not loaded with R-SiO2-TPZ NPs and SiO2-TPZ NPs alone. This is mainly due to the enhanced tumor targeting ability of neutrophils after CAR engineering.

[0233] After additional hypoxic co-culture with tumor cells for 24 h, CAR-neutrophils loaded with R-SiO2-TPZ NPs showed superior anti-tumor ability compared with other groups ( Figure 5D ). CAR-neutrophils loaded with R-SiO2-TPZ NPs also exhibited excellent cytolytic activity against re-inoculated tumor cells ( Figure 5E ).

[0234] RNA sequencing (RNA-seq) analysis of tumor cells was performed to elucidate the potential molecular mechanisms of CAR expression and R-SiO2-TPZ NP-enhanced neutrophil anti-tumor cell lysis. Gene expression analysis demonstrated that CAR-neutrophils loaded with or without R-SiO2-TPZ NPs significantly reduced the cytoplasmic and membrane fractions of tumor cells compared with controls and R-SiO2-TPZNPs ( Fig.16A and Fig. 5F ), further demonstrating their phagocytic effect on tumor cells when co-cultured. Although all experimental groups increased cellular oxidative stress in tumor cells, CAR-neutrophils loaded with R-SiO2-TPZ were superior to other groups in triggering oxidative stress signals. In addition, CAR-neutrophils loaded with R-SiO2-TPZ significantly promoted tumor cell apoptosis and reduced their proliferation. To further understand the enhanced anti-tumor activity of CAR-neutrophils loaded with R-SiO2-TPZ, the phagocytic inhibitor cytochalasin D and the reactive oxygen species (ROS) inhibitor N-acetylcysteine ​​(NAC) were applied to tumor-neutrophil co-culture. 5μM cytochalasin D ( Fig. 16B ) and 5 mM NAC ( Fig. 16C ) significantly reduced cytolysis of tumor cells by CAR-neutrophils, indicating that phagocytosis and ROS play an important role in CAR-neutrophil-mediated tumor cell killing. Example 5 Functional evaluation of CAR-neutrophils loaded with nanodrugs using an in vitro biomimetic GBM model

[0235] To further evaluate the activity of CAR-neutrophils loaded with R-SiO2-TPZ NPs, a transwell-based blood-brain barrier (BBB) ​​tumor model using human brain microvascular endothelial cells was implemented ( Fig. 6A ). HBEC-5i cells were used to construct an in vitro BBB model in transwell cell culture plates. Briefly, HBEC-5i cells (1×10 5 Cells / well) were seeded into the upper chamber of a 24-well transwell plate (8 μm pore size, 6.5 mm diameter, Corning) pre-coated with gelatin (1% w:v) and maintained in DMEM / F12 medium containing 10% FBS. Neutrophils (2×10 5 ) was added to the upper chamber, and medium without FBS containing or not containing 10 nM fMLP was added to the lower chamber. After 3 h of incubation, cell cultures were collected from the upper or lower chamber to count the number of neutrophils. For cytotoxicity analysis, 2 × 10 4 U87MG cells were seeded in the lower chamber for 12 h, and then neutrophils (2×10 5 10 cells) were added to the upper chamber, and then FBS-free medium with 10 nM fMLP was added to the lower chamber. After 12 h of incubation, tumor cell viability was determined by flow cytometry analysis. For the second migration analysis, 2×10 cells from the bottom chamber of the first migration were added to the upper chamber. 5 Neutrophils were seeded into the upper chamber of a second transwell BBB model, and neutrophil migration toward target tumor cells in the bottom chamber was quantified.

[0236] As expected, CAR-neutrophils loaded with R-SiO2-TPZ NPs exhibited excellent migration ability in the in vitro BBB model ( Figure 6B ), effectively kill target tumor cells after migration ( Figure 6C ) and release more inflammatory cytokines ( Fig.6D ), attracting other effector cells to kill tumors. CAR-neutrophils loaded with R-SiO2-TPZ NPs retained excellent migration ability during the second migration experiment ( Fig. 6E ) and had excellent anti-tumor ability compared with other groups ( Fig. 6F ).

[0237] A three-dimensional (3D) tumor spheroid model was then used to evaluate the tumor penetration ability of CAR-neutrophils loaded with R-SiO2-TPZ NPs ( Figure 6G ). 3D tumor spheroids were generated by the hanging drop method. Briefly, U87MG cells were cultured at 2×10 6Cells / mL were suspended in minimum essential medium (MEM) containing 10% FBS and 0.3% methylcellulose and placed as individual drops on the inverted lid of a 96-well plate using a 20 μL pipette. The lid was then placed back on the bottom chamber filled with PBS and the entire plate was incubated at 37°C and 5% carbon dioxide. The hanging drops were monitored daily until cell aggregates formed within 5-7 days. Each cell aggregate was transferred to a single well of a 24-well plate for subsequent experiments.

[0238] To evaluate the tumor penetration ability of CLTX-CAR neutrophils, 2 × 10 5 Neutrophils / well were added to wells of a 24-well plate and incubated with tumor spheroids. After 24 hours of co-incubation, tumor spheroids were fixed and stained for CD45 and DAPI. For cytotoxicity analysis, live / dead cell staining and CytoTox-Glo were used. TM Cytotoxicity Assay Kit (Promega Corporation, Madison, WI). CytoTox-Glo TM Cytotoxicity assays were quantified using a SpectraMax iD3 microplate reader (Molecular Devices, Sunnyvale, CA).

[0239] After 8 hours of incubation, CAR-neutrophils gradually migrated to the center of the tumor organoids and were evenly distributed in the tumor organoids ( Figure 6H ). A high degree of colocalization between CAR-neutrophils and R-SiO2-TPZ NPs was observed, demonstrating that R-SiO2-TPZ NPs were stably encapsulated in CAR-neutrophils during tumor infiltration. In the absence of neutrophil-mediated delivery, R-SiO2-TPZ NPs were only found in the outer layer of tumor spheroids. Compared with R-SiO2-TPZ NPs and CAR-neutrophils, CAR-neutrophils loaded with R-SiO2-TPZ NPs exhibited excellent anti-tumor cell lysis in a 3D tumor model ( Fig.6I CAR-neutrophil@R-SiO2 NPs can also be used to deliver other drugs, including clinical temozolomide (TMZ) and JNJ64619187, into 3D tumor models and effectively kill GBM cells ( Figures 17A-17C ). In summary, the combination of CAR neutrophils and nanomedicines exhibited excellent antitumor activity under in vitro biomimetic TME conditions, highlighting the therapeutic potential of neutrophil-based combinatorial chemoimmunotherapy. Example 6 In vivo distribution of CAR neutrophil-delivered R-SiO2-TPZ nanoparticles

[0240] In addition to improving direct tumor killing, it is hypothesized that CAR engineering of hPSC-neutrophils will significantly enhance their targeted delivery of therapeutic drugs without the need for additional surgery- or light-induced inflammation. Osuka et al. (2017), supra. To test this hypothesis, a mouse xenograft model of glioblastoma and an in vivo imaging system were used to determine the trafficking and biodistribution of CAR-neutrophils loaded with R-SiO2-TPZ NPs. SiO2 NPs were fluorescently labeled with the near-infrared dye Cyanine 5 (Cy5) and fluorescence imaging was performed at 3 and 24 hours after systemic administration ( Fig. 7A ). Only 3 hours after intravenous injection, R-SiO2-TPZ NPs reached the whole body of tumor-bearing mice and emitted strong fluorescence with or without neutrophil-mediated delivery ( Figure 7B ).

[0241] As expected, CAR-neutrophil-delivered R-SiO2-TPZ NPs eventually accumulated at brain tumor sites within 24 hours, whereas non-neutrophil-delivered R-SiO2-TPZ NPs remained evenly distributed throughout the body ( Figure 7B To further quantify the biodistribution of R-SiO2-TPZ NPs in various organs, inductively coupled plasma optical emission spectroscopy (ICP-OES) analysis of Si content was performed on harvested organs 24 h after injection and confirmed that CAR neutrophil-delivered R-SiO2-TPZ NPs were significantly enriched in the mouse brain ( Figure 7C ), although minimal off-target delivery to the liver and spleen was observed. Histological analysis also confirmed that CAR-neutrophils delivered R-SiO2-TPZ NPs across the BBB to the host brain ( Fig.7D ). In contrast, R-SiO2-TPZ NPs alone accumulated mainly in the liver and spleen. Collectively, our data demonstrate that CAR-neutrophils enhance the targeted delivery of R-SiO2-TPZ NPs without inducing additional inflammation, highlighting the feasibility and safety of neutrophil-based chemoimmunotherapy in cancer treatment. Example 7 Combined chemoimmunotherapy of CAR-neutrophils and R-SiO2-TPZ nanoparticles exhibits excellent anti-glioblastoma activity in vivo

[0242] To determine the therapeutic effect of CAR neutrophils loaded with R-SiO2-TPZ NPs, luciferase-expressing U87MG cells were used to culture neutrophils in immunodeficient NOD.Cg-RAG 1tm1Mom IL tm1WjlA GBM orthotopic xenograft model was established in SzJ / NRG mice. Fig. 8A The protocol for the study is outlined.

[0243] In short, by dividing 5×10 5 The orthotopic xenograft mouse model was constructed by intracranially injecting 5×10 GBM cells expressing luciferase into the brains of immunodeficient mice. 5 U87MG cells expressing luciferase (Luci) were stereotaxically implanted into the right forebrain of NRG mice. All mouse experiments were approved by the Purdue Institutional Animal Care and Use Committee (PACUC). 1tm1Mom IL tm1Wjl / SzJ (NRG) mice were bred and maintained by the Biological Evaluation Core at Purdue University Institute for Cancer Research. All female mice used in this study were 6 to 10 weeks old. Mice were housed in pathogen-free and ventilated cages, with free access to autoclaved food and water, a 12-hour light / dark cycle, a room temperature of 21 ± 2 degrees, and a humidity of 45% to 65%.

[0244] Tumor-bearing mice were intravenously administered 5×10 6 neutrophils, and blood samples were collected from these mice on days 5, 12, 19, and 26. Tumor burden was monitored by a bioluminescence imaging (BLI) system (Spectral Ami Optical Imaging System; Spectral Instruments Imaging, Tucson, AZ). Figure 8B and 8C ), and the body weight of the experimental mice was measured once a week ( Figure 8F). Collected blood cells were stained with CD45 and analyzed in an Accuri C6 plus flow cytometer (Beckton Dickinson & Company, Franklin Lakes, NJ). Blood samples were also subjected to enzyme-linked immunosorbent assay (ELISA) to measure the release of human TNFα and IL-6 cytokines (Invitrogen, Waltham, MA). At the end of treatment, tumors were collected for H&E staining. For in vivo biodistribution analysis, fluorescent images were captured by the Spectral Ami optical imaging system at 3 and 24 hours after intravenous injection of Cy5 (Lumiprobe)-labeled neutrophils.

[0245] The experimental endpoint was defined as death, luciferase signal intensity in bioluminescent imaging above 109a.u., or the development of neurological symptoms (e.g., inactivity, seizures, ataxia, and / or hydrocephalus). Mice with more than 109a.u. or the development of neurological symptoms were euthanized.

[0246] exist Fig. 20B Tumor burden was quantified at 20°C and 40°C. Compared with mice treated with PBS or PB-neutrophils, treatment with CAR-neutrophils and CAR-neutrophil-R-SiO2-TPZ NPs showed higher antitumor cytotoxicity than any other experimental group. In contrast, PB-neutrophils significantly promoted tumor growth in the brain, leading to the death of tumor-bearing mice as early as day 23 ( Fig.7D ), suggesting that engineered neutrophils may pose additional risks.

[0247] Treatment with R-SiO2-TPZ NPs, PB-neutrophils@R-SiO2-TPZ NPs, CAR-neutrophils, and CAR-neutrophils@R-SiO2-TPZ NPs effectively slowed tumor growth in host mice compared to mice treated with PBS or PB-neutrophils. As expected, CAR-neutrophils@R-SiO2-TPZ NPs exhibited higher antitumor cytotoxicity than any other experimental group. In contrast, PB-neutrophils significantly promoted tumor growth in the host brain, leading to the death of tumor-bearing mice as early as day 23 ( Fig.8D ), suggesting that unengineered neutrophils may pose additional risks.

[0248] Human cytokine release in the plasma of different experimental mouse groups was also measured ( Fig. 8E). All non-PBS experimental groups produced detectable TNFα and IL-6 in plasma from day 5 to day 26, indicating that human neutrophils were activated after tumor stimulation. Consistent with the observed higher tumor growth rates, unmodified neutrophils gradually released more IL-6 and TNFα, which may lead to cytokine release syndrome in patients and require more in-depth safety studies with IL-6 blockers. Morris et al., Cytokine release syndrome and associated neurotoxicity in cancer immunotherapy, Nature Reviews Immunology 22: 85-96 (2022); Liang et al., Neutrophils promote the malignant glioma phenotype through S100A4, Clinical Cancer Research 20: 187-198 (2014). Notably, CAR-neutrophil@RSiO2-TPZ NPs exhibited decreased cytokine production at later time points (days 19 and 26), suggesting that patients treated with CAR-neutrophil-based chemoimmunotherapy may be at lower risk for cytokine release syndrome.

[0249] The biocompatibility of the combined CAR-neutrophil and R-SiO2-TPZ NPs was evaluated by measuring body weight and monitoring pathological changes in the main organs of mice weekly. No detectable difference in body weight was observed between mice treated with CAR-neutrophil@R-SiO2-TPZ NPs and any other experimental groups, indicating that CAR-neutrophil@R-SiO2-TPZ NPs had minimal systemic toxicity and excellent biocompatibility within 28 days of treatment ( Figure 8F ).

[0250] Histological analysis of the main organ sections of mice on day 30 showed that CAR-neutrophil@R-SiO2-TPZ NP-treated mice did not cause obvious abnormalities or significant organ damage in the heart, liver, spleen, lung, and kidney ( Fig.18 ), further confirming the safety of the combination of CAR-neutrophils and R-SiO2-TPZ NPs.

[0251] Although CAR-neutrophil@R-SiO2-TPZ NPs significantly slowed tumor growth in xenograft mice, there was no significant difference in animal survival rates among the CAR-neutrophil, SiO2-TPZ NP, and CAR-neutrophil@R-SiO2-TPZ NP experimental groups (p>0.05), which may be due to the death of short-lived neutrophils during cell preparation and injection.

[0252] Next, it was evaluated whether the reduced cell preparation time and increased doses of CAR-neutrophils and nanomedicines would have any effect on the animals (focusing on these three groups) (Figure 20G). When administered systemically for 6 times, CAR-neutrophil@R-SiO2-TPZ NPs were superior to the other two groups in extending the lifespan of tumor-bearing mice (Figure 20H), while the difference in animal survival between the CAR-neutrophil group and the SiO2-TPZ NP group remained insignificant. Although similar survival curves were observed in the R-SiO2-TPZ group in these two independent animal studies, the cell isolation and injection preparation time was reduced from a total of ~4 hours to 1 hour during the first 4 neutrophil doses, resulting in improved animal survival in the CAR neutrophil group before day 32.

[0253] Collectively, these data demonstrate the importance of neutrophil preparation and dose optimization in the clinical application of neutrophil therapy. See Chang et al., CAR-neutrophil mediated delivery of tumor-microenvironment responsive nanodrugs for glioblastoma chemo-immunotherapy, Nature Communications 14:2266 (2023). Example 8 Anti-PSMACAR neutrophils derived from hPSCs specifically recognize and kill prostate cancer cells

[0254] PSMA-CAR Fig.19A The design shown was knocked into the endogenous AAVS1 safe harbor locus by Cas9-mediated homology-directed repair (HDR). The PSMA-CAR consists of a signal peptide, anti-PSMA J591 scFV or nanobody, IgG4-Fc (EQ), CD4 transmembrane (tm), and CD3ζ (CD3z). Genotyping of CAR knock-in in hPSCs showed target efficiency of 12 clones out of a total of 13 clones and 13 clones out of a total of 15 clones, respectively ( Fig.19BCAR-neutrophils were co-cultured with U87MG GBM and LNCaP prostate cancer cells at the indicated cell ratios for 16 h, and the neutrophil cytotoxicity was calculated ( Fig.19C ). Anti-PSMA J591 CAR-neutrophils were loaded with SiO2-TPZ nanodrugs to enhance anti-tumor cytotoxicity and tested in an in vitro hypoxic tumor model ( Fig.19D ).

Claims

1. Neutrophils expressing chimeric antigen receptors (CARs) loaded with drug-containing nanoparticles.

2. A CAR-expressing neutrophil according to claim 1, which is differentiated from a pluripotent stem cell (PSC) engineered to express the CAR.

3. A CAR-expressing neutrophil according to claim 2, wherein the PSC is a human PSC (hPSC).

4. A CAR-expressing neutrophil according to claim 2 or 3, wherein the hPSC comprises human embryonic stem cells (hESC) and / or induced pluripotent stem cells (iPSC).

5. The CAR-expressing neutrophil according to claim 1, wherein the nanoparticles comprise one or more of rough silica nanoparticles, cytosine arabinoside-based liposomes, polyamidoamine dendrimer-albumin nanoparticles and / or fullerenes.

6. The CAR-expressing neutrophil according to claim 5, wherein the rough silica nanoparticles are biodegradable mesoporous organic silica.

7. A CAR-expressing neutrophil according to any one of claims 1-3, 5 or 6, wherein the drug is a prodrug, a chemotherapeutic drug or a radiosensitizer.

8. The CAR-expressing neutrophil according to claim 1, wherein the drug is a prodrug activated by hypoxic conditions, acidic pH, enzymes or radiation.

9. The CAR-expressing neutrophil according to claim 1, wherein the drug is tirapazamine, temozolomide, climacostol or indole-3-acetic acid.

10. The CAR-expressing neutrophil according to claim 1, wherein the drug is selected from the group consisting of everolimus, bevacizumab, belzutifan, carmustine, naxitamab-gqgk and lomustine.

11. A CAR-expressing neutrophil according to any one of claims 1-3, 5, 6 or 8-10, wherein the CAR comprises a 36-amino acid glioblastoma (GBM)-targeting chlorotoxin peptide, a CD32a transmembrane domain, and a CD3ζ intracellular domain.

12. A CAR-expressing neutrophil according to any one of claims 1-3, 5, 6 or 8-10, wherein the CAR comprises a 36-amino acid GBM-targeting chlorotoxin peptide, a CD4 transmembrane domain and a CD3ζ intracellular domain.

13. A CAR-expressing neutrophil according to any one of claims 1-3, 5, 6 or 8-10, wherein the CAR comprises a neutrophil-specific transmembrane domain.

14. A CAR-expressing neutrophil according to any one of claims 1-3, 5, 6 or 8-10, wherein the CAR comprises a 36-amino acid GBM-targeting chlorotoxin peptide, a CD32a transmembrane domain or a CD16 transmembrane domain, and a CD3ζ intracellular signaling domain.

15. A CAR-expressing neutrophil according to any one of claims 1-3, 5, 6 or 8-10, wherein the CAR comprises: A 36-amino acid chlorotoxin peptide targeting GBM; CD32a transmembrane domain or CD16 transmembrane domain; and a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain.

16. A CAR-expressing neutrophil according to any one of claims 1-3, 5, 6 or 8-10, wherein the CAR comprises: A 36-amino acid chlorotoxin peptide targeting GBM; CD32a transmembrane domain or CD16 transmembrane domain; CD32aγ intracellular signaling domain or CD16 intracellular signaling domain; CD3ζ intracellular signaling domain.

17. A CAR-expressing neutrophil according to any one of claims 1-3, 5, 6 or 8-10, wherein the CAR comprises: A 36-amino acid chlorotoxin peptide targeting GBM, Natural killer group 2D (NKG2D) transmembrane domain, 2B4 co-stimulatory domain, and CD3ζ intracellular signaling domain.

18. A CAR-expressing neutrophil according to any one of claims 1-3, 5, 6 or 8-10, wherein the CAR comprises: quadruple mutant IL-13 (TQM13) T-CAR targeting IL-13 receptor α2 (IL-13Rα2), single chain variable fragment (scFV) targeting GD2, scFV targeting human epidermal growth factor receptor 2 (HER2), scFV targeting vIII mutant epidermal growth factor receptor (EGFRvIII), or other scFV targeting glioma, CD4 transmembrane domain, and CD3ζ intracellular signaling domain.

19. The CAR-expressing neutrophil according to claim 1, wherein the neutrophil has an anti-tumor N1 phenotype.

20. The CAR-expressing neutrophil of claim 18, wherein the neutrophil exhibits anti-glioblastoma activity in a hypoxic tumor microenvironment.

21. The CAR-expressing neutrophil according to claim 1, wherein the CAR is encoded by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a functional variant of SEQ ID NO: 2, 3, or 4.

22. A neutrophil-specific chimeric antigen receptor (CAR) construct comprising one or more sequences encoding: Disease-targeting peptides, neutrophil-specific transmembrane domains, and Intracellular domain.

23. The neutrophil-specific CAR construct of claim 22, wherein the neutrophil-specific transmembrane domain is CD32a.

24. The neutrophil-specific CAR construct of claim 22, wherein the neutrophil-specific transmembrane domain is CD4.

25. The neutrophil-specific CAR construct of claim 22, wherein the neutrophil-specific transmembrane domain is NKG2D, Dectin-1, IL-6 receptor or CD16.

26. A neutrophil-specific CAR construct according to claim 22, wherein the disease-targeting peptide is a 36-amino acid GBM-targeting chlorotoxin peptide.

27. A neutrophil-specific CAR construct according to claim 22, wherein the intracellular domain is a CD3ζ signaling domain.

28. A neutrophil-specific CAR construct according to claim 22, wherein the intracellular domain is a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain.

29. A neutrophil-specific CAR construct according to any one of claims 22-26 and 28, further comprising a sequence encoding a CD3ζ intracellular signaling domain.

30. A neutrophil-specific CAR construct according to any one of claims 22-26 and 28, wherein the construct further comprises one or more sequences encoding a 2B4 co-stimulatory domain, and the intracellular domain is a CD3ζ intracellular signaling domain.

31. A neutrophil-specific CAR construct according to any one of claims 22, 24 and 26-28, wherein: The transmembrane domain is a CD4 transmembrane domain, and the intracellular domain is a CD3ζ intracellular signaling domain; and The CAR further comprises one or more sequences encoding: Quadruple mutant IL-13 (TQM13) T-CAR targeting IL-13 receptor α2 (IL-13Rα2), single chain antibody (scFV) targeting GD2, scFV targeting human epidermal growth factor receptor 2 (HER2), scFV targeting vIII mutant epidermal growth factor receptor (EGFRvIII), or other scFVs targeting glioma.

32. A neutrophil-specific CAR construct according to claim 22, comprising SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or a functional variant of SEQ ID NO:2, 3 or 4.

33. An engineered neutrophil cell line comprising a CAR comprising: Disease-targeting peptides, a neutrophil-specific transmembrane domain, and Intracellular domain.

34. An engineered neutrophil cell line according to claim 33, wherein the neutrophil-specific transmembrane domain is CD32a.

35. The engineered neutrophil cell line according to claim 33, wherein the disease-targeting peptide is a 36 amino acid GBM-targeting chlorotoxin peptide.

36. An engineered neutrophil cell line according to claim 33, wherein the neutrophil-specific transmembrane domain is a CD4 transmembrane domain.

37. An engineered neutrophil cell line according to claim 33, wherein the transmembrane domain is NKG2D, Dectin-1, IL-6 receptor or CD16.

38. An engineered neutrophil cell line according to claim 33, wherein the neutrophil-specific transmembrane domain is a CD32a transmembrane domain or a CD16 transmembrane domain.

39. An engineered neutrophil cell line according to any one of claims 33-38, wherein the intracellular domain is a CD3ζ intracellular signaling domain.

40. The engineered neutrophil cell line according to any one of claims 33-38, wherein the intracellular domain comprises a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain.

41. The engineered neutrophil cell line according to claim 33, wherein the CAR comprises: CD32a transmembrane domain or CD16 transmembrane domain, and CD32aγ intracellular signaling domain or CD16 intracellular signaling domain.

42. An engineered neutrophil cell line according to claim 33 or 41, wherein the CAR further comprises a CD3ζ intracellular signaling domain.

43. An engineered neutrophil cell line according to any one of claims 33-38 or 41, wherein the CAR further comprises a 2B4 co-stimulatory domain.

44. The engineered neutrophil cell line according to claim 33, wherein: The disease-targeting peptide is a 36-amino acid chlorotoxin peptide targeting GBM; The neutrophil-specific transmembrane domain is a CD4 transmembrane domain; The intracellular domain is a CD3ζ intracellular signaling domain; and The CAR also includes a quadruple mutant IL-13 (TQM13) T-CAR targeting IL-13 receptor α2 (IL-13Rα2), a single-chain variable fragment (scFV) targeting GD2, a scFV targeting human epidermal growth factor receptor 2 (HER2), a scFV targeting vIII mutant epidermal growth factor receptor (EGFRvIII), or other scFVs targeting gliomas.

45. A pharmaceutical composition comprising: A neutrophil expressing a chimeric antigen receptor (CAR) according to any one of claims 1 to 21 or a neutrophil from an engineered neutrophil cell line according to any one of claims 33 to 44; and Pharmaceutically acceptable carrier and / or diluent.

46. ​​The pharmaceutical composition according to claim 45, further comprising a pharmaceutically acceptable excipient.

47. Use of a neutrophil expressing a chimeric antigen receptor (CAR) according to any one of claims 1-21, an engineered neutrophil cell line according to any one of claims 33-44, or a pharmaceutical composition according to claim 45 or 46 in the preparation of a medicament for treating a disease in a subject.

48. Use according to claim 41, wherein the disease is cancer.

49. Use according to claim 41, wherein the disease is a neurological disorder.

50. A method of treating cancer in a subject, comprising administering to the subject a first therapy comprising a therapeutically effective amount of: A cell population of neutrophils expressing CAR according to any one of claims 1 to 21; A cell population of neutrophils from an engineered neutrophil cell line according to any one of claims 33 to 44; or a pharmaceutical composition according to claim 45 or 46; The subject's cancer is thereby treated.

51. The method according to claim 50, wherein the cancer is brain cancer.

52. The method according to claim 51, wherein the brain cancer is glioblastoma.

53. The method according to claim 50, wherein the cancer is prostate cancer.

54. The method according to any one of claims 50-53, wherein administering the first therapy comprises a delivery route selected from the group consisting of intravenous, intraperitoneal, intramuscular, intradermal, subcutaneous, intrathecal, intraosseous, and any combination of the foregoing.

55. The method of claim 50, further comprising administering to the subject a second therapy.

56. The method of claim 55, wherein the second therapy comprises surgically removing cancer cells from the subject.

57. The method of claim 55, wherein the second therapy comprises chemotherapy, radiation therapy, or both.

58. The method according to any one of claims 50-57, further comprising imaging cancer in the subject before or during administration of the first and / or second therapy.

59. The method according to claim 55, wherein the first and second therapies are administered sequentially and / or alternatively.

60. A method of delivering a therapeutic agent to a target location in a subject suffering from a disease, the method comprising administering to the subject a first therapy comprising a therapeutically effective amount of: A cell population of neutrophils expressing CAR according to any one of claims 1 to 21; A cell population of neutrophils from an engineered neutrophil cell line according to any one of claims 33 to 44; or a pharmaceutical composition according to claim 45 or 46, wherein the target location is across the blood-brain barrier of the subject relative to the site of administration.

61. The method according to claim 60, wherein the disease is brain cancer.

62. The method according to claim 61, wherein the disease is glioblastoma.

63. The method according to claim 60, wherein the disease is a neurological disorder.

64. The method according to claim 63, wherein the neurological disorder involves aggregation of an aggregation-prone protein.

65. The method of claim 63, wherein the neurological disorder is a tauopathy.

66. The method according to claim 63, wherein the neurological disorder is Alzheimer's disease or Parkinson's disease.

67. The method of claim 60, further comprising administering to the subject a second therapy.

68. The method of claim 67, wherein the second therapy comprises surgically removing cancer cells from the subject.

69. The method of claim 67, wherein the second therapy comprises chemotherapy, radiation therapy, or both.

70. The method according to any one of claims 60-69, further comprising imaging the target location in the subject before or during administration of the first and / or second therapy.

71. The method according to any one of claims 60-69, wherein the target location comprises brain tissue.

72. The method according to any one of claims 63-66, wherein the second therapy comprises a microtubule stabilizer.

73. The method according to any one of claims 67-69, wherein the first and second therapies are administered sequentially and / or alternatively.

Images