Novel CRISPR-Cas12f system and application thereof

Abstract

Provided are Cas12f polypeptides, fusion proteins comprising such Cas12f polypeptides, CRISPR-Cas12f systems comprising such Cas12f polypeptides or fusion proteins, and methods of use thereof.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of and priority to PCT patent application No. PCT / CN2022 / 089053, entitled “NOVEL CRISPR-CAS SYSTEMS AND USES THEREOF,” filed on April 25, 2022, and PCT patent application No. PCT / CN2022 / 142467, entitled “NOVEL CRISPR-CAS SYSTEMS AND USES THEREOF,” filed on December 27, 2022, the entire contents of which, including any sequence listings and drawings, are incorporated herein by reference in their entirety.

[0003] References to Electronic Sequence Listings

[0004] The present disclosure contains an electronic sequence listing ("HEP003PCT-Sequence listing.xml", created on May 17, 2023 by the software "WIPOSequence" in accordance with WIPO Standard ST.26), which is incorporated herein by reference in its entirety. According to WIPO Standard ST.26, the symbol "t" is used to represent both T in DNA and U in RNA (see "Table 1: List of Nucleotide Symbols", the definition of the symbol "t" is "thymine in DNA / uracil in RNA (t / u)"). Therefore, in the sequence listing prepared according to ST.26, in any case where the sequence is RNA, T in the sequence should be regarded as U. Background Art

[0005] Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes (collectively referred to as CRISPR-Cas or CRISPR / Cas systems) are adaptive immune systems in archaea and bacteria that protect specific species from foreign genetic elements.

[0006] Citation or identification of any document in this disclosure is not an admission that the document is available as prior art to the present disclosure. Each reference mentioned or cited in this disclosure is incorporated by reference in its entirety. Summary of the invention

[0007] In view of the above background technology, the present disclosure provides certain advantages and advances over the prior art. Although the present disclosure is not limited to specific advantages or functions, in one aspect, the present disclosure provides a Cas12f polypeptide, the Cas12f polypeptide comprising an amino acid sequence having at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity with any one of SEQ ID NO: 1-34 (optionally any one of SEQ ID NO: 1, 2, 4, 5, 15, 28, 29, 31 and 32).

[0008] In another aspect, the present disclosure provides a system comprising:

[0009] (1) a Cas12f polypeptide or a polynucleotide encoding the Cas12f polypeptide, the Cas12f polypeptide comprising an amino acid sequence having at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31 and 32); and

[0010] (2) a guide nucleic acid or a polynucleotide encoding the guide nucleic acid, wherein the guide nucleic acid comprises:

[0011] (i) a scaffold sequence capable of forming a complex with the Cas12f polypeptide; and

[0012] (ii) a guide sequence capable of hybridizing to a target sequence of a target DNA, thereby directing the complex to the target DNA.

[0013] In yet another aspect, the present disclosure provides a polynucleotide encoding the Cas12f polypeptide of the present disclosure.

[0014] In yet another aspect, the present disclosure provides a delivery system comprising (1) a Cas12f polypeptide of the present disclosure, a polynucleotide of the present disclosure, or a system of the present disclosure; and (2) a delivery vehicle.

[0015] In yet another aspect, the present disclosure provides a vector comprising a polynucleotide of the present disclosure; optionally, wherein the vector encodes a guide nucleic acid as defined in the present disclosure; optionally, wherein the vector is a plasmid vector, a recombinant AAV (rAAV) vector or a recombinant lentiviral vector.

[0016] In yet another aspect, the present disclosure provides a ribonucleoprotein (RNP) comprising a Cas12f polypeptide of the present disclosure and, optionally, a guide nucleic acid as defined in the present disclosure.

[0017] In yet another aspect, the present disclosure provides lipid nanoparticles (LNPs) comprising the Cas12f polypeptide of the present disclosure 9 or the system of the present disclosure.

[0018] In yet another aspect, the present disclosure provides a method for modifying a target DNA, the method comprising contacting the target DNA with the system of the present disclosure, the vector of the present disclosure, the ribonucleoprotein of the present disclosure, or the lipid nanoparticle of the present disclosure, wherein the spacer sequence is capable of hybridizing with a target sequence of the target DNA, wherein the target DNA is modified by the complex.

[0019] In yet another aspect, the disclosure provides cells modified by the methods of the disclosure.

[0020] In yet another aspect, the present disclosure provides a pharmaceutical composition comprising (1) the system of the present disclosure, the vector of the present disclosure, the ribonucleoprotein of the present disclosure, the lipid nanoparticle of the present disclosure, or the cell of the present disclosure; and (2) a pharmaceutically acceptable excipient.

[0021] In yet another aspect, the present disclosure provides a method for diagnosing, preventing or treating a disease in a subject in need thereof, the method comprising administering to the subject the system of the present disclosure, the vector of claim 29, the ribonucleoprotein of the present disclosure, the lipid nanoparticle of the present disclosure, the cell of the present disclosure or the pharmaceutical composition of the present disclosure, wherein the disease is associated with a target DNA, wherein the spacer sequence is capable of hybridizing with a target sequence of the target DNA, wherein the target DNA is modified by the complex, and wherein modification of the target DNA diagnoses, prevents or treats the disease.

[0022] The details of one or more embodiments of the present disclosure are set forth in the following description. Other features or advantages of the present disclosure should be clear from the following drawings and detailed description of several embodiments and from the claims. It should be understood that, unless otherwise indicated, any aspect or embodiment of the present disclosure may be combined with any other aspect or embodiment of the present disclosure to constitute another embodiment explicitly or implicitly disclosed herein.

[0023] Overview

[0024] Cas12f, as a subtype of Class 2 V-type CRISPR-associated protein (Cas12), can bind to or act on a target nucleic acid (e.g., dsDNA), such as guided by a guide nucleic acid (e.g., guide RNA (gRNA, used interchangeably with single guide RNA or sgRNA in the disclosure)) comprising a guide sequence targeting the target nucleic acid. In some embodiments, the target nucleic acid is a eukaryotic nucleic acid.

[0025] Without wishing to be bound by theory, in some embodiments, the guide nucleic acid comprises a scaffold sequence responsible for forming a complex with Cas12f, and a guide sequence (used interchangeably with a spacer sequence in the present disclosure) intentionally designed to be responsible for hybridizing with a target sequence of a target nucleic acid, thereby directing the complex comprising Cas12f and the guide nucleic acid to the target nucleic acid.

[0026] refer to Fig.24 , an exemplary target dsDNA (eg, a target gene) is depicted as comprising a 5' to 3' single DNA strand and a 3' to 5' single DNA strand.

[0027] Exemplary guide nucleic acids are described as comprising a guide sequence and a scaffold sequence. The guide sequence is designed to hybridize with a portion of a 3' to 5' single DNA strand, and the guide sequence is therefore "targeted" to this portion. Therefore, the 3' to 5' single DNA strand is referred to as the "target strand (TS)" of the target dsDNA, and the opposite 5' to 3' single DNA strand is referred to as the "non-target strand (NTS)" of the target dsDNA. This portion of the target strand based on which the guide sequence is designed and to which the guide sequence can hybridize is referred to as the "target sequence", and the opposite portion corresponding to this portion on the non-target strand is referred to as the "protospacer sequence", which is 100% (completely) reverse complementary to the target sequence.

[0028] Typically, nucleic acid sequences (eg, DNA sequences, RNA sequences) are written in a 5' to 3' direction / orientation.

[0029] For example, for the DNA sequence of ATGC, unless otherwise indicated, it is generally understood as 5'-ATGC-3'. Its reverse sequence is 5'-CGTA-3', its complete complement sequence is 5'-TACG-3', and its complete reverse complement sequence is 5'-GCAT-3'.

[0030] In general, unless otherwise indicated, the double-stranded sequence of a dsDNA may be represented by the sequence of its 5' to 3' single DNA strand, conventionally written in a 5' to 3' direction / orientation.

[0031] For example, for a dsDNA having a 5' to 3' single DNA strand of 5'-ATGC-3' and a 3' to 5' single DNA strand of 3'-TACG-5', the dsDNA can be simply represented as 5'-ATGC-3'.

[0032] 5'-----ATGC-----3'

[0033] 3'-----TACG-----5'

[0034] It should be noted that the 5' to 3' single DNA strand or the 3' to 5' single DNA strand of the dsDNA may be a non-target strand from which the protospacer sequence is selected, or may be a target strand to which the guide sequence is designed to hybridize.

[0035] Typically, for a gene that is dsDNA, the 5' to 3' single DNA strand is the sense strand of the gene, and the 3' to 5' single DNA strand is the antisense strand of the gene. However, it should be noted that the sense strand or antisense strand of the gene can be a non-target strand from which the protospacer sequence is selected, or can be a target strand to which the guide sequence is designed to hybridize.

[0036] To hybridize to the target dsDNA, in one embodiment, the guide sequence of the guide nucleic acid (e.g., guide RNA) is designed to have a 5'-AUGC-3' RNA sequence that is completely reverse complementary to the 3' to 5' strand of the target dsRNA, which sequence will be listed in ATGC in the electronic sequence listing, but annotated as RNA; and in another embodiment, the guide sequence of the guide nucleic acid (e.g., guide RNA) is designed to have a 5'-GCAU-3' RNA sequence that is completely reverse complementary to the 5' to 3' strand of the target dsRNA, which sequence will be listed in GCAT in the electronic sequence listing, but annotated as RNA.

[0037] In the case where the guide sequence of the guide nucleic acid is completely reverse complementary to the target sequence and the target sequence is completely reverse complementary to the protospacer sequence, the guide sequence is identical to the protospacer sequence except for U in the guide sequence (if it is an RNA sequence) and T in the corresponding protospacer sequence. According to WIPO Standard ST.26, the symbol "t" is used to represent both T in DNA and U in RNA (see "Table 1: List of Nucleotide Symbols", the definition of the symbol "t" is "thymine in DNA / uracil in RNA (t / u)"). Therefore, in the sequence table of the present disclosure prepared according to ST.26, such a guide sequence can be listed in the same order as the corresponding protospacer sequence. For convenience, a single SEQ ID NO in the sequence table can be used to represent both such a guide sequence and the protospacer sequence, although such a single SEQ ID NO can be marked as DNA or RNA in the sequence table. When referring to such a SEQ ID NO listing the protospacer sequence / guide sequence, it refers to the protospacer sequence as a DNA sequence or the guide sequence which can be an RNA sequence according to the context, regardless of whether it is marked as DNA or RNA in the sequence table.

[0038] the term

[0039] Unless otherwise specified, all technical and scientific terms used in this disclosure have the meanings commonly understood by those of ordinary skill in the art to which this disclosure belongs. Throughout the specification, several terms defined in the following paragraphs are used. Other definitions are also found in the body of the specification.

[0040] As used herein, the terms "nucleic acid", "nucleic acid molecule" or "polynucleotide" are used interchangeably. They refer to polymers of deoxyribonucleotides or ribonucleotides or mixtures thereof in single-stranded or double-stranded form, and unless otherwise specified, also encompass known analogs of natural nucleotides that can function in a manner similar to naturally occurring nucleotides. These terms encompass nucleic acid-like structures with synthetic backbones as well as amplification products. Both DNA and RNA are polynucleotides. The polymer may include natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, C5-propynylcytidine, C5-propynyluridine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-methylcytidine, 7-deoxy ... The invention also includes bases selected from the group consisting of 5′-nitrogen adenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2′-fluororibose, ribose, 2′-deoxyribose, arabinose and hexose), or modified phosphate groups (e.g., phosphorothioate and 5′-N-phosphoramidite bonds).

[0041] As used herein, the terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also encompasses amino acid polymers that have been modified; for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.

[0042] As used herein, "fusion protein" refers to a protein created by joining two or more originally separate proteins or parts thereof. In some embodiments, a linker may be present between each protein.

[0043] As used herein, the term "heterologous" in reference to polypeptide domains refers to the fact that the polypeptide domains do not naturally occur together (e.g., in the same polypeptide). For example, in an artificially generated fusion protein, a polypeptide domain from one polypeptide can be fused with a polypeptide domain from a different polypeptide. Two polypeptide domains will be considered "heterologous" to each other because they do not naturally occur together.

[0044] As used herein, the term "nuclease" refers to a polypeptide capable of cleaving phosphodiester bonds between nucleotide subunits of a nucleic acid; the term "endonuclease" refers to a polypeptide capable of cleaving phosphodiester bonds within a polynucleotide chain.

[0045] As used herein, the term "Cas12f" is used interchangeably with Cas12f protein or Cas12f polypeptide in the present disclosure and is used in its broadest sense and includes a parent or reference Cas12f protein (e.g., a Cas12f protein comprising any one of SEQ ID NOs: 1-34), derivatives or variants thereof, and functional fragments thereof, such as nucleic acid-binding fragments thereof, including endonuclease-deficient (inactive) Cas12f polypeptides and Cas12f nickases.

[0046] As used herein, the term "guide nucleic acid" refers to a nucleic acid-based molecule capable of forming a complex with a CRISPR-Cas protein (e.g., Cas12f of the present disclosure) (e.g., via a scaffold sequence of a guide nucleic acid), and comprises a sequence (e.g., a guide sequence) that is fully complementary to a target nucleic acid to hybridize with the target nucleic acid and guide the complex to the target nucleic acid, the nucleic acid including but not limited to RNA-based molecules, such as guide RNA. As used herein, the term "single guide RNA (sgRNA)" is used interchangeably with guide RNA (gRNA) or RNA guides. As used in the present disclosure, the term "guide sequence" is used interchangeably with the term "spacer sequence". A guide nucleic acid can be a DNA molecule, an RNA molecule, or a DNA / RNA mixture molecule. "DNA / RNA mixture molecule" refers to a nucleic acid comprising one or more modified or unmodified ribonucleotides and one or more modified or unmodified deoxyribonucleotides, whether or not continuous. However, a "DNA molecule" or "RNA molecule" may also refer to a DNA molecule containing one or more modified or unmodified ribonucleotides, whether consecutive or not, or an RNA molecule containing one or more modified or unmodified deoxyribonucleotides, whether consecutive or not.

[0047] As used herein, the term "complex" refers to the grouping of two or more molecules. In some embodiments, the complex comprises polypeptides and nucleic acids that interact with each other (e.g., bind, contact, adhere). As used herein, the term "complex" may refer to the grouping of guide nucleic acids and polypeptides (e.g., Cas12f polypeptides). As used herein, the term "complex" may refer to the grouping of guide nucleic acids, polypeptides, and target nucleic acids.

[0048] As used herein, the term "activity" refers to biological activity. In some embodiments, the activity includes enzymatic activity, such as the catalytic ability of the effector. For example, the activity can include nuclease activity, such as DNA nuclease activity, dsDNA endonuclease activity, guide sequence-specific (on-target) dsDNA endonuclease activity, guide sequence-independent (off-target) dsDNA endonuclease activity.

[0049] As used herein, unless otherwise indicated, the term "guide sequence-specific (on-target) dsDNA cleavage" may be referred to simply as "dsDNA cleavage."

[0050] As used herein, the term "cleavage" refers to the breakage of the covalent backbone of a DNA molecule. Cutting can be performed by a variety of methods, including but not limited to enzymatic or chemical hydrolysis of phosphodiester bonds. Both single-stranded and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two different single-stranded cleavage events. DNA cleavage can result in the production of blunt ends or sticky ends.

[0051] As used herein, the meanings of "cleaved nucleic acid" or "modified nucleic acid" may overlap. Modified nucleic acid includes not only modification of single nucleotides, but also insertion or deletion of nucleic acid fragments.

[0052] As used herein, the term "on-target" refers to a predetermined or intended region of DNA that is bound, cut and / or edited, for example, by Cas12f of the present disclosure.

[0053] As used herein, the term "off-target" refers to an unintended or unexpected region of DNA that is bound, cut, and / or edited, for example, by Cas12f of the present disclosure. In some embodiments, when a DNA region is different from a DNA region that is predetermined or expected to be bound, cut, and / or edited by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides, the DNA region is an off-target region.

[0054] As used herein, if a DNA sequence, e.g., 5'-ATGC-3', is transcribed into an RNA sequence, and each dT (deoxythymidine, or "T" for short) in the primary sequence of the DNA sequence is replaced with U (uridine), and each dA (deoxyadenosine, or "A" for short), dG (deoxyguanosine, or "G" for short), and dC (deoxycytidine, or "C" for short) is replaced with A (adenosine), G (guanosine), and C (cytidine), respectively, e.g., 5'-AUGC-3', then the DNA sequence is said in the present disclosure to "encode" the RNA sequence.

[0055] As used herein, the term "protospacer adjacent motif" or "PAM" refers to a short sequence (or motif) adjacent to the protospacer sequence on the non-target strand of dsDNA that is recognized by the CRISPR complex.

[0056] As used herein, the term "adjacent" includes the situation where there are no nucleotides between the original spacer sequence and the PAM, and the situation where there are a small number (e.g., 1, 2, 3, 4, or 5) of nucleotides between the original spacer sequence and the PAM. As used herein, A is "adjacent" to B (adjacent to B), A is "adjacent" to the 5' of B, and A is "adjacent" to the 3' of B means that there are no nucleotides between A and B.

[0057] As described herein, the guide sequence is designed to be able to hybridize with the target sequence. As used herein, the term "hybridization (hybridize, hybridizing or hybridization)" refers to a reaction in which one or more polynucleotide sequences react to form a complex, which is stabilized via hydrogen bonds between the bases of one or more polynucleotide sequences. Hydrogen bonds can occur by Watson Crick base pairing, Hoogstein binding or in any other sequence-specific manner. The polynucleotide sequence that can hybridize with a given polynucleotide sequence is referred to as the "complementary sequence" of a given polynucleotide sequence. As used herein, the hybridization of the guide sequence and the target sequence is so stable that the Cas12f polypeptide of the guide nucleic acid compound containing the guide sequence or the functional domain (e.g., deaminase domain) associated with the Cas12f polypeptide (e.g., fusion) works (e.g., cutting, deamination) at or near the target sequence or its complementary sequence (e.g., target DNA sequence or its complementary sequence).

[0058] For the purpose of hybridization, in some embodiments, the guide sequence is reverse complementary to the target sequence. As used herein, the term "complementary" refers to the ability of the nucleobase of the first polynucleotide sequence (such as a guide sequence) to base pair with the nucleobase of the second polynucleotide sequence (such as a target sequence) by traditional Watson Crick base pairing. Two complementary polynucleotide sequences can be non-covalently bound under appropriate temperature and solution ionic strength conditions. In some embodiments, the first polynucleotide sequence (e.g., a guide sequence) has 100% (complete) complementarity with the second nucleic acid (e.g., a target sequence). In some embodiments, if the first polynucleotide sequence (e.g., a guide sequence) has at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementarity with the second nucleic acid, the first polynucleotide sequence is complementary to the second nucleic acid. As used herein, the term "substantially complementary" refers to a polynucleotide sequence (e.g., a guide sequence) having a degree of complementarity with a second polynucleotide sequence (e.g., a target sequence) such that a first polynucleotide sequence (e.g., a guide sequence) can hybridize with a second polynucleotide sequence (e.g., a target sequence) with sufficient affinity to allow the Cas12f polypeptide to act (e.g., cleave, deaminase) on a target sequence or its complementary sequence (e.g., a target DNA sequence or its complementary sequence) by complexing the first polynucleotide sequence or a nucleic acid comprising the first polynucleotide sequence or a functional domain associated with the Cas12f polypeptide (e.g., fused). In some embodiments, a guide sequence that is substantially complementary to a target sequence has 100% or less complementarity with the target sequence. In some embodiments, a guide sequence that is substantially complementary to a target sequence has at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity to the target sequence.

[0059] As used herein, the term "identity" refers to the overall correlation between polymer molecules, for example, between nucleic acid molecules (for example, DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, if the sequence of a polymer molecule has at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity, then they are considered to be "substantially identical" to each other. The calculation of the identity percentage of two nucleic acids or polypeptide sequences can be performed by comparing two sequences for the best comparison purpose (for example, a room can be introduced in one or both of the first sequence and the second sequence to achieve the best comparison, and different sequences can be ignored for the purpose of comparison). In some embodiments, the sequence length compared for the purpose of comparison is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or substantially 100% of the length of the reference sequence. The nucleotide at the corresponding position is then compared. The determination of the identity percentage between the comparison of the sequence and the two sequences can be completed using a mathematical algorithm. As well known in the art, amino acid or nucleotide sequence can use any of the various algorithms to compare, including those algorithms available in the commercial computer program, such as BLASTN for nucleotide sequence and BLASTP, gap BLAST and PSI-BLAST for amino acid sequence. In some embodiments, sequence identity is by global comparison, for example, using the online tool at the Needleman-Wunsch algorithm and ebi.ac.uk / Tools / psa / emboss_needle / to calculate. In some embodiments, sequence identity is by local comparison, for example, using the online tool at the Smith-Waterman algorithm and ebi.ac.uk / Tools / psa / emboss_water / to calculate.

[0060] As used herein, the term "variant" refers to an entity that shows significant structural identity with a reference entity (e.g., a wild-type sequence), but is structurally different from the reference entity in terms of the presence or level of one or more chemical moieties compared to the reference entity. In many embodiments, the variant is also functionally different from its reference entity. In general, whether a particular entity is appropriately regarded as a "variant" of a reference entity is based on its degree of structural identity with the reference entity. As understood by those skilled in the art, any biological or chemical reference entity has certain characteristic structural elements. By definition, a variant is a unique chemical entity that shares one or more such characteristic structural elements. To name just a few examples, a polypeptide can have a characteristic sequence element that includes a plurality of amino acids that have a specified position relative to each other in a linear or three-dimensional space and / or contribute to a specific biological function; a nucleic acid can have a characteristic sequence element that includes a plurality of nucleotide residues that have a specified position relative to each other in a linear or three-dimensional space. For example, a variant polypeptide may differ from a reference polypeptide due to one or more differences in an amino acid sequence and / or one or more differences in a chemical moiety (e.g., carbohydrates, lipids, etc.) covalently attached to a polypeptide backbone. In some embodiments, the variant polypeptide shows an overall sequence identity with a reference polypeptide (e.g., a nuclease described herein), which is at least 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Alternatively or in addition, in some embodiments, the variant polypeptide does not share at least one characteristic sequence element with the reference polypeptide. In some embodiments, the reference polypeptide has one or more biological activities. In some embodiments, the variant polypeptide shares one or more biological activities of the reference polypeptide, such as nuclease activity. In some embodiments, the variant polypeptide lacks one or more biological activities of the reference polypeptide. In some embodiments, compared with the reference polypeptide, the variant polypeptide shows a reduced level of one or more biological activities (e.g., nuclease activity, such as off-target nuclease activity). In some embodiments, if the polypeptide of interest has the same amino acid sequence as the parent, but has a small amount of sequence changes at a specific position, the polypeptide of interest is considered to be a "variant" of the parent or reference polypeptide. Typically, less than 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% of the residues in the variant are substituted compared to the parent or reference polypeptide. In some embodiments, the variant has 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 substituted residues compared to the parent or reference polypeptide. Variants often have a very small number (e.g., less than 5, 4, 3, 2 or 1) of substituted functional residues (i.e., residues involved in a specific biological activity).In some embodiments, compared with the parent or reference polypeptide, the variant has no more than 5, 4, 3, 2 or 1 additions or deletions, and often no additions or deletions. In addition, any addition or deletion is typically less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, about 10, about 9, about 8, about 7, about 6 residues, and usually less than about 5, about 4, about 3 or about 2 residues. In some embodiments, the parent or reference polypeptide is wild type. The variant of polynucleotides or polypeptides can be naturally occurring, such as allelic variants, or it can be a variant known to be not naturally occurring. Non-naturally occurring variants of polynucleotides and polypeptides can be prepared by mutagenesis techniques, by direct synthesis and by other recombinant methods known to those skilled in the art.

[0061] As used herein, the terms "non-naturally occurring" and "engineered" are used interchangeably and refer to human involvement. When these terms are used to describe a nucleic acid or polypeptide, it means that the nucleic acid or polypeptide is at least substantially free of at least one other component with which it is found in nature or in association with nature.

[0062] Conservative substitutions of non-critical amino acids of a protein can be made without affecting the normal function of the protein. Conservative substitutions refer to replacing an amino acid with a chemically or functionally similar amino acid. In some embodiments, conservative amino acid substitutions refer to amino acid substitutions that do not change the relative charge or size characteristics of the protein in which the amino acid substitution is made. In some embodiments, "conservative substitutions" refer to amino acid substitutions made to amino acids in the following groups: i) methionine, isoleucine, leucine, valine, ii) phenylalanine, tyrosine, tryptophan, iii) lysine, arginine, histidine, iv) alanine, glycine, v) serine, threonine, vi) glutamine, asparagine and vii) glutamic acid, aspartic acid.

[0063] As used herein, the term "wild type" has the meaning generally understood by those skilled in the art, i.e., refers to the typical form of an organism, strain, gene or characteristic, which, when it occurs in nature, distinguishes it from a mutant or variant. It can be isolated from a source in nature without being intentionally modified.

[0064] As used herein, the description of "a variant (e.g., Cas12f polypeptide) comprising an amino acid mutation (e.g., substitution) at a given position (e.g., position 52) of a given polypeptide (e.g., SEQ ID NO: 1)" or similar descriptions means that the polypeptide listed in the amino acid sequence of a given polypeptide serves as a parent or reference polypeptide, and the variant is a variant of the parent or reference polypeptide, and comprises an amino acid mutation at the position of the amino acid sequence of the variant corresponding to a given position of the amino acid sequence of a given polypeptide. The position of the amino acid mutation in the amino acid sequence of the variant can be the same as the given position of the given polypeptide, for example, when the variant only comprises an amino acid substitution compared to the given polypeptide and has the same length as the given polypeptide. The position of the amino acid mutation in the amino acid sequence of the variant can also be different from the given position of the given polypeptide, for example, when the variant comprises an N-terminal truncation compared to the given polypeptide and the first N-terminal amino acid of the variant does not correspond to the first N-terminal amino acid of the given polypeptide, but corresponds to the amino acid within the given polypeptide, but the position of the amino acid mutation can be determined by comparing the variant with the given polypeptide to identify the corresponding amino acid in its sequence, as understood by those skilled in the art. For example, if a variant has an N-terminal truncation of 20 amino acids compared to a given polypeptide, then the variant comprises an amino acid mutation at position 52 of the given polypeptide means that the variant comprises an amino acid mutation at position 32 of the variant, because position 32 in the variant corresponds to position 52 in the given polypeptide, as determined by alignment of the variant and the given polypeptide.

[0065] As used herein, the description of "a variant (e.g., Cas12f polypeptide) comprising a given amino acid substitution (e.g., D52R) relative to a given polypeptide (e.g., SEQ ID NO: 1)" means that the polypeptide listed in the amino acid sequence of the given polypeptide serves as a parent or reference polypeptide that does not comprise a given amino acid substitution, and the variant is a variant of the parent or reference polypeptide, and comprises an amino acid substitution having the same substitution type as the given amino acid substitution at a position in the amino acid sequence of the variant corresponding to the position of the given amino acid substitution. For example, a Cas12f polypeptide comprising an amino acid substitution D52R relative to SEQ ID NO: 1 refers to the fact that the amino acid sequence of SEQ ID NO: 1 comprises an amino acid D at position 52, and the Cas12f polypeptide comprises an amino acid R at a position corresponding to position 52 of the amino acid sequence of SEQ ID NO: 1. The correspondence of positions in two amino acid sequences as determined by comparison is explained in the previous paragraph.

[0066] As used herein, the terms "upstream" and "downstream" refer to relative positions within a single nucleic acid (e.g., DNA) sequence in a nucleic acid. "Upstream" and "downstream" are respectively related to the 5' to 3' direction in which transcription occurs. For a first sequence and a second sequence present on the same strand of a single nucleic acid written in a 5' to 3' direction, when the 3' end of the first sequence is to the left of the 5' end of the second sequence, the first sequence is located upstream of the second sequence, and when the 5' end of the first sequence is to the right of the 3' end of the second sequence, the first sequence is located downstream of the second sequence. For example, a promoter is typically located upstream of a sequence under the regulation of the promoter; and on the other hand, a sequence under the regulation of the promoter is typically located downstream of the promoter.

[0067] As used herein, the term "regulatory element" refers to a DNA sequence that controls or affects one or more aspects of transcription and / or expression, and is intended to include promoters, enhancers, silencers, termination signals, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences). Regulatory elements include those that direct constitutive expression of nucleotide sequences in many types of host cells, and those that direct expression of nucleotide sequences only in certain host cells (e.g., tissue-specific regulatory sequences). Regulatory elements can also direct expression in a time-dependent manner, such as in a cell cycle-dependent or developmental stage-dependent manner, which may or may not be tissue or cell type specific.

[0068] As used herein, the term "operably linked" refers to a juxtaposition in which the components described are in a relationship that allows them to function in the intended manner. A regulatory element that is "operably linked" to a functional element is associated in such a way that transcription, expression, and / or activity of the functional element is achieved under conditions that are compatible with the regulatory element. In some embodiments, an "operably linked" regulatory element is contiguous (e.g., covalently linked) with a functional element of interest; in some embodiments, the regulatory element trans-acts on a functional element of interest or is otherwise kept at a distance from the functional element of interest.

[0069] As used herein, the term "cell" is understood to refer not only to a particular individual cell, but also to the progeny or potential progeny of the cell. Because certain modifications may occur in subsequent generations due to mutations or environmental influences, such progeny may not in fact be different from the parent cell, but are still included within the scope of the term.

[0070] As used herein, the term "in vivo" means inside an organism, and the term "ex vivo" or "in vitro" means outside an organism.

[0071] As used herein, the term "treatment" is a method for obtaining beneficial or desired results (including clinical results). For the purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviating one or more symptoms caused by the disease, weakening the degree of the disease, stabilizing the disease (e.g., preventing or delaying the deterioration of the disease), preventing or delaying the spread of the disease (e.g., metastasis), preventing or delaying the recurrence of the disease, reducing the recurrence rate of the disease, delaying or slowing down the progress of the disease, improving the disease state, providing relief (partial or complete) of the disease, reducing the dosage of one or more other drugs required for the treatment of the disease, delaying disease progression, increasing the quality of life and prolonging survival. The term also encompasses the pathological results of reducing diseases (such as cancer). The method of this disclosure contemplates any one or more of these therapeutic aspects of treatment.

[0072] As used herein, the term "disease" includes the terms "disorder" and "condition", and is not limited to those specific diseases that have been medically or clinically defined.

[0073] As used herein, reference to a value or parameter that is "not" generally means and describes a value or parameter that is "different from." For example, a method is not for treating cancer type X, meaning that the method can be used to treat cancers other than type X.

[0074] As used herein, the singular forms "a, an," and "the" include plural referents unless the context clearly dictates otherwise. That is, the articles "a, an," and "the" are used herein to refer to one or more than one (i.e., at least one) of the grammatical objects of the article. For example, "an" means one element or more than one element, for example, two elements.

[0075] As used herein, the term "and / or" in phrases such as "A and / or B" is intended to mean one or both of the alternatives, including both A and B, A or B, A (alone), and B (alone). Likewise, the term "and / or" in phrases such as "A, B, and / or C" is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0076] As used herein, when the term "about" precedes a series of numbers (e.g., about 1, 2, 3), it is understood that each of the series of numbers is modified by the term "about" (i.e., about 1, about 2, about 3). The term "about XY" as used herein has the same meaning as "about X to about Y".

[0077] As used herein, unless otherwise stated or otherwise apparent from the context, when referring to numbers, the terms "about" and "approximately" are used herein to include numbers that fall within a range of 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% in either direction (greater or less than) of the number (except where such number would exceed 100% of the possible value).

[0078] As used herein, a numerical range includes the end value of the range and each specific value within the range, for example, "16 to 100 nucleotides" includes 16 nucleotides and 100 nucleotides and each specific value between 16 and 100, for example, 17, 23, 34, 52, 78.

[0079] As used herein, unless the context requires otherwise, the terms "comprise", "include", "contain", and "have" should be understood to imply the inclusion of the stated element or group of elements but not the exclusion of any other element or group of elements. In certain embodiments, the terms "comprise", "include", "contain", and "have" are used synonymously.

[0080] As used herein, the phrase "consisting essentially of is intended to include any elements listed after the phrase "consisting essentially of," and is limited to other elements that do not interfere with or contribute to the activity or action specified in the present disclosure of the listed elements. Thus, the phrase "consisting essentially of is intended to indicate that the listed elements are required, but no other elements are optional and may or may not be present, depending on whether they affect the activity or action of the listed elements.

[0081] As used herein, the phrase “consisting of is meant to include, but is not limited to, any elements following the phrase “consisting of.” Thus, the phrase “consisting of” indicates that the listed elements are required, and other elements may not be present.

[0082] As used herein, the term “consisting of also encompasses the terms “consisting essentially of” and “consisting of.” It should be understood that “comprising” the embodiments of the present disclosure described herein also includes “consisting essentially of” and “consisting of.”

[0083] Throughout the specification, references to "one embodiment," "an embodiment," "a specific embodiment," "a related embodiment," "an embodiment," "another embodiment," or "a further embodiment," or combinations thereof, mean that a particular element, feature, structure, or characteristic described in conjunction with that embodiment is included in at least one embodiment of the present disclosure. Therefore, the aforementioned phrases that appear in different places throughout the specification do not necessarily all refer to the same embodiment. In addition, particular elements, features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0084] It is also noted that the claims may be drafted to exclude any optional element. As such, this description is intended to serve as an antecedent basis for use of exclusive terminology such as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] An understanding of certain features and advantages of the present disclosure will be gained by referring to the following detailed description, which sets forth illustrative embodiments in which the principles of the present disclosure may be utilized, and to the accompanying drawings, in which:

[0086] Figure 1 : Identification and characterization of CRISPR loci and Cas proteins of class 2 and VF-type CRISPR systems. Figure 1 a, Maximum likelihood tree of identified Cas12f1 and previously reported Cas12f1. An evolutionary distance scale of 0.08 is shown. Figure 1 b, Scheme of Cas12f1-induced EGFP activation in HEK293T cells. Transfection of plasmids expressing Cas12f1 and sgRNA-activated EGFP. Figure 1 c, EGFP activation efficiency mediated by various Cas12f1s determined by flow cytometry. Values ​​and error bars represent mean and sd (n = 3). The two most efficient Cas12f1s selected for further study are highlighted in red. The FACS gating strategy is described in Supplementary Figure 7 As shown in e. Figure 1 d, Protein organization of SpCas9, LbCas12a, Un1Cas12f1_ge4.1, OsCas12f1, and RhCas12f1. Nuclease domains (including RuvC and HNH) and protein lengths are indicated. Figure 1 e, Comparison of DNA sequence sizes among OsCas12f1, RhCas12f1, and other commonly used CRISPR systems. Figure 1f, WebLogo of the PAM sequences of OsCas12f1 and RhCas12f1.

[0087] Figure 2 : Rational protein engineering and sgRNA optimization for efficient Cas12f1. Figure 2 a, Scheme of the protein engineering strategy. Mutants showing higher EGFP activation were selected for further optimization. Figure 2 b, The first round of efficient mutant screening of OsCas12f1. Wild-type OsCas12f1 (WTOsCas12f1), Un1Cas12f1_ge4.1, SpCas9, and mutants selected for the next round of screening are indicated. Figure 2 c, A second round of enhanced OsCas12f1 variant screening was performed by combining D52R with other arginine substitution mutants. Values ​​and error bars represent mean and sd (n = 3). Figure 2 d, Engineering strategy of OsCas12f1sgRNA. Figure 2 e, Results of sgRNA engineering of OsCas12f1. The best sgRNA (Os-sg1.1) selected for further engineering is marked in red. Values ​​and error bars represent mean and sd (n = 3). Figure 2 f, Second round of sgRNA engineering by including CG base pair substitutions on Os-sg1.1. Values ​​and error bars represent mean and sd (n=3). Figure 2 g, Increased EGFP activation efficiency by combining OsCas12f1 mutants (T132R+D52R) and sgRNA variants (Os-sg2.6). enOsCas12f1 is indicated by red triangles. Values ​​and error bars represent mean and sd (n=3). Figure 2 h, Enhanced mutant screening of RhCas12f1. Each dot indicates a mutant. Figure 2 i and 2j, RhCas12f1 sgRNA was optimized to increase activity. The labeled sgRNA (Rh-sg1.1) was selected for further optimization. Values ​​and error bars represent mean and sd (n = 3). Figure 2 k, Combination of Rh-sg1.1 variants with protein variants further increased the EGFP activation efficiency of Rh-sg1.1 variants. The best combination is indicated as enRhCas12f1 marked with a red triangle. Values ​​and error bars represent mean and sd (n=3).

[0088] Figure 3 : PAM preferences of enOsCas12f1 and enRhCas12f1. Figure 3a, PAM preferences of OsCas12f1, enOsCas12f1 and Un1Cas12f1_ge4.1 analyzed by the GFP activation system of Example 1. Values ​​and error bars represent mean and sd (n = 3). Figure 3 b, Comparison of RhCas12f1- and enRhCas12f1-preferred PAMs. Values ​​and error bars represent mean and sd (n = 3). Figure 3 c and Figure 3 d, Validation of PAM preferences of enOsCas12f, enRhCas12f1 and Un1Cas12f1_ge4.1 at endogenous loci. Values ​​and error bars represent mean and sd (n=3). Figure 3 e and Figure 3 f, Summary of indel efficiencies of enOsCas12f1, Un1Cas12f1_ge4.1, and enRhCas12f1. Values ​​and error bars represent means and sd from biologically independent experiments.

[0089] Figure 4 : Comprehensive validation of the genome editing efficiency of enOsCas12f1 and enRhCas12f1 in human cells. Figure 4 a, The distribution and indel frequencies of all exon-accessible target sites for enOsCas12f1 (5'-NTTC PAM), enRhCas12f1 (5'-CCCA PAM) and Un1Cas12f1_ge4.1 (5'-TTTR PAM) are indicated by the average of three replicates as determined by NGS. Exons (grey solid squares) are connected by introns (lines), and UTRs are shown as open boxes. Figure 4 b, Indel frequencies of enOsCas12f1, enRhCas12f1, and Un1Cas12f1_ge4.1 at endogenous genomic loci. Each point represents a single target site, and each value means the average of three replicates. The bars represent the average. Figure 4 c, Comparison of editing efficiency of enOsCas12f1 and Un1Cas12f1_ge4.1 at PCSK9 and TTR loci targeted by the same sgRNA. Values ​​and error bars represent mean and sd (n = 3). Figure 4 d, Average indel frequencies of enOsCas12f1 and Un1Cas12f1_ge4.1 at 5'-TTC PAM and 5'-TTTR PAM target sites. Each point represents a single target site, and each value means the average of 3 replicates. Error bars represent mean and sd. Figure 4e, Comparison of editing efficiency of enOsCas12f1 and SpG at endogenous target loci targeted by the same sgRNA. Values ​​and error bars represent mean and sd (n = 3). Figure 4 f, Distribution and top 10 mutant alleles disrupted at the TTR locus by enOsCas12f1.

[0090] Figure 5 : Specificity of genome editing mediated by enOsCas12f1 and enRhCas12f1 in human cells. Figure 5 a, Effects of 1 bp or 2 bp mismatches in sgRNA on enOsCas12f1 activity at the PCSK9 locus. Values ​​and error bars represent mean and sd (n=3). Figure 5 b, Mismatch tolerance of enRhCas12f1 at PCSK9-sg32. Values ​​and error bars represent mean and sd (n=3). Figure 5 c, Off-target efficiency of LbCas12a, enOsCas12f1, and Un1Cas12f1_ge4.1 at computer-predicted off-target sites, determined by targeted deep sequencing. Figure 5 d and Figure 5 e, PEM-seq genome-wide quantification of translocation efficiency induced by off-target indels of enOsCas12f1 and enRhCas12f1. Circos diagram showing off-target sites connected to bait DSBs (red triangles, 5d). Percentages of translocation, germline, and editing efficiency calculated by PEM-seq analysis of enOsCas12f1, Un1Cas12f1_ge4.1, LbCas12a, SpCas9, and enRhCas12f1 (5e).

[0091] Figure 6 : Tunable enOsCas12f1-mediated deletion of human DMD exon 51 in vitro and in vivo, and engineering enOsCas12f1 for epigenome editing and gene activation. Figure 6 a, Strategy for generating humanized DMD mutant mice with human exon 51 replacement and exon 52 deletion. Deletion of exon 51 can restore dystrophin expression. Two sgRNAs located before (5' sgRNA) and after (3' sgRNA) exon 51 were designed to delete exon 51. Figure 6 b, Paired sgRNAs cause enOsCas12f1 and SpCas9-mediated deletion of DMD exon 51 in HEK293T cells. The exon 51 deletion band is marked with a red asterisk. This experiment was repeated twice, showing similar results. Figure 6c, Scheme representing the strategy to destabilize enOsCas12f1 (DD-enOsCas12f1). Figure 6 d, Overview of intramuscular injection of a single AAV9 system in humanized mice. Figure 6 e, The in vivo editing efficiency of enOsCas12f1 and DD-enOsCas12f1 was tested by genomic PCR. This experiment was repeated twice, showing similar results. Figure 6 f, Western blot for detecting restoration of dystrophin (DMD) by enOsCas12f1 and DD-enOsCas12f1 in DMD model mice. Vinculin (VCL) protein level was used as an internal control. Figure 6 g, Percentage of restored dystrophin protein analyzed by Western blot. Values ​​and error bars represent mean and sd (n=1 for KO, n=6 for enOsCas12f1). Figure 6 h, DMD immunofluorescence staining. Figure 6 i, Percentage of dystrophin-positive fibers in enOsCas12f1- and DD-enOsCas12f1-treated muscles. Values ​​and error bars represent mean and sd (n=3). Figure 6 j, GFP silencing activity of mini-CRISPRoff-v1 to v4 and CRISPRoff-v2. HEK293T cells stably expressing GFP generated by the piggyBac system were used. Values ​​and error bars represent mean and sd (n = 3). Figure 6 k, DNA methylation level on the Snrp promoter region. Figure 6 l, Using the design strategy of denOsCas12f1-VPR from Xu et al., a TRE3G-GFP reporter cell line was created in HEK293T cells using the piggyBac system. Figure 6 m, GFP activation efficiency of denOsCas12f1-VRP. sgRNA containing a random non-targeting spacer sequence was used as a non-target (NT) control. Values ​​and error bars represent mean and sd (n=3).

[0092] Figure 7 .Strategies for flow cytometry gating and Cas12f1 candidate prediction. Figure 7 a, Scheme showing the natural CRISPR-Cas loci encoding OsCas12f1 and RhCas12f1. Figure 7 b, tracrRNA structure predicted by RNAfold. Figure 7 c and Figure 7d, Computer prediction of base pairing between tracrRNA and crRNA of OsCas12f1 (7c) and RhCas12f1 (7d). Figure 7 e, Gating strategy for evaluating EGFP activation efficiency. The EGFP activation efficiency of the targeted group was analyzed using the gate set on the non-targeted control. Figure 7 f, Screening for functional Cas12f1 in HEK293T cells. Values ​​and error bars represent mean and sd (n=3).

[0093] Figure 8 . Validation of the efficiency of genome editing by Cas12f1 in human cells. Figure 8 a- Figure 8 e, Indel efficiency at endogenous genes in HEK293T cells as determined by TIDER. All values ​​and error bars represent the mean and sd from n=2 biologically independent experiments.

[0094] Fig. 9 .Optimal parameter sets for OsCas12f1 and RhCas12f1. Fig. 9 a and Fig. 9 b, Optimal spacer lengths of OsCas12f1 (9a) and RhCas12f1 (9b). Values ​​and error bars represent mean and sd (n=3). Fig. 9 c, OsCas12f1 and RhCas12f1 were aligned with Un1Cas12f1 to identify the conserved residues in the RuvC active site, which are marked with red boxes. Fig. 9 d and Fig. 9 e, Validation of the enzyme active sites of OsCas12f1 (9d) and RhCas12f1 (9e). Using targeting spacer sequences with respective PAMs

[0095] TTTC-CCATTACAGTAGGAGCATAC (SEQ ID NO: 214) and

[0096] CCCA-CCATTACAGTAGGAGCATAC (SEQ ID NO: 214) evaluated the GFP activation efficiency of OsCas12f1 and RhCas12f1, respectively. Values ​​and error bars represent mean and sd (n=3).

[0097] Fig.10 .Characterization of OsCas12f1- and RhCas12f1-mediated cleavage. Fig.10a, SDS-PAGE analysis of purified OsCas12f1, RhCas12f1, enOsCas12f1 and enRhCas12f1 proteins. Fig.10 b, Linear plasmid cleavage by OsCas12f1 and RhCas12f1 at different temperatures. Fig.10 c, OsCas12f1 and RhCas12f1 cleave both supercoiled and linear plasmids in vitro. Fig.10 c and Fig.10 e, Run-off sequencing of products cleaved by OsCas12f1 (10d) and RhCas12f1 (10e). Red triangles indicate cleavage sites. These experiments were repeated at least twice, showing similar results.

[0098] Fig.11 .OsCas12f1-sgRNA and RhCas12f1-sgRNA complex formation. Fig.11 a and Fig.11 b, Size exclusion chromatograms of OsCas12f1 (11a) and RhCas12f1 (11b) with or without their sgRNA. UV absorbance at 280nm and 260nm is shown as solid and dashed lines, respectively. The molecular weight of the standard marker protein is indicated. At least under the conditions tested, both OsCas12f1 and RhCas12f1 can form dimers with their sgRNA, as indicated by pink and blue arrows, respectively. Peak fractions were analyzed by SDS-PAGE. These experiments were repeated three times, showing similar results.

[0099] Fig.12 .Protein alignment of OsCas12f1 and RhCas12f1 with Un1Cas12f1. Fig.12 a, Domain architecture of OsCas12f1 and RhCas12f1 predicted by alignment with Un1Cas12f1. ZF, zinc finger domain; REC, recognition domain; WED, wedge domain; RuvC, RuvC nuclease domain; TNB, target nucleic acid binding domain. The maximum likelihood regions of OsCas12f1 and RhCas12f1 for RNA and / or DNA recognition are indicated (regions 1-3). Fig.12 b, Protein alignment of OsCas12f1, RhCas12f1 and Un1Cas12f1.

[0100] Fig.13. Mutagenesis strategy for screening enOsCas12f1 and enRhCas12f1. Shown with enOsCas12f1 as an example. Region 1-3 of OsCas12f1 is divided into 11 segments, and the length of these segments is 17 amino acid residues. By PCR and Gibson assembly method (using NEBuilder HiFi DNA assembly master mix (New England Biolabs (NewEngland Biolabs))), by replacing the above-mentioned segment with BpiI recognition sequence, eleven skeleton mutants of OsCas12f1 are produced. Then specific mutations are introduced by incorporating annealed oligonucleotides containing mutations via BpiI digestion and T4 DNA ligase connection.

[0101] Fig.14 Engineering and optimization of .enCas12f1. Fig.14 a, Saturation mutagenesis analysis at the D52 site of OsCas12f1. The data shown here represent the values ​​of the results from n=1 experiment. Fig.14 b, Evaluation of the efficiency of the OsCas12f1-D52R+Os-sg1.1 combination variant. Target: TTTC-CCATTACAGTAGGAGCATAC (SEQ ID NO: 214). Values ​​and error bars represent mean and sd (n = 3). Fig.14 c, Increased EGFP activation efficiency by Os-sg2.6. Target: TTTC-CCATTACAGTAGGAGCATAC (SEQ ID NO: 214). Values ​​and error bars represent mean and sd (n = 3). Fig.14 d-14f, OsCas12f1-D52R+Os-sg2.6 was validated by reporters containing different endogenous protospacer sequences. Target-d: CTTC-TTGTGCTGGACGGTGACGTA (SEQ ID NO: 511); Target-e: TTTC-ATTGGCTTTGATTTCCCTAG (SEQ ID NO: 486); Target-f: TTTC-CCTAGGGTCCAGCTTCAAAT (SEQ ID NO: 512). Values ​​and error bars represent mean and sd (n = 3). Fig.14 g, By combining OsCas12f1 mutants and sgRNA variants, the EGFP activation efficiency of enOsCas12f variants was increased. The best combination is represented as enOsCas12f1. A reporter containing the DMD_2 protospacer sequence (SEQ ID NO: 487) was used. The values ​​represent the average of the results from n=2 biological independent experiments. Fig.14h, Efficiency of enOsCas12f1 at the endogenous DMD locus in HEK293T cells. Values ​​and error bars represent mean and sd (n=3). Fig.14 i, Efficiency of enRhCas12f1 at the endogenous PCSK9 locus in HEK293T cells. Values ​​and error bars represent mean and sd (n=3).

[0102] Fig.15 . In vitro PAM preferences of enOsCas12f1 and enRhCas12f1. WebLogo of the in vitro PAM sequences of enOsCas12f1 (15a) and enRhCas12f1 (15b).

[0103] Fig.16 .enRhCas12f1-mediated gene disruption in human cells. Fig.16 a, Size and position distribution of indels induced by enOsCas12f1. Fig.16 b, Top 10 mutant alleles of enRhCas12f1-mediated disruption at the PCSK9 locus. Fig.16 c- Fig.16 d, Size and position distribution of indels induced by enRhCas12f1.

[0104] Fig.17 Mismatch tolerance of enOsCas12f1 and enRhCas12f1. Effect of 1 bp mismatched sgRNA on GFP activation efficiency of enOsCas12f1 and enRhCas12f1. 5'-TTTC PAM- and 5'-CCCA PAM-adjacent protospacer sequences were used for OsCas12f1 and RhCas12f1, respectively. Values ​​and error bars represent mean and sd (n=3).

[0105] Fig.18 .Deletion of DMD exon 51 by DD-enOsCas12f1. Fig.18 a, Indel frequencies induced by enOsCas12f1, Un1Cas12f1_ge4.1, and enRhCas12f1 at the 5' and 3' regions flanking DMD exon 51 in HEK293T cells. Target sites of SpCas9 from Ousterout et al. Values ​​and error bars represent mean and sd (n=3). Fig.18 b, RT-PCR across DMD exon 51 shows a smaller band with exon 51 deletion in treated muscle. Fig.18c, Percentage of exon 51 deletion calculated by TA cloning of RT-PCR products. Values ​​and error bars represent mean and sd (n = 3). Fig.18 d, Representative chromatogram of the expected deletion PCR product.

[0106] Fig.19 .cloning strategy for denOsCas12f1-mediated epigenome editing (mini-CRISPRoff). Scheme for gene silencing fused to denOsCas12f1 and epigenetic editors (mini-CRISPRoff). CRISPRoff-v2 design from Nunez, JK et al., 2021.

[0107] Fig. 20 Gating strategy used to evaluate the efficiency of mini-CRISPRoff and denOsCas12f1-VPR. Fig. 20 a, GFP knockdown efficiency of mini-CRISPRoff and CRISPRoff-v2 5 days after transfection in Snrp-GFP HEK293T cells. Fig. 20 b, GFP activation efficiency induced by denOsCas12f1-VPR in TRE3G-GFP HEK293T cells 3 days after transfection.

[0108] Fig.21 Uncropped image. The red rectangle indicates the crop location.

[0109] Fig. 22 A schematic diagram of the two plasmids in the fluorescent reporter assay is shown.

[0110] Fig.23 The cleavage activity of various CRISPR-Cas12f systems disclosed herein is shown.

[0111] Fig.24 is a schematic diagram illustrating an exemplary target dsDNA, an exemplary guide nucleic acid, and an exemplary Cas12f.

[0112] The drawings herein are for illustration purposes only and are not necessarily drawn to scale. DETAILED DESCRIPTION

[0113] Overview

[0114] The present disclosure provides Cas12f polypeptides and Cas12f polypeptides having high spacer sequence-specific (on-target) dsDNA cleavage activity and / or low spacer sequence-independent (off-target) dsDNA cleavage activity based on a parent or reference Cas12f polypeptide, and fusions and uses thereof.

[0115] In some embodiments, the parent or reference Cas12f polypeptide can be: (i) any one of SEQ ID NO: 1-34 disclosed herein or a known Cas12f polypeptide, (ii) a naturally occurring ortholog, paralog or homolog of any one of (i); (iii) a Cas12f polypeptide having at least about 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with any one of (i) and (ii); or (iv) any mutant or variant of (i) to (iii). The parent or reference Cas12f polypeptide can be wild-type or not wild-type.

[0116] Representative Cas12f peptides

[0117] As a representative of the present disclosure, in one aspect, the present disclosure provides a Cas12f polypeptide comprising an amino acid sequence having at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31 and 32).

[0118] In some embodiments, the Cas12f polypeptide is not any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).

[0119] Characterization of Cas12f peptides

[0120] In some aspects of the present disclosure, the Cas12f polypeptide of the present disclosure has or retains or has an improved endonuclease activity for target DNA for on-target DNA cutting. Also for the purpose of on-target DNA cutting, the Cas12f polypeptide of the present disclosure may not only have on-target endonuclease activity, but also substantially lack off-target endonuclease activity, so that it can have specificity for target DNA. On the other hand, the Cas12f polypeptide of the present disclosure can be engineered to substantially lack endonuclease activity (on-target or off-target), but retains its ability to be complexed with the guidance nucleic acid and thereby guided to the target DNA, so as to indirectly guide the functional domain associated with the Cas12f polypeptide to the target DNA. Therefore, the characterization of the Cas12f polypeptide of the present disclosure is not limited to the ability of target DNA cutting.

[0121] In some embodiments, the Cas12f polypeptide has a function (e.g., a modified function that is increased or decreased compared to the latter) of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32) (e.g., the ability to form a complex with a guide nucleic acid, the guide nucleic acid being able to form a complex with any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32); and / or guide sequence-specific dsDNA cleavage activity).

[0122] In some embodiments, the Cas12f polypeptide has a guide sequence-specific (on-target) dsDNA cleavage activity.

[0123] In some embodiments, the Cas12f polypeptide substantially retains the guide sequence-specific (on-target) dsDNA cleavage activity of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).

[0124] Increased on-target cutting

[0125] In some embodiments, when both are used in combination with the same guide nucleic acid, any one of SEQ ID NOs: 1-34 (optionally SEQ ID NO: 1, 2, 4, 5, 15, 28, 29, 31 and 32), the Cas12f polypeptide has an increased guide sequence-specific (on-target) dsDNA cleavage activity, for example, an increase of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300% or more.

[0126] In some embodiments, the Cas12f polypeptide comprises an amino acid substitution at position 46, 49, 50, 52, 53, 54, 56, 57, 62, 63, 66, 70, 71, 72, 119, 120, 127, 132, 136, 141, 144, 146, 147, 148, 150, 264, 292, 293, 311, 313, 314 and / or 315 of SEQ ID NO: 1 (OsCas12f1 (ME-B.3)).

[0127] In some embodiments, the Cas12f polypeptide comprises positions 10, 11, 13, 14, 15, 17, 18, 19, 20, 27, 28, 31, 32, 40, 44, 47, 49, 51, 52, 55, 56, 59, 61, 63, 65, 68, 71, 84, 91, 94, 96, 99, 111, 112, 124, 125, 126, 127, 128, 129, 130, 131, 139, 140, 141, 146, 147, 150, 151, 156, 160, 163, 167, 170, 173, 178, 179, 180, 183, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201 , 202, 206, 215, 224, 225, 226, 227, 230, 235, 249, 254, 256, 257, 264, 265, 266, 269, 270, 272, 273, 276, 280, 283, 292, 295, 303, 309, 311, 313, 314, 316, 318, 319, 32 0, 321, 334, 337, 341, 344, 346, 349, 358, 363, 365, 366, 367, 368, 371, 372, 374, 375, 377, 380, 382, ​​393, 399, 403, 404, 406, 408, 409, 410, 411, 413 and / or 414 amino acid substitutions.

[0128] Typically, the amino acid substitution is with a non-polar amino acid residue (such as glycine (Gly / G), alanine (Ala / A), valine (Val / V), cysteine ​​(Cys / C), proline (Pro / P), leucine (Leu / L), isoleucine (Ile / I), methionine (Met / M), tryptophan (Trp / W), phenylalanine (Phe / F)), a polar amino acid residue (such as serine (Ser / S), threonine (Thr / T), tyrosine (Tyr / Y), asparagine (Asn / N), glutamine (Gln / Q)), a positively charged amino acid residue (such as lysine (Lys / K), arginine (Arg / R), histidine (His / H)) or a negatively charged amino acid residue (such as aspartic acid (Asp / D), glutamic acid (Glue / E)).

[0129] In some embodiments, the amino acid substitution is a substitution with a positively charged amino acid residue such as lysine (Lys / K), arginine (Arg / R), histidine (His / H), and optionally with arginine (Arg / R).

[0130] In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D52R and / or T132R relative to SEQ ID NO: 1.

[0131] In some embodiments, the Cas12f polypeptide comprises substitutions D52R and T132R relative to SEQ ID NO: 1.

[0132] In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 226, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 226.

[0133] In some embodiments, the Cas12f polypeptide comprises amino acid substitutions A56R, Y125R, S130R, T131R, I264R, L270R and / or A273R relative to SEQ ID NO:2.

[0134] In some embodiments, the Cas12f polypeptide comprises an amino acid substitution L270R relative to SEQ ID NO:2.

[0135] In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 227, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 227.

[0136] Reduced off-target cleavage

[0137] In some embodiments, the Cas12f polypeptide substantially lacks guide sequence-independent (off-target) dsDNA cleavage activity.

[0138] In some embodiments, the Cas12f polypeptide substantially lacks the guide sequence-independent (off-target) dsDNA cleavage activity of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).

[0139] In some embodiments, when both are used in combination with the same guide nucleic acid, the Cas12f polypeptide has reduced guide sequence-independent (off-target) dsDNA cleavage activity compared to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32), for example, reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0140] Endonuclease-deficient (inactive) Cas12f polypeptide

[0141] In some aspects, the present disclosure provides a nuclease-deficient Cas12f polypeptide, which means that the Cas12f polypeptide is substantially incapable of acting as an endonuclease for cutting dsDNA or ssDNA (double-stranded or single-stranded) against target DNA or against non-target DNA (for the convenience of experimental design, performance and evaluation, the defect of endonuclease activity is generally indicated by substantially losing the spacer sequence-specific dsDNA cutting activity against the target DNA). This Cas12f polypeptide is named "inactive Cas12f (dCas12f)" and can be generated based on a parent or reference Cas12f polypeptide, for example, by mutating one or more functional domains responsible for the endonuclease activity of a parent or reference Cas12f polypeptide.

[0142] In some embodiments, the Cas12f polypeptide is further engineered to substantially lack guide sequence-specific (on-target) dsDNA cleavage activity.

[0143] In some embodiments, the Cas12f polypeptide substantially lacks the guide sequence-specific (on-target) dsDNA cleavage activity of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).

[0144] In some embodiments, when both are used in combination with the same guide nucleic acid, the Cas12f polypeptide has reduced guide sequence-specific (on-target) dsDNA cleavage activity compared to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32), for example, reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0145] In some embodiments, the Cas12f polypeptide comprises an amino acid substitution at position 44, 79, 81, 82, 125, 131, 133, 138, 149, 151, 153, 228, 268, 270, 271, 274, 275, 277, 279, 282, 287, 291, 305, 308, 312 and / or 406 of SEQ ID NO: 1.

[0146] In some embodiments, the Cas12f polypeptide comprises position 4, 7, 9, 23, 30, 33, 34, 35, 37, 38, 39, 41, 42, 46, 60, 62, 67, 69, 72, 75, 76, 77, 78, 80, 81, 82, 86, 90, 93, 97, 98, 101, 105, 107, 108, 114, 116, 121, 123, 135, 137, 143, 145, 148, 162, 165, 177, 185, 187, 189, 190, 207, 392, 395, 396, 397, 398, 399, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 450, 451, 452, 453, 454, 455, 456, 457, 458, 460, 461, 462, 463, 464, 471

[0147] Typically, the amino acid substitution is with a non-polar amino acid residue (such as glycine (Gly / G), alanine (Ala / A), valine (Val / V), cysteine ​​(Cys / C), proline (Pro / P), leucine (Leu / L), isoleucine (Ile / I), methionine (Met / M), tryptophan (Trp / W), phenylalanine (Phe / F)), a polar amino acid residue (such as serine (Ser / S), threonine (Thr / T), tyrosine (Tyr / Y), asparagine (Asn / N), glutamine (Gln / Q)), a positively charged amino acid residue (such as lysine (Lys / K), arginine (Arg / R), histidine (His / H)) or a negatively charged amino acid residue (such as aspartic acid (Asp / D), glutamic acid (Glue / E)).

[0148] In some embodiments, the amino acid substitution is a substitution with (1) a positively charged amino acid residue (such as lysine (Lys / K), arginine (Arg / R), histidine (His / H)), and optionally a substitution with arginine (Arg / R); or a substitution with (2) a non-polar amino acid residue (such as glycine (Gly / G), alanine (Ala / A), valine (Val / V), cysteine ​​(Cys / C), proline (Pro / P), leucine (Leu / L), isoleucine (Ile / I), methionine (Met / M), tryptophan (Trp / W), phenylalanine (Phe / F)), and optionally a substitution with alanine (Ala / A).

[0149] In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D228A and / or T406A relative to SEQ ID NO: 1.

[0150] In some embodiments, the Cas12f polypeptide comprises an amino acid sequence of SEQ ID NO: 221 or 222, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to an amino acid sequence of SEQ ID NO: 221 or 222.

[0151] In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D52R and T132R relative to SEQ ID NO: 1.

[0152] In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D52R, T132R, D228A, and T406A relative to SEQ ID NO: 1.

[0153] In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 513 (denOsCas12f1 (OsCas12f1-D52R+T132R+D228A+T406A)), or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 513.

[0154] In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D210A and / or D388A relative to SEQ ID NO:2.

[0155] In some embodiments, the Cas12f polypeptide comprises an amino acid sequence of SEQ ID NO: 223 or 224, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to an amino acid sequence of SEQ ID NO: 223 or 224.

[0156] In some embodiments, the Cas12f polypeptide comprises an amino acid substitution L270R relative to SEQ ID NO:2.

[0157] In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D210A, L270R, and D388A relative to SEQ ID NO:2.

[0158] In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 515 (denRhCas12f1 (RhCas12f1-D210A+L270R+D388A)), or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 515.

[0159] Cas12f nickase

[0160] In some aspects, the present disclosure provides a Cas12f polypeptide, which is not completely endonuclease-deficient, but the endonuclease activity is not directed to the double strand of dsDNA, but to one strand of dsDNA or ssDNA (sense strand or nonsense strand; or target strand or non-target strand), which means that the Cas12f polypeptide is substantially incapable of acting as a dsDNA endonuclease for cutting the double strand of dsDNA for target DNA or for non-target DNA, but is substantially capable of acting as an ssDNA endonuclease for cutting ssDNA or "generating a nick" in one strand of dsDNA. This Cas12f polypeptide is named "nickase" and can be generated based on a parent or reference Cas12f polypeptide, for example, by mutating one or more functional domains responsible for the endonuclease activity of a parent or reference Cas12f polypeptide.

[0161] In some embodiments, the Cas12f polypeptide is further engineered into a nickase.

[0162] Fusion Protein

[0163] In some aspects, the present disclosure provides a fusion protein comprising a Cas12f polypeptide and a functional domain. In some embodiments, the functional domain is a heterologous functional domain. This functional protein can also be regarded as the following Cas12f polypeptide, which further comprises a functional domain fused to the Cas12f polypeptide.

[0164] In some embodiments, the Cas12f polypeptide further comprises a functional domain fused to the Cas12f polypeptide.

[0165] In some embodiments, the functional domain is selected from a nuclear localization signal (NLS), a nuclear export signal (NES), a base editing domain such as a deaminase or a catalytic domain thereof, a base excision domain, a uracil glycosylase inhibitor (UGI) or a catalytic domain thereof, a uracil glycosylase (UNG) or a catalytic domain thereof, a methylpurine glycosylase (MPG) or a catalytic domain thereof, a methylase or a catalytic domain thereof, a demethylase or a catalytic domain thereof, a transcriptional activation domain (e.g., VP64 or VPR), a transcriptional repression domain (e.g., a KRAB portion or a SID portion), a reverse transcriptase or a catalytic domain thereof, an exonuclease (e.g., T5E (SEQ ID NO:449)) or its catalytic domain, destabilizing domain (e.g., the destabilizing domain (DD) of Escherichia coli dihydrofolate reductase (ecDHFR)), histone residue modifying domain, nuclease catalytic domain (e.g., FokI), transcription modifier, light gating factor, chemical inducible factor, chromatin visualization factor, targeting polypeptide for providing binding to a cell surface moiety on a target cell or target cell type, reporter (e.g., fluorescent) polypeptide or detection label (e.g., GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP), localization signal, polypeptide targeting moiety, DNA binding domain (e.g., MBP, Lex A DBD, Gal4 DBD), epitope tags (e.g., His, myc, V5, FLAG, HA, VSV-G, Trx, etc.), transcription release factors, HDACs, portions having ssRNA cleavage activity, portions having dsRNA cleavage activity, portions having ssDNA cleavage activity, portions having dsDNA cleavage activity, DNA or RNA ligases, functional domains exhibiting target DNA modification activity and catalytic domains thereof and functional fragments thereof (e.g., functional truncations), and any combination thereof, wherein the target DNA modification activity is selected from: methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkane alkylation activity, dealkylation activity, depurination activity, oxidation activity, deoxygenation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, glycosylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylation activity, deSUMOylation activity, ribosylation activity, deribosylation activity, myristoylation activity, demyristoylation activity, glycosylation activity (e.g., from O-GlcNAc transferase), deglycosylation activity.

[0166] In some embodiments, the NLS comprises or is an SV40 NLS (such as SEQ ID NO:216; encoded by, for example, SEQ ID NO:217), a bpSV40 NLS (BP NLS, bpNLS) or an NP NLS (Xenopus laevis nucleoplasmin NLS, nucleoplasmin NLS) (such as SEQ ID NO:218; encoded by, for example, SEQ ID NO:219).

[0167] Base editing

[0168] In some embodiments, a base editing domain is capable of replacing a base of a nucleotide with a different base.

[0169] In some embodiments, the base editing domain is capable of deaminating a base of a nucleotide.

[0170] In some embodiments, the base editing domain comprises a deaminase domain capable of deaminating a base of a nucleotide (e.g., adenine, guanine, cytosine, thymine, uracil). In some embodiments, the deaminase domain is capable of deaminating adenine (A) to hypoxanthine (I). In some embodiments, adenine is deaminated to hypoxanthine to convert adenosine (A) or deoxyadenosine (dA) containing adenine to guanosine (G) or deoxyguanosine (dG). In some embodiments, the deaminase domain is capable of deaminating cytosine (C) to uracil (U). In some embodiments, cytosine is deaminated to uracil to convert cytidine (C) or deoxycytidine (dC) containing cytosine to uridine (U) or deoxythymidine (dT).

[0171] In some embodiments, a base editing domain is capable of excising a base of a nucleotide (e.g., adenine, guanine, cytosine, thymine, uracil).

[0172] In some embodiments, the base editing domain comprises a base excision domain capable of excising a base of a nucleotide.

[0173] In some embodiments, the base editing domain comprises a deaminase domain and a base excision domain.

[0174] In some embodiments, the deaminase domain is tRNA adenosine deaminase (TadA) or a deaminase domain thereof or a functional variant or fragment thereof, such as TadA8e, TadA8.17, TadA8.20, TadA9, TadA8E V106W 、TadA8E V106W+D108Q TadA-CDa, TadA-CDb, TadA-CDc, TadA-CDd, TadA-CDe, TadA-dual, T AD AC-1.2, TAD AC-1.14, T AD AC-1.17, T AD AC-1.19, T AD AC-2.5, T AD AC-2.6, T AD AC-2.9, T AD AC-2.19, T AD AC-2.23, TadA8e-N46L, TadA8e-N46P.

[0175] In some embodiments, the deaminase domain is an apolipoprotein B mRNA editing complex (APOBEC) family deaminase, activation-induced deaminase (AID), cytidine deaminase 1 from sea lamprey (Petromyzon marinus) (pmCDA1) or a deaminase domain or a functional variant or fragment thereof, such as APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H.

[0176] In some embodiments, the deaminase or its catalytic domain is an adenine deaminase (e.g., TadA, such as TadA8e, TadA8.17, TadA8.20, TadA9) or its catalytic domain, e.g., TadA8e-V106W, TadA8e-W106V.

[0177] In some embodiments, the deaminase or its catalytic domain is a cytidine deaminase (e.g., an APOBEC, such as APOBEC3, e.g., APOBEC3A, APOBEC3B, APOBEC3C; DddA) or its catalytic domain, e.g., hAPOBEC3-W104A.

[0178] In some embodiments, the UGI is a human UGI domain.

[0179] In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D52R, T132R, D228A, and T406A relative to SEQ ID NO: 1, and comprises a base editing domain, such as a deaminase or a catalytic domain thereof.

[0180] In some embodiments, the Cas12f polypeptide comprises an amino acid sequence of any one of SEQ ID NOs: 260-265, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to an amino acid sequence of any one of SEQ ID NOs: 260-265.

[0181] In some embodiments, the functional domain includes a reverse transcriptase (RT) or its catalytic domain. In some embodiments, the guide nucleic acid further includes a reverse transcription donor RNA (RT donor RNA) or is used in combination with it, and the reverse transcription donor RNA includes a primer binding site (PBS) and a template sequence. For details on primer editing with 2 types of V-type Cas proteins, refer to WO 2022256440 A3, which is incorporated herein by reference in its entirety.

[0182] system

[0183] The Cas12f polypeptide of the present disclosure can be used in combination with a guide nucleic acid and guided to a target DNA by the guide nucleic acid to exert an effect on the target DNA.

[0184] In another aspect, the present disclosure provides a system comprising:

[0185] (1) a Cas12f polypeptide of the present disclosure or a polynucleotide encoding the Cas12f polypeptide; and

[0186] (2) a guide nucleic acid or a polynucleotide encoding the guide nucleic acid, wherein the guide nucleic acid comprises:

[0187] (i) a scaffold sequence capable of forming a complex with the Cas12f polypeptide; and

[0188] (ii) a guide sequence capable of hybridizing to a target sequence of a target DNA, thereby directing the complex to the target DNA.

[0189] In some embodiments, the system is a non-naturally occurring or engineered system.

[0190] In some embodiments, the system is a complex comprising a Cas12f polypeptide complexed with a guide nucleic acid. In some embodiments, the complex further comprises a target DNA hybridized with a target sequence.

[0191] In some embodiments, the Cas12f polypeptide comprises an amino acid sequence having at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).

[0192] In some embodiments, the Cas12f polypeptide is a mutant of any one of SEQ ID NOs: 1-34 as described herein (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).

[0193] In another aspect, the present disclosure provides a guide nucleic acid comprising:

[0194] (1) a scaffold sequence capable of forming a complex with the Cas12f polypeptide of the present disclosure, and

[0195] (2) A guide sequence that is capable of hybridizing to a target sequence of a target DNA, thereby directing the complex to the target DNA.

[0196] In some embodiments, the guide nucleic acid is a guide RNA (gRNA), such as a single guide RNA (sgRNA). In some embodiments, the guide nucleic acid comprises crRNA. In some embodiments, the guide nucleic acid comprises tracrRNA.

[0197] In some embodiments, the scaffold sequence is 5' to the spacer sequence.

[0198] In some embodiments, the guide nucleic acid further comprises a polyU sequence having at least four consecutive U (uridine) 3' to the guide sequence.

[0199] In some embodiments, the polyU sequence further comprises an A (adenosine) downstream of the at least four consecutive Us.

[0200] In some embodiments, the sequence encoding the polyU sequence comprises a sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity to the sequence of SEQ ID NO: 220; or a sequence having at most 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide differences, whether consecutive or not, compared to the sequence of SEQ ID NO: 220.

[0201] Design of protospacer sequence / target sequence; target site

[0202] For purposes of the present disclosure, in some embodiments, the protospacer sequence or target sequence is positioned such that the target DNA is specifically modified by the Cas12f polypeptide.

[0203] In order to facilitate the evaluation of the selected protospacer sequence or target sequence and the designed guide sequence in the mouse model, in some embodiments, the protospacer sequence or target sequence is positioned so that the mouse target DNA is specifically modified by the Cas12f polypeptide. In some embodiments, the protospacer sequence or target sequence is positioned so that the human target DNA and the mouse target DNA are specifically modified by the Cas12f polypeptide. That is, the protospacer sequence or target sequence is selected to have cross-reactivity with both human and mouse species.

[0204] In some embodiments, the protospacer sequence is a stretch of consecutive nucleotides identified from the non-target strand of the target DNA by identifying the stretch of consecutive nucleotides immediately 3' to the PAM on the non-target strand. In some embodiments, the PAM is 5'-TTN or 5'-CCN, where N is A, T, G, or C. The protospacer sequence is the reverse complement of the target sequence.

[0205] In some embodiments, the protospacer sequence is a stretch of about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more consecutive nucleotides of the target DNA, or a stretch of consecutive nucleotides in a numerical range between any two of the aforementioned values ​​of the target DNA, such as a stretch of about 16 to about 50 or about 17 to about 22 consecutive nucleotides. In some embodiments, the protospacer sequence is a stretch of about 20 consecutive nucleotides of the target DNA.

[0206] In some embodiments, the protospacer sequence comprises about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more consecutive nucleotides of the target DNA, or a range of values ​​between any two of the aforementioned values, such as about 16 to about 50 or about 17 to about 22 consecutive nucleotides of the target DNA. In some embodiments, the protospacer sequence comprises about 20 consecutive nucleotides of the target DNA.

[0207] In some embodiments, the target sequence is a stretch of contiguous nucleotides identified from the target strand of the target DNA.The target sequence is the reverse complement of the protospacer sequence.

[0208] In some embodiments, the target sequence is a stretch of about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more consecutive nucleotides on the target strand of the target DNA, or a stretch of consecutive nucleotides in a numerical range between any two of the foregoing values ​​on the target strand of the target DNA, for example, a stretch of about 16 to about 50 or about 17 to about 22 consecutive nucleotides. In some embodiments, the target sequence is a stretch of about 20 consecutive nucleotides on the target strand of the target DNA.

[0209] In some embodiments, the target sequence comprises about or at least about 16 consecutive nucleotides of the target DNA, such as about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more consecutive nucleotides of the target DNA, or in a numerical range between any two of the foregoing values, such as about 16 to about 50 or about 17 to about 22 consecutive nucleotides of the target DNA. In some embodiments, the target sequence comprises about 20 contiguous nucleotides of the target DNA.

[0210] In some embodiments, the target sequence comprises about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more consecutive nucleotides on the target strand of the target DNA, or a range of consecutive nucleotides between any two of the aforementioned values, such as about 16 to about 50 or about 17 to about 22 consecutive nucleotides on the target strand of the target DNA. In some embodiments, the target sequence comprises about 20 consecutive nucleotides on the target strand of the target DNA.

[0211] In some embodiments, the reverse complement of the target sequence is immediately 3' to a protospacer adjacent motif (PAM); optionally, wherein the PAM is 5'-TTN or 5'-CCN, wherein N is A, T, G or C.

[0212] In some embodiments, the non-target strand is the sense strand of the target DNA.

[0213] In some embodiments, the non-target strand is the antisense strand of the target DNA.

[0214] In some embodiments, the target strand is the sense strand of the target DNA.

[0215] In some embodiments, the target strand is the antisense strand of the target DNA.

[0216] In some embodiments, the protospacer sequence or target sequence is located within exon 1 of the target DNA.

[0217] In some embodiments, the protospacer sequence or target sequence is located within about 50, 100, 150, 200, 250, 300, or more 5'-terminal nucleotides of exon 1 of the target DNA.

[0218] In some embodiments, the target DNA comprises a disease-causing mutation.

[0219] In some embodiments, the target DNA comprises a premature stop codon (eg, TAG).

[0220] In some embodiments, the target DNA is dsDNA, such as eukaryotic dsDNA, for example, a gene in a eukaryotic cell. In some embodiments, the target DNA is human target DNA, non-human primate target DNA, or mouse target DNA.

[0221] In some embodiments, the target DNA is within a eukaryotic cell, such as a human cell, a non-human primate cell, or a mouse cell.

[0222] Design guide sequence based on protospacer / target sequence

[0223] In some embodiments, the guide sequence is about or at least about 16 nucleotides in length, such as about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more nucleotides in length, or a range of values ​​between any two of the preceding values, such as about 16 to about 50 nucleotides in length or about 17 to about 22 nucleotides in length. In some embodiments, the guide sequence is about 20 nucleotides in length.

[0224] In some embodiments, (1) the guide sequence is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% (perfect), optionally about 100% (perfect) reverse complementary to the target sequence; (2) the guide sequence contains no more than 5, 4, 3, 2, or 1 mismatches with the target sequence or no mismatches; or (3) the guide sequence is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,

[0225] Choice of protospacer sequence / target sequence / guide sequence; role of the system

[0226] In some embodiments, the original spacer sequence, target sequence or guide sequence is selected so that the target DNA is modified by the system of the present disclosure. In some embodiments, the modification reduces or eliminates the transcription of the target DNA and / or the translation of the transcript (e.g., mRNA) of the target DNA.

[0227] In some embodiments, after administration of the system of the present disclosure to a cell model (e.g., a HEK293T cell model) or an animal model (e.g., a mouse model, a non-human primate model), the level of the transcript (e.g., mRNA) of the target DNA in the cell model or animal model is reduced by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% or more compared to the level of the transcript (e.g., mRNA) of the target DNA in the same cell model or animal model that did not receive the administration.

[0228] In some embodiments, after administration of the system of the present disclosure to a cell model (e.g., a HEK293T cell model) or an animal model (e.g., a mouse model, a non-human primate model), the level of the transcript (e.g., mRNA) of the target DNA in the cell model or animal model is increased by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% or more compared to the level of the transcript (e.g., mRNA) of the target DNA in the same cell model or animal model that did not receive the administration.

[0229] In some embodiments, after administration of the system of the present disclosure to a cell model (e.g., a HEK293T cell model) or an animal model (e.g., a mouse model, a non-human primate model), the level of the expression product (e.g., protein) of the target DNA in the cell or animal model is reduced by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% or more compared to the level of the expression product (e.g., protein) of the target DNA in the same cell model or animal model that did not receive the administration.

[0230] In some embodiments, after administering the system of the present disclosure to a cell model (e.g., HEK293T cell model) or an animal model (e.g., mouse model, non-human primate model), the level of the expression product (e.g., protein) of the target DNA is increased in the cell or animal model by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% or more compared to the level of the expression product (e.g., protein) of the target DNA in the same cell model or animal model that does not receive the administration. In some embodiments, the expression product is a functional mutant of the expression product of the target DNA.

[0231] Overall structure of guide nucleic acids

[0232] In some embodiments, a guide nucleic acid is a single molecule.

[0233] In some embodiments, a guide nucleic acid comprises a guide sequence capable of hybridizing to a target sequence.

[0234] In some embodiments, a guide nucleic acid comprises multiple (e.g., 2, 3, 4, 5, or more) guide sequences capable of hybridizing to multiple target sequences, respectively.

[0235] In some embodiments, a guide nucleic acid comprises, from 5′ to 3′, a direct repeat sequence, a guide sequence, a direct repeat sequence, a guide sequence, and a direct repeat sequence.

[0236] In some embodiments, a guide nucleic acid comprises a scaffold sequence and a guide sequence.

[0237] In some embodiments, a guide nucleic acid comprises a scaffold sequence 5' of a guide sequence. In some embodiments, a guide nucleic acid comprises a scaffold sequence 3' of a guide sequence.

[0238] In some embodiments, a guide nucleic acid comprises one or more scaffold sequences and / or one or more guide sequences, with the proviso that a guide nucleic acid does not comprise a scaffold sequence and a guide sequence.

[0239] In some embodiments, a guide nucleic acid comprises from 5' to 3' a scaffold sequence, a guide sequence, and a scaffold sequence, wherein the scaffold sequences are the same or different.

[0240] In some embodiments, a guide nucleic acid comprises from 5' to 3' a guide sequence, a scaffold sequence, and a guide sequence, wherein the guide sequences are the same or different.

[0241] In some embodiments, a guide nucleic acid comprises from 5' to 3' one scaffold sequence, one guide sequence, one scaffold sequence, and one guide sequence, wherein the scaffold sequences are the same or different, and wherein the guide sequences are the same or different.

[0242] In some embodiments, a guide nucleic acid comprises from 5' to 3' one guide sequence, one scaffold sequence, one guide sequence and one scaffold sequence, wherein the scaffold sequences are the same or different, and wherein the guide sequences are the same or different.

[0243] In some embodiments, a guide nucleic acid comprises from 5' to 3' one scaffold sequence, one guide sequence, one scaffold sequence, one guide sequence, and one scaffold sequence, wherein the scaffold sequences are the same or different, and wherein the guide sequences are the same or different.

[0244] In some embodiments, a guide nucleic acid comprises from 5' to 3' one guide sequence, one scaffold sequence, one guide sequence, one scaffold sequence, and one guide sequence, wherein the scaffold sequences are the same or different, and wherein the guide sequences are the same or different.

[0245] In some embodiments, a guide nucleic acid comprises from 5' to 3' one scaffold sequence, one guide sequence, one scaffold sequence, one guide sequence, one scaffold sequence, and one guide sequence, wherein the scaffold sequences are the same or different, and wherein the guide sequences are the same or different.

[0246] In some embodiments, a guide nucleic acid comprises from 5' to 3' one guide sequence, one scaffold sequence, one guide sequence, one scaffold sequence, one guide sequence and one scaffold sequence, wherein the scaffold sequences are the same or different, and wherein the guide sequences are the same or different.

[0247] In some embodiments, the guide nucleic acid comprises a linker or does not comprise a linker between any adjacent scaffold sequence and the guide sequence. In some embodiments, the guide nucleic acid does not comprise a linker between any adjacent scaffold sequence and the guide sequence.

[0248] Multiple guide nucleic acids

[0249] The systems of the present disclosure can comprise or encode one guide nucleic acid, or can comprise or encode multiple (e.g., 2, 3, 4, or more) guide nucleic acids, for example, for the purpose of increasing the editing efficiency of the system for the target DNA.

[0250] In some embodiments, the system further comprises one or more additional guide nucleic acids, or the first polynucleotide sequence further comprises one or more additional sequences encoding one or more additional guide nucleic acids, each of the additional guide nucleic acids comprising:

[0251] (1) another scaffold sequence capable of forming a complex with the Cas12f polypeptide, and

[0252] (2) an additional guide sequence that is capable of hybridizing to an additional target sequence on the target strand of the target DNA or an additional target sequence on its transcript, thereby directing the complex to the target DNA or transcript.

[0253] In some embodiments, the additional protospacer sequence is on the same strand as the protospacer sequence.

[0254] In some embodiments, the additional protospacer sequence is on a different strand than the protospacer sequence.

[0255] In some embodiments, the additional protospacer sequence is the same as or different from the protospacer sequence.

[0256] In some embodiments, the additional target sequence is the same as or different from the target sequence.

[0257] In some embodiments, the additional guide sequence is the same or different from the guide sequence.

[0258] In some embodiments, the additional scaffold sequence is the same or different from the scaffold sequence. In some embodiments in which the system comprises the same Cas12f polypeptide and multiple guide nucleic acids, the scaffold sequences of multiple guide nucleic acids can be the same or different (e.g., differing by no more than 5, 4, 3, 2 or 1 nucleotides) to be compatible with the same Cas12f polypeptide. In some embodiments in which the system comprises different Cas12f polypeptides and multiple guide nucleic acids, the scaffold sequences of multiple guide nucleic acids can be different to be compatible with different Cas12f polypeptides.

[0259] In some embodiments, the additional guide nucleic acid and the guide nucleic acid are operably linked to or under the regulation of the same regulatory element (e.g., promoter) or separate regulatory elements (e.g., promoters).

[0260] In some embodiments, the system comprises two or more guide nucleic acids comprising two or more guide sequences capable of hybridizing to two or more target sequences of the same target DNA or different target DNAs, wherein the two or more guide sequences are the same or different, and wherein the two or more target sequences are the same or different.

[0261] Guide to the properties and modification of nucleic acids

[0262] In some embodiments, the guide nucleic acid (e.g., guide nucleic acid, additional guide nucleic acid) is RNA. In some embodiments, the guide nucleic acid is an unmodified guide RNA. In some embodiments, the guide nucleic acid is a modified guide RNA. In some embodiments, the guide nucleic acid comprises a modification. In some embodiments, the guide nucleic acid is a modified RNA containing modified ribonucleotides. In some embodiments, the guide nucleic acid is a modified RNA containing deoxyribonucleotides. In some embodiments, the guide nucleic acid is a modified RNA containing modified deoxyribonucleotides. In some embodiments, the guide nucleic acid comprises modified or unmodified deoxyribonucleotides and modified or unmodified ribonucleotides.

[0263] Scaffold sequence

[0264] For the purpose of the present disclosure, the scaffold sequence is compatible with the Cas12f polypeptide of the present disclosure, and can be compounded with the Cas12f polypeptide.The scaffold sequence can be a naturally occurring scaffold sequence identified together with the Cas12f polypeptide or a variant thereof that maintains the ability to be compounded with the Cas12f polypeptide.Generally, as long as the secondary structure of the variant is substantially the same as the secondary structure of the naturally occurring scaffold sequence, the ability to be compounded with the Cas12f polypeptide can be maintained.The nucleotide deletion, insertion or substitution in the primary sequence of the scaffold sequence may not necessarily change the secondary structure of the scaffold sequence (for example, the relative position and / or size of the stem, protrusion and ring of the scaffold sequence will not significantly deviate from the relative position and / or size of the original stem, protrusion and ring).For example, nucleotide deletion, insertion or substitution can be in the protrusion or loop region of the scaffold sequence, so that the overall symmetry of the protrusion and therefore the secondary structure remains roughly the same.Nucleotide deletion, insertion or substitution can also be in the stem of the scaffold sequence, so that the length of the stem does not significantly deviate from the length of the original stem (for example, adding or missing a base pair in each of the two stems corresponds to a total of 4 base changes).

[0265] refer to Fig.24 In some embodiments, the scaffold sequence is a fusion of the tracrRNA sequence and the repeat sequence of the crRNA with or without a loop.

[0266] In some embodiments, the scaffold sequence comprises the tracrRNA sequence of any one of SEQ ID NOs: 111-144.

[0267] In some embodiments, the scaffold sequence comprises a repeat sequence of any one of SEQ ID NOs: 145-178.

[0268] In some embodiments, the crRNA sequence comprises a repeat sequence and a guide sequence of any one of SEQ ID NOs: 145-178.

[0269] In some embodiments, the tracrRNA sequence comprises an anti-repeat sequence at its 3' end, which can form a duplex with the repetitive sequence.

[0270] The repetitive sequence is derived from a direct repeat (DR) sequence identified with a homologous Cas12f polypeptide. In some embodiments, the repetitive sequence is derived from a direct repeat sequence of any one of SEQ ID NOs: 179-212.

[0271] In some embodiments, the scaffold sequence or additional scaffold sequence has a secondary structure substantially identical to the secondary structure of any one of SEQ ID NOs: 73-106 (optionally any one of SEQ ID NOs: 73, 74, 76, 77, 87, 100, 101, 103, and 104).

[0272] In some embodiments, a scaffold sequence or an additional scaffold sequence:

[0273] (i) a polynucleotide sequence comprising any one of SEQ ID NOs: 73-106 (optionally any one of SEQ ID NOs: 73, 74, 76, 77, 87, 100, 101, 103 and 104); or

[0274] (ii) comprises a polynucleotide sequence having at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to any one of SEQ ID NOs:73-106 (optionally any one of SEQ ID NOs:73, 74, 76, 77, 87, 100, 101, 103 and 104).

[0275] Increased on-target cutting

[0276] Engineering or optimization strategies can be applied to the scaffold sequence of the guide nucleic acid of the present disclosure to assist the Cas12f polypeptide of the present disclosure in on-target cleavage.

[0277] In some embodiments, when both are used in combination with the same Cas12f polypeptide (e.g., the Cas12f polypeptide of any of the preceding claims) in an otherwise identical guide nucleic acid, with any one of SEQ ID NOs: 73-106 (optionally SEQ ID In some embodiments, the scaffold sequence results in increased guide sequence-specific (on-target) dsDNA cleavage activity, such as at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300% or more, compared to any one of NOS:73, 74, 76, 77, 87, 100, 101, 103 and 104).

[0278] In some embodiments, the scaffold sequence comprises a base pair substitution of a thermodynamically unstable base pair (eg, an AU base pair or a mismatched base pair) with a GC base pair.

[0279] In some embodiments, the scaffold sequence comprises a base pair substitution of a thermodynamically unstable base pair (e.g., an AU base pair or a mismatched base pair) with a GC base pair relative to SEQ ID NO: 73, and comprises a polynucleotide sequence of any one of SEQ ID NOs: 234-236, 239-242, 244-247, and 250-251, or a polynucleotide sequence of any one of SEQ ID NOs: 234-236, 239-242, 244-247, and 250-251. NO:234-236, 239-242, 244-247 and 250-251 have a polynucleotide sequence with at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity; optionally, wherein the scaffold sequence comprises the polynucleotide sequence of SEQ ID NO:244.

[0280] In some embodiments, the scaffold sequence comprises a base pair substitution of a thermodynamically unstable base pair (e.g., an AU base pair or a mismatched base pair) with a GC base pair relative to SEQ ID NO: 74, and comprises the polynucleotide sequence of SEQ ID NO: 257, or a polynucleotide sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the polynucleotide sequence of SEQ ID NO: 257.

[0281] Specific combination of Cas12f or its mutant and scaffold sequence or its mutant

[0282] The scaffold sequence of the guide nucleic acid of the present disclosure is required to be compatible with the Cas12f polypeptide of the present disclosure, so as to allow the composite of the Cas12f polypeptide of the present disclosure and the guide nucleic acid of the present disclosure. A scaffold sequence can be compatible with several Cas12f polypeptides, and vice versa. Non-limiting combinations are provided below.

[0283] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 1 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 226), and wherein the scaffold sequence comprises SEQ ID NO: 73 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 244).

[0284] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 2 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 227), and wherein the scaffold sequence comprises SEQ ID NO: 74 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 257).

[0285] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 3 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 75 or a mutant thereof as defined in any preceding claim.

[0286] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 4 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 76 or a mutant thereof as defined in any preceding claim.

[0287] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 5 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 77 or a mutant thereof as defined in any preceding claim.

[0288] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 6 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 78 or a mutant thereof as defined in any preceding claim.

[0289] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 7 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 79 or a mutant thereof as defined in any preceding claim.

[0290] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 8 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 80 or a mutant thereof as defined in any preceding claim.

[0291] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 9 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 81 or a mutant thereof as defined in any preceding claim.

[0292] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 10 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 82 or a mutant thereof as defined in any preceding claim.

[0293] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 11 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 83 or a mutant thereof as defined in any preceding claim.

[0294] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 12 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 84 or a mutant thereof as defined in any preceding claim.

[0295] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 13 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 85 or a mutant thereof as defined in any preceding claim.

[0296] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 14 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 86 or a mutant thereof as defined in any preceding claim.

[0297] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 15 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 87 or a mutant thereof as defined in any preceding claim.

[0298] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 16 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 88 or a mutant thereof as defined in any preceding claim.

[0299] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 17 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 89 or a mutant thereof as defined in any preceding claim.

[0300] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 18 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 90 or a mutant thereof as defined in any preceding claim.

[0301] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 19 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 91 or a mutant thereof as defined in any preceding claim.

[0302] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 20 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 92 or a mutant thereof as defined in any preceding claim.

[0303] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 21 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 93 or a mutant thereof as defined in any preceding claim.

[0304] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 22 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 94 or a mutant thereof as defined in any preceding claim.

[0305] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 23 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 95 or a mutant thereof as defined in any preceding claim.

[0306] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 24 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 96 or a mutant thereof as defined in any preceding claim.

[0307] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 25 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 97 or a mutant thereof as defined in any preceding claim.

[0308] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 26 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 98 or a mutant thereof as defined in any preceding claim.

[0309] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 27 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 99 or a mutant thereof as defined in any preceding claim.

[0310] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 28 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 100 or a mutant thereof as defined in any preceding claim.

[0311] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 29 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 101 or a mutant thereof as defined in any preceding claim.

[0312] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 30 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 102 or a mutant thereof as defined in any preceding claim.

[0313] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 31 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 103 or a mutant thereof as defined in any preceding claim.

[0314] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 32 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 104 or a mutant thereof as defined in any preceding claim.

[0315] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 33 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 105 or a mutant thereof as defined in any preceding claim.

[0316] In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 34 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 106 or a mutant thereof as defined in any preceding claim.

[0317] Directing the regulation of nucleic acids

[0318] In some embodiments, the polynucleotide encoding the guide nucleic acid is DNA, RNA, or a DNA / RNA mixture. A "DNA / RNA mixture" refers to a nucleic acid comprising one or more modified or unmodified ribonucleotides and one or more modified or unmodified deoxyribonucleotides, whether or not continuous. However, "DNA" or "RNA" may also refer to a DNA containing one or more modified or unmodified ribonucleotides, whether or not continuous, or an RNA containing one or more modified or unmodified deoxyribonucleotides, whether or not continuous.

[0319] In some embodiments, the guide nucleic acid is operably linked to or under the regulation of a promoter.

[0320] In some embodiments, the promoter is a ubiquitous promoter, a tissue-specific promoter, a cell-type-specific promoter, a constitutive promoter, or an inducible promoter.

[0321] Suitable promoters are known in the art and include, for example, Cbh promoter, Cba promoter, pol I promoter, pol II promoter, pol III promoter, T7 promoter, U6 promoter, H1 promoter, retroviral Rous sarcoma virus LTR promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, elongation factor 1 alpha short (EFS) promoter, β-glucuronidase (GUSB) promoter, cytomegalovirus (CMV) immediate early (le) enhancer and / or promoter, chicken β-actin (CBA) promoter or derivatives thereof such as CAG promoter, CB promoter, (human) elongation factor 1 alpha-subunit (EF1α) promoter, ubiquitin C (UBC) promoter, prion promoter, neuron-specific enolase (NSE), neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, Platelet-derived growth factor (PDGF) promoter, platelet-derived growth factor B chain (PDGF-β) promoter, synapsin (Syn) promoter, synapsin 1 (Syn1) promoter, methyl-CpG binding protein 2 (MeCP2) promoter, Ca2+ / calmodulin-dependent protein kinase II (CaMKII) promoter, metabotropic glutamate receptor 2 (mGluR2) promoter, neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, β-globin minigene nβ2 promoter, preproenkephalin (PPE) promoter, enkephalin (Enk) promoter, excitatory amino acid transporter 2 (EAAT2) promoter, glial fibrillary acidic protein (GFAP) promoter, and myelin basic protein (MBP) promoter.

[0322] Regulation of Cas12f polypeptide

[0323] In some embodiments, the polynucleotide encoding the Cas12f polypeptide is DNA, RNA, or a DNA / RNA mixture. "DNA / RNA mixture" refers to a nucleic acid comprising one or more modified or unmodified ribonucleotides and one or more modified or unmodified deoxyribonucleotides, whether or not continuous. However, "DNA" or "RNA" may also refer to a DNA containing one or more modified or unmodified ribonucleotides, whether or not continuous, or an RNA containing one or more modified or unmodified deoxyribonucleotides, whether or not continuous.

[0324] In some embodiments, the polynucleotide encoding the Cas12f polypeptide is operably linked to or under the regulation of a promoter.

[0325] In some embodiments, the promoter is a broad spectrum promoter, a tissue-specific promoter, a cell type-specific promoter, a constitutive promoter, or an inducible promoter.

[0326] Suitable promoters are known in the art and include, for example, the Cbh promoter, the Cba promoter, the pol I promoter, the pol II promoter, the pol III promoter, T7 promoter, U6 promoter, H1 promoter, retroviral Rous sarcoma virus LTR promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, elongation factor 1 alpha short (EFS) promoter, β-glucuronidase (GUSB) promoter, cytomegalovirus (CMV) immediate early (Ie) enhancer and / or promoter, chicken β-actin (CBA) promoter or its derivatives such as CAG promoter, CB promoter, (human) elongation factor 1 alpha-subunit (EF1α) promoter, ubiquitin C (UBC) promoter, prion promoter, neuron-specific enolase (NSE), neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, platelet-derived growth factor (PDGF) promoter, platelet-derived growth factor B chain (PDGF-β) promoter, synaptophysin (Syn) promoter, human synapsin (hSyn) promoter, synapsin 1 (Syn1) promoter, methyl-CpG binding protein 2 (MeCP2) promoter, Ca2+ / calmodulin-dependent protein kinase II (CaMKII) promoter, metabotropic glutamate receptor 2 (mGluR2) promoter, neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, β-globin minigene nβ2 promoter, preproenkephalin (PPE) promoter, enkephalin (Enk) promoter, excitatory amino acid transporter 2 (EAAT2) promoter, glial fibrillary acidic protein (GFAP) promoter, myelin basic protein (MBP) promoter, OTOF promoter, GRK1 promoter, CRX promoter, NRL promoter, MECP2 promoter, mMECP2 promoter, hMECP2 promoter, APP promoter and RCVRN promoter.

[0327] deliver

[0328] According to practical needs, various delivery methods can be applied to the Cas12f polypeptide of the present disclosure or the system of the present disclosure.

[0329] In yet another aspect, the present disclosure provides a polynucleotide encoding the Cas12f polypeptide of the present disclosure, such as any one of SEQ ID NOs: 39-72.

[0330] In yet another aspect, the present disclosure provides a delivery system comprising (1) a Cas12f polypeptide of the present disclosure, a polynucleotide of the present disclosure, or a system of the present disclosure; and (2) a delivery vehicle.

[0331] In yet another aspect, the present disclosure provides a vector comprising a polynucleotide of the present disclosure. In some embodiments, the vector encodes a guide nucleic acid of the present disclosure. In some embodiments, the vector is a plasmid vector, a recombinant AAV (rAAV) vector (vector genome) or a recombinant lentiviral vector.

[0332] In yet another aspect, the present disclosure provides a recombinant AAV (rAAV) particle comprising the rAAV vector genome of the present disclosure. A brief introduction to AAV for delivery can be found in the "Adeno-associated virus (AAV) Guide" (addgene.org / guides / aav / ).

[0333] Adeno-associated virus (AAV), when engineered for delivery of, for example, a protein coding sequence of interest, may be referred to as an (r)AAV vector, (r)AAV vector particle, or (r)AAV particle, where "r" stands for "recombinant". And the genome packaged in an AAV vector for delivery may be referred to as an (r)AAV vector genome, vector genome, or simply vg, while the viral genome may refer to the original viral genome of native AAV.

[0334] The serotype of the rAAV particle capsid can be matched to the type of target cell. For example, Table 2 of WO 2018002719A1 lists exemplary cell types that can be transduced by the indicated AAV serotypes (incorporated herein by reference).

[0335] In some embodiments, the rAAV particles include a capsid of a serotype suitable for delivery to an ear cell (e.g., inner hair cell). In some embodiments, the rAAV particles include a capsid of a serotype of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, or AAV.PHP.eB, AAV1-AAV13 to which any one belongs, or a functional variant thereof (e.g., a functional truncation), which encapsulates the rAAV vector genome. In some embodiments, the serotype of the capsid is AAV9 or a functional variant thereof.

[0336] The general principles of rAAV particle production are known in the art. In some embodiments, rAAV particles can be produced using the triple transfection method (described in detail in US Pat. No. 6,001,650).

[0337] Vector titer is usually expressed as vector genome / ml (vg / ml). In some embodiments, the vector titer is greater than 1×10 9 , higher than 5×10 10, higher than 1×10 11 , higher than 5×10 11 , higher than 1×10 12 , higher than 5×10 12 or higher than 1×10 13 vg / ml.

[0338] As an alternative to packaging single-stranded (ss) DNA sequences as vector genomes of rAAV particles, systems and methods for packaging RNA sequences as vector genomes into rAAV particles have recently been developed and can be applied herein. See PCT / CN2022 / 075366, which is incorporated herein by reference in its entirety.

[0339] When the vector genome is RNA, such as in PCT / CN 2022 / 075366, for the sake of simplicity of description and declaration, the sequence elements for the DNA vector genome described herein, when present in the RNA vector genome, should generally be considered to be applicable to the RNA vector genome, except that the deoxyribonucleotides in the DNA sequence are the corresponding ribonucleotides in the RNA sequence (e.g., dT is equivalent to U, and dA is equivalent to A) and / or the elements in the DNA sequence are replaced with corresponding elements having corresponding functions in the RNA sequence, or are omitted because their functions are not required in the RNA sequence, and / or additional elements necessary for the RNA vector genome are introduced.

[0340] As used herein, a coding sequence (e.g., as a sequence element of an rAAV vector genome herein) is interpreted, understood, and considered to cover and encompass both DNA coding sequences and RNA coding sequences. When it is a DNA coding sequence, an RNA sequence can be transcribed from the DNA coding sequence, and optionally a protein can be further translated from the transcribed RNA sequence as needed. When it is an RNA coding sequence, the RNA coding sequence itself can be a functional RNA sequence for use, or an RNA sequence can be generated from the RNA coding sequence (e.g., by RNA processing), or a protein can be translated from the RNA coding sequence.

[0341] For example, a Cas13 coding sequence encoding a Cas13 polypeptide covers a Cas13 DNA coding sequence from which the Cas13 polypeptide is expressed (indirectly via transcription and translation) or a Cas13 RNA coding sequence from which the Cas13 polypeptide is translated (directly).

[0342] For example, a gRNA coding sequence encoding a gRNA covers a gRNA DNA coding sequence from which the gRNA is transcribed or a gRNA RNA coding sequence that (1) is itself a functional gRNA for use or (2) from which the gRNA is generated (e.g., by RNA processing).

[0343] In some embodiments of the rAAV RNA vector genome, the 5'-ITR and / or 3'-ITR may not be necessary as DNA packaging signals and may be at least partially omitted, but RNA packaging signals may be introduced.

[0344] In some embodiments of the rAAV RNA vector genome, a promoter driving transcription of a DNA sequence may not be necessary and may be at least partially omitted.

[0345] In some embodiments of the rAAV RNA vector genome, the sequence encoding the polyA signal may be unnecessary and may be at least partially omitted, but a polyA tail may be introduced.

[0346] Similarly, other DNA elements of the rAAV DNA vector genome can be omitted or replaced with corresponding RNA elements and / or additional RNA elements can be introduced to accommodate strategies for delivering the RNA vector genome by rAAV particles.

[0347] In yet another aspect, the present disclosure provides a ribonucleoprotein (RNP) comprising a Cas12f polypeptide of the present disclosure and a guide nucleic acid of the present disclosure.

[0348] In yet another aspect, the present disclosure provides a lipid nanoparticle (LNP) comprising an RNA (e.g., mRNA) encoding a Cas12f polypeptide of the present disclosure and a guide nucleic acid of the present disclosure.

[0349] Modification method

[0350] The CRISPR-Cas12f system of the present disclosure comprising the Cas12f polypeptide of the present disclosure has various utilities, including modifying (e.g., cutting, deleting, inserting, translocating, inactivating or activating) target DNA in various cell types. The CRISPR-Cas12f system has a wide range of applications, such as drug screening, disease diagnosis and prognosis, and treatment of various genetic disorders, which require high cutting activity and small size.

[0351] The methods and / or systems disclosed herein can be used to modify target DNA, for example, to modify the translation and / or transcription of one or more genes of a cell. For example, the modification can result in an increase in the transcription / translation / expression of a gene. In other embodiments, the modification can result in a decrease in the transcription / translation / expression of a gene.

[0352] In yet another aspect, the present disclosure provides a method for modifying a target DNA, the method comprising contacting the target DNA with a system of the present disclosure, a vector of the present disclosure, a ribonucleoprotein of the present disclosure, or a lipid nanoparticle of the present disclosure, wherein the guide sequence is capable of hybridizing with a target sequence of the target DNA, wherein the target DNA is modified by the complex. In some embodiments, the target DNA is within a cell.

[0353] In some embodiments, the modification comprises one or more of cleavage, base editing, repair, and insertion or integration of exogenous sequences into the target DNA.

[0354] cell

[0355] The methods of the present disclosure can be used to introduce the systems of the present disclosure into cells and cause the cells to alter the production of one or more cell products (such as antibodies, starch, ethanol or any other desired product). Such cells and their progeny are within the scope of the present disclosure.

[0356] In yet another aspect, the present disclosure provides a cell comprising a system of the present disclosure. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a human cell.

[0357] In yet another aspect, the disclosure provides a cell modified by a system of the disclosure or a method of the disclosure. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is modified in vitro, in vivo, or ex vivo.

[0358] In some embodiments, the cell is a stem cell. In some embodiments, the cell is not a human embryonic stem cell. In some embodiments, the cell is not a human germ cell.

[0359] In some embodiments, the cell is a prokaryotic cell.

[0360] In some embodiments, the cell is a eukaryotic cell (e.g., an animal cell, a vertebrate cell, a mammalian cell, a non-human mammalian cell, a non-human primate cell, a rodent (e.g., a mouse or rat) cell, a human cell, a plant cell, or a yeast cell) or a prokaryotic cell (e.g., a bacterial cell).

[0361] In some embodiments, the cell is from a plant or animal.

[0362] In some embodiments, the plant is a dicot. In some embodiments, the dicot is selected from soybean, cabbage (e.g., Chinese cabbage), rapeseed, Brassica, watermelon, melon, potato, tomato, tobacco, eggplant, pepper, cucumber, cotton, alfalfa, eggplant, grape.

[0363] In some embodiments, the plant is a monocot. In some embodiments, the monocot is selected from rice, corn, wheat, barley, oats, sorghum, millet, grasses, Poaceae, Zizania, Avena, Coix, Hordeum, Oryza, Panicum (e.g., Panicum miliaceum), Secale, Setaria (e.g., Setaria italica), Sorghum, Triticum, Zea, Cymbopogon, Saccharum (e.g., Saccharum officinarum), Phyllostachys, Dendrocalamus, Bambusa, Yushania.

[0364] In some embodiments, the animal is selected from the group consisting of pigs, cows, sheep, goats, mice, rats, alpacas, monkeys, rabbits, chickens, ducks, geese, fish (eg, zebrafish).

[0365] In some embodiments, the cell is a eukaryotic cell, such as a mammalian cell, including a human cell (primary human cell or an established human cell line). In some embodiments, the cell is a non-human mammalian cell, such as a cell from a non-human primate (e.g., monkey), a cow / bull / cow, a sheep, a goat, a pig, a horse, a dog, a cat, a rodent (such as a rabbit, a mouse, a rat, a hamster, etc.). In some embodiments, the cell is from a fish (such as a salmon), a bird (such as a bird, including a chicken, a duck, a goose), a reptile, a shellfish (e.g., an oyster, a clam, a lobster, a prawn), an insect, a worm, a yeast, etc. In some embodiments, the cell is from a plant, such as a monocot or a dicot. In certain embodiments, the plant is a food crop, such as barley, cassava, cotton, groundnut or peanut, maize, millet, oil palm fruit, potato, dry bean, rapeseed or canola, rice, rye, sorghum, soybean, sugarcane, beet, sunflower and wheat. In some embodiments, the plant is a cereal (barley, maize, millet, rice, rye, sorghum, and wheat). In some embodiments, the plant is a tuber (cassava and potato). In some embodiments, the plant is a sugar crop (sugar beet and sugar cane). In some embodiments, the plant is an oil crop (soybean, groundnut or peanut, rapeseed or canola, sunflower, and oil palm fruit). In some embodiments, the plant is a fiber crop (cotton). In some embodiments, the plant is a tree (such as a peach or nectarine tree, an apple or pear tree, a nut tree (such as an almond or walnut or pistachio tree), or a citrus tree (e.g., an orange, grapefruit, or lemon tree)), a grass, a vegetable, a fruit, or an algae. In certain embodiments, the plant is a Solanum; a Brassica; a Lactuca; a Spinacia; a Capsicum; cotton, tobacco, asparagus, carrot, cabbage, broccoli, cauliflower, tomato, eggplant, pepper, lettuce, spinach, strawberry, blueberry, raspberry, blackberry, grape, coffee, cocoa, etc.

[0366] Pharmaceutical composition

[0367] In yet another aspect, the present disclosure provides a pharmaceutical composition comprising (1) the system of the present disclosure, the vector of the present disclosure, the ribonucleoprotein of the present disclosure, the lipid nanoparticle of the present disclosure, or the cell of the present disclosure; and (2) a pharmaceutically acceptable excipient.

[0368] In some embodiments, the pharmaceutical composition comprises rAAV particles at a concentration selected from about 1×10 10 vg / mL, 2×10 10 vg / mL, 3×10 10 vg / mL, 4×10 10vg / mL, 5×10 10 vg / mL, 6×10 10 vg / mL, 7×10 10 vg / mL, 8×10 10 vg / mL, 9×10 10 vg / mL, 1×10 11 vg / mL, 2×10 11 vg / mL, 3×10 11 vg / mL, 4×10 11 vg / mL, 5×10 11 vg / mL, 6×10 11 vg / mL, 7×10 11 vg / mL, 8×10 11 vg / mL, 9×10 11 vg / mL, 1×10 12 vg / mL, 2×10 12 vg / mL, 3×10 12 vg / mL, 4×10 12 vg / mL, 5×10 12 vg / mL, 6×10 12 vg / mL, 7×10 12 vg / mL, 8×10 12 vg / mL, 9×10 12 vg / mL, 1×10 13 vg / mL, or a concentration in a numerical range between any two of the foregoing values, such as about 9×10 10 vg / mL to about 8×10 11 The concentration of vg / mL.

[0369] In some embodiments, the pharmaceutical composition is an injectable solution.

[0370] In some embodiments, the volume of the injection solution is selected from about 1 microliter, 10 microliters, 50 microliters, 100 microliters, 150 microliters, 200 microliters, 250 microliters, 300 microliters, 350 microliters, 400 microliters, 450 microliters, 500 microliters, 550 microliters, 600 microliters, 650 microliters, 700 microliters, 750 microliters, 800 microliters, 850 microliters, 900 microliters, 950 microliters, 1000 microliters, and volumes in a numerical range between any two of the foregoing values, for example, a concentration of about 10 microliters to about 750 microliters.

[0371] Treatment

[0372] In yet another aspect, the present disclosure provides a method for diagnosing, preventing or treating a disease in a subject in need thereof, the method comprising administering to the subject (e.g., a therapeutically effective dose of) a system of the present disclosure, a vector of the present disclosure, a ribonucleoprotein of the present disclosure, a lipid nanoparticle of the present disclosure, a cell of the present disclosure or a pharmaceutical composition of the present disclosure, wherein the disease is associated with a target DNA, wherein the guide sequence is capable of hybridizing with a target sequence of the target DNA, wherein the target DNA is modified by the complex, and wherein modification of the target DNA diagnoses, prevents or treats the disease.

[0373] In some embodiments, the disease is selected from Angelman syndrome (AS), Alzheimer's disease (AD), transthyretin amyloidosis (ATTR), transthyretin amyloid cardiomyopathy (ATTR-CM), cystic fibrosis (CF), hereditary angioedema, diabetes, Duchenne muscular dystrophy, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), spinal muscular atrophy (SMA), alpha-1-antitrypsin deficiency, Pompe disease, myotonic dystrophy, Huntington's disease (HTT), fragile X syndrome, Friedreich's ataxia, myopathy Atrophic lateral sclerosis (ALS), frontotemporal dementia, inherited chronic kidney disease, hyperlipidemia, Leber congenital amaurosis (LCA), sickle cell disease, thalassemia (e.g., beta thalassemia), Parkinson's disease (PD), myelodysplastic syndrome (MDS), retinitis pigmentosa (RP), age-related macular degeneration (AMD), hepatitis B, non-alcoholic fatty liver disease (NAFLD), acquired immunodeficiency syndrome, corneal dystrophy (CD), hypercholesterolemia, familial hypercholesterolemia (FH), heart disease (e.g., hypertrophic cardiomyopathy (HCM)), and cancer.

[0374] In some embodiments, the target DNA encodes mRNA, tRNA, ribosomal RNA (rRNA), microRNA (miRNA), non-coding RNA, long non-coding (lnc) RNA, nuclear RNA, interfering RNA (iRNA), small interfering RNA (siRNA), ribozyme, riboswitch, satellite RNA, microswitch, yeast (microzyme) or viral RNA.

[0375] In some embodiments, the target DNA is eukaryotic DNA.

[0376] In some embodiments, the eukaryotic DNA is mammalian DNA (such as non-human mammalian DNA), non-human primate DNA, human DNA, plant DNA, insect DNA, bird DNA, reptile DNA, rodent (e.g., mouse, rat) DNA, fish DNA, nematode DNA, or yeast DNA.

[0377] In some embodiments, the target DNA is within a eukaryotic cell, such as a human cell, a non-human primate cell, or a mouse cell.

[0378] In some embodiments, administering comprises local administration or systemic administration.

[0379] In some embodiments, administration comprises intrathecal administration, intramuscular administration, intravenous administration, transdermal administration, intranasal administration, oral administration, mucosal administration, intraperitoneal administration, intracranial administration, intracerebroventricular administration, or stereotactic administration.

[0380] In some embodiments, administration is injection or infusion.

[0381] In some embodiments, the subject is a human, a non-human primate, or a mouse.

[0382] In some embodiments, the level of a transcript (e.g., mRNA) of a target DNA is reduced in a subject by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more compared to the level of a transcript (e.g., mRNA) of the target DNA in the subject before administration.

[0383] In some embodiments, the level of a transcript (e.g., mRNA) of a target DNA is increased in a subject by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more compared to the level of a transcript (e.g., mRNA) of the target DNA in the subject before administration.

[0384] In some embodiments, the level of an expression product (e.g., protein) of a target DNA in a subject is reduced by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more compared to the level of an expression product (e.g., protein) of the target DNA in the subject before administration.

[0385] In some embodiments, the level of the expression product (e.g., protein) of the target DNA in the subject is increased by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% or more in the subject compared to the level of the expression product (e.g., protein) of the target DNA in the subject before administration. In some embodiments, the expression product is a functional mutant of the expression product of the target DNA.

[0386] In some embodiments, the median survival of subjects who have the disease but receive the administration is 5 days, 10 days, 20 days, 30 days, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1.5 years, 2 years, 2.5 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or longer than the median survival of a subject or population of subjects who have the disease and do not receive the administration.

[0387] The therapeutically effective dose can be via a single dose or multiple doses. It will be appreciated by those skilled in the art that the actual dose may vary greatly depending on a variety of factors, such as vector selection, target cells, organisms, tissues, the general condition of the subject to be treated, the degree of transformation / modification sought, route of administration, mode of administration, the type of transformation / modification sought, etc.

[0388] For example, a therapeutically effective dose of rAAV particles can be about 1.0E+8, 2.0E+8, 3.0E+8, 4.0E+8, 6.0E+8, 8.0E+8, 1.0E+9, 2.0E+9, 3.0E+9, 4.0E+9, 6.0E+9, 8.0E+9, 1.0E+10, 2.0E+10, 3.0E+10, 4.0E+10, 6.0E+10, 8.0E+10, 1.0E+11, 2.0E+11, 3.0E+11, 4.0E+11, 6.0E+11, 8.0E+11, 1.0E+12, 2.0E+12, 3.0E+12, 4.0E+12, 6.0E+13, 8.0E+13, + 15, 2.0E+15, 3.0E+15, 4.0E+15, 6.0E+15, 8.0E+15, 1.0E+16, 2.0E+16, 3.0E+16, 4.0E+16, 6.0E+16, 8.0E+16, or 1.0E+17 vg, or a range between any two of these point values. vg represents the vector genome of the rAAV particle used for administration.

[0389] Detection Methods

[0390] In yet another aspect, the present disclosure provides a method for detecting a target DNA, the method comprising contacting the target DNA with a system of the present disclosure, wherein the target DNA is modified by the complex, and wherein the modification detects the target DNA. In some embodiments, the modification generates a detectable signal, such as a fluorescent signal.

[0391] Reagent test kit

[0392] In yet another aspect, the present disclosure provides a kit comprising a Cas12f polypeptide of the present disclosure, a system of the present disclosure, a polynucleotide of the present disclosure, a vector of the present disclosure, an RNP of the present disclosure, an LNP of the present disclosure, a delivery system of the present disclosure, a cell of the present disclosure, or a pharmaceutical composition of the present disclosure, or any one, two or all of its components.

[0393] In some embodiments, the kit further includes instructions for using one or more components contained therein, and / or for combining with additional one or more components that may be obtained or required elsewhere.

[0394] In some embodiments, the kit further comprises one or more buffers, which can be used to dissolve any of the components contained therein, and / or provide suitable reaction conditions for one or more of the components. Such buffers can include one or more of the following: PBS, HEPES, Tris, MOPS, Na2CO3, NaHCO3, NaB or a combination thereof. In some embodiments, the reaction conditions include a suitable pH, such as an alkaline pH. In some embodiments, the pH is between 7-10.

[0395] In some embodiments, any one or more of the kit components can be stored in a suitable container or stored at a suitable temperature, such as 4 degrees Celsius.

[0396] Further embodiments are described in the following examples, which are provided for illustrative purposes only and are not intended to limit the scope of the present disclosure.

[0397] Example

[0398] Two ultra-compact Cas12f1s from Oscillibacter sp. (OsCas12f1) and Ruminiclostridium herbifermentans (RhCas12f1) are particularly presented herein. Through protein engineering and sgRNA optimization, enhanced OsCas12f1 (enOsCas12f1) and enhanced RhCas12f1 (enRhCas12f1) systems are produced, which show both high- and low-target cleavage activity and low-off-target cleavage activity, and also show extensive target recognition in human cells. In addition, enOsCas12f1 and its inducible form are delivered by a single AAV in humanized mdx mice to achieve effective recovery of dystrophin. In addition, enOsCas12f1 is engineered for both epigenome editing and gene activation.

[0399] Materials and methods

[0400] Unless otherwise specified, the experimental procedures used in the examples are conventional.

[0401] Unless otherwise specified, the materials, reagents, etc. used in the Examples are commercially available. Unless otherwise specified, the following materials and experimental methods were used in the Examples.

[0402] Ethical Statement

[0403] All studies in this disclosure complied with all relevant ethical regulations, and animal experiments were approved by the Animal Care and Use Committee of HuidaGene Therapeutics Co., Ltd, Shanghai, China.

[0404] Computational analysis and PAM prediction of the CRISPR-Cas12f system

[0405] More than 200,000 bacterial genomes were downloaded from the NCBI database. First, the applicant used TBLASTN and UnCas12f protein to identify sequences containing Cas12f in bacterial genomes with E values ​​<1e-10 downloaded from NCBI. Then, the "0.Cas-Finder.pl" script was used to annotate CRISPR arrays and Cas proteins with sequences containing Cas12f. The applicant further used "1.Cas12f-Finder.pl" to annotate Cas12f proteins with conserved RuvC and Zn finger domains.

[0406] Then, the definition of the 5' boundary of crRNA depends on the prediction of the anti-repeat sequence in tracrRNA. The same-direction repeat sequence of the crRNA of mature Cas12 is usually in the 3' end sequence of about 22nt. Therefore, the applicant uses the 22nt sequence at the 3' end of DR to search for non-coding sequences between the Cas12f gene and the CRISPR array.

[0407] The applicant defines a non-coding sequence containing at least 9 AU / CG pairs and at least 65% of the AU / CG / GU pairs (with a 22nt sequence at the 3' end of the DR) as an anti-repetitive sequence. The applicant further extends 150nt upstream of the anti-repetitive sequence to obtain a potential tracrRNA sequence. Then, RNAfold is used to predict the secondary structure of the potential tracrRNA sequence, and the applicant retains the sequence with a conservative secondary structure in the Cas12f family. Based on the above principles, the applicant wrote the "2.Cas12f.tracrRNA.Finder.pl" script to predict the tracrRNA sequence of the Cas12f variant.

[0408] The applicant initially predicted the PAM of 34 CRISPR-Cas12f systems through CRISPRTarget, and successfully predicted ten of these CRISPR-Cas12f systems (Table 1). Then the PAM of other CRISPR-Cas12f systems was predicted based on the protein homology with those Cas12f1s that successfully obtained PAM through CRISPRTarget.

[0409] Plasmid construction and purification of Cas12f1 protein

[0410] Human codon-optimized Cas12f1 protein and sgRNA were synthesized and cloned by NEBuilder (New England Biolabs) to generate pCAG_NLS-Cas12f-NLS_pA_pU6_gRNA Scaffold-2xBpiI_pCMV_mCherry_pA. The spacer sequence was annealed and ligated to the BpiI site.

[0411] In order to generate Cas12f1 mutants, regions 1-3 of OsCas12f1 and RhCas12f1 were divided into 11 segments with a length of 17 amino acid residues. By PCR and Gibson assembly method (using NEBuilder HiFi DNA assembly master mix (New England Biolabs)), by replacing the 11 segments mentioned above with BpiI recognition sequences, 11 skeleton mutants of OsCas12f1 and RhCas12f1 were generated respectively. Then specific mutations were introduced by incorporating annealed oligonucleotides containing mutations via BpiI digestion and T4 DNA ligase connection.

[0412] Full-length OsCas12f1, enOsCas12f1, RhCas12f1 or enRhCas12f1 were cloned into pET-32a to express Cas12f1 protein with C-terminal 6xHis. The plasmids were transformed into Escherichia coli BL21 (DE3) cells and grown at 37°C to OD 600The expression of protein was induced by incubating overnight with 0.5 mM IPTG at 18 ° C. The cells were harvested and lysed by ultrasonic treatment in buffer A (50 mM Tris-HCl (PH = 8.0), 50 mM imidazole, 1.5 M NaCl). After centrifugation, the supernatant was collected and loaded onto a HisTrap HP column (Cytiva) and eluted with buffer B (50 mM Tris-HCl (PH = 8.0), 600 mM imidazole, 1.5 M NaCl). The eluted protein was exchanged into buffer C, which contained 20 mM Tris-HCl (PH = 8.0), 0.3 M NaCl, 1 mM DTT and 2% (v / v) glycerol. The protein was then loaded onto a HiTrap Heparin HP column (Situofan), equilibrated with buffer C, and eluted using a linear gradient of NaCl concentration increasing from 0.3 M to 2.0 M. The obtained protein was stored in buffer D (25 mM Tris-HCl (PH = 8.0), 150 mM NaCl, 2 mM DTT, and 1 mM MgCl2). For long-term storage, the protein was supplemented with 10% (v / v) glycerol, then rapidly frozen in liquid nitrogen, and stored at -80°C.

[0413] sgRNA synthesis

[0414] sgRNA was prepared by in vitro transcription using the MEGA shortscript T7 kit (Life Technologies) and purified by the MEGA clear kit (Life Technologies). DNA templates for T7 transcription were generated by PCR using primers containing the T7 promoter. The sequences of these sgRNAs are provided in Table 5.

[0415] In vitro cleavage assay and PAM characterization

[0416] The Cas12f1 ribonucleoprotein (RNP, 1 μM) complex was assembled by mixing the Cas12f1 protein with the sgRNA in a 1:1 molar ratio and then mixing with incubation assembly buffer (10mM Tris-HCl, pH 7.5, 100mMNaCl, 1 mM EDTA, 1 mM DTT) at 37°C for 30 min. 5nM supercoiled plasmid or linear plasmid containing the target sequence was incubated with 250 nM Cas12f1 RNP in reaction buffer (2.5 mM Tris-HCl, pH 7.5, 25 mM NaCl, 0.25 mMDTT and 10 mM MgCl2) at 46°C or the indicated temperature for testing the optimal temperature for one hour. The reaction was terminated with quenching buffer (20mM EDTA, 0.1 mg / ml proteinase K). The digestion products were analyzed with 1% agarose gel. For run-off sequencing, the digestion products were purified and subjected to Sanger sequencing.

[0417] In vitro PAM characterization was performed as previously described. In brief, a dsDNA library with a 7-bp random sequence followed by a protospacer sequence was created by PCR with a primer having 7 Ns. In vitro cleavage was performed as mentioned above. The cleavage product with the 7 N sequence was gel purified, adapter-ligated, and PCR for NGS. PAM motifs were drawn using the top 1000 enriched PAM sequences by WebLogo.

[0418] Size Exclusion Chromatography

[0419] To verify the formation of Cas12f1-sgRNA complex, Cas12f1 RNP was assembled in vitro with a 4:3 molar ratio of protein:gRNA in buffer D at 37°C for 30 min and analyzed on a Superdex200Increase 10 / 300 column (Situofan) equilibrated with buffer D. In view of the fact that OsCas12f1 protein could not be eluted from a column equilibrated with buffer D (possibly due to nonspecific interactions with the resin), Cas12f1 protein without sgRNA was analyzed using buffer E (20 mMTris-HCl (PH = 8.0), 500 mM NaCl, 1 mM DTT, and 5 mM MgCl2). Gel filtration standards (Bio-Rad, No. 1511901) were used for calibration.

[0420] Cell culture, transfection, and flow cytometric analysis

[0421] HEK293T cells (Stem Cell Bank, Chinese Academy of Sciences) cultured in DMEM supplemented with 10% FBS and penicillin / streptomycin were seeded on 24-well poly-D-lysine coated plates (Corning). For EGFP activation assays, 3.2 μl of PEI (Polyscience) and 1.6 μg of plasmid (0.8 μg of reporter plasmid + 0.8 μg of plasmid expressing Cas12f) were transfected according to the manufacturer's manual. Forty-eight hours after transfection, flow cytometry analysis was performed to evaluate EGFP activation efficiency. In order to analyze the insertion and deletion efficiency of endogenous genes, HEK293T cells were transfected with 2 μl of PEI and 1 μg of plasmid expressing Cas12f and sgRNA boxes. At 72 h after transfection, mCherry positive cells were collected by FACS sorting.

[0422] Analysis of insertion / deletion efficiency at human endogenous genomic loci

[0423] According to the manufacturer's manual, eight thousand sorted cells were harvested to extract genomic DNA by adding 20 μl lysis buffer (Vazyme). For the TIDER test, nested PCR was used to amplify the genomic region near the Cas nuclease target site by Phanta Max Super-Fidelity DNA Polymerase (Vazyme). Sanger sequencing and analysis were performed on the purified PCR products as previously described. For deep sequencing analysis, nested PCR (primers with barcodes were used) was used to amplify the targeted genomic region by Phanta Max Super-Fidelity DNA Polymerase (Vazyme). The PCR product was purified by gel extraction kit (Vazyme) and sequenced on Illumina HiSeq X system (150-bp double-end sequencing reads). The forward read was compared with the reference sequence using BWA (v0.7.17-r1188) with the parameter "bwa mem-A2-O3-E1". At each target, edits were calculated as the percentage of total reads containing the desired edit without indels within a 10-bp window of the cut site. Target site information is provided in Table 4.

[0424] PEM-seq analysis

[0425] PEM-seq was performed in HEK293 cells as previously described. In brief, enOsCas12f1, LbCas12a, SpCas9, and Un1Cas12f_ge4.1 targeting target 36, as well as expression plasmids of enRhCas12f1 and SpCas9 targeting PCSK9 were transfected into HEK293 cells by PEI, and after 72 h, positive cells were harvested for DNA extraction. 20 μg of genomic DNA was fragmented by Covaris sonication with a peak length of 300-700 bp. The DNA fragments were labeled with biotin at the 5' end by a round of biotinylated primer extension, and then the primers were removed by AMPure XP beads and purified by streptavidin beads. The single-stranded DNA on the streptavidin beads was connected to a bridging adapter containing a 14-bp RMB, and the PCR products were subjected to nested PCR to enrich the DNA fragments containing the bait DSB and labeled with the illumine adapter sequence. The prepared sequencing library was sequenced on Hi-seq 2500 at 2 × 150 bp.

[0426] animal

[0427] All animal experiments were performed and approved by the Animal Care and Use Committee of Shanghai Huida Biotechnology Co., Ltd., China. Mice were housed in a barrier facility with a 12-h light / dark cycle and 18°C-23°C and 40%-60% humidity. Diet and water were available at all times. DMD mice were generated in a C57BL / 6 J background using the CRISPR-Cas9 system. Duchenne muscular dystrophy (DMD) is the most common sex-linked lethal disease in humans, so male mice were selected for this study.

[0428] Intramuscular injection

[0429] rAAV9 particles were produced by PackGene Biotech (Guangzhou, China) and purified by iodixanol density gradient centrifugation. For intramuscular injection, DMD mice were anesthetized and injected with 50 μL of AAV9 (5 × 10 11 vg) preparation or the same volume of saline solution was injected into the TA (tibialis anterior) muscle. Three weeks after the intramuscular injection of rAAV9, the mice were anesthetized and euthanized, and the TA (tibialis anterior) muscles were collected.

[0430] RT-PCR and TA cloning

[0431] Muscle total mRNA was extracted, and cDNA was synthesized using HiScript II One Step RT-PCR kit (Novagen, P611-01) according to the manufacturer's protocol. Then, each 20 μl PCR reaction was carried out on C1000 Touch Thermal Cycler (Bio-Rad), each reaction containing about 2 μl cDNA, each forward primer and reverse primer of 0.25 μM and 10 μl of Ex taq (Takara, RR001A). Amplification conditions consisted of the following: initial maintenance of 5 min, followed by 35 cycles of 95 ° C for 30 s, 60 ° C for 30 s and 72 ° C for 30 s. PCR products were analyzed by gel electrophoresis.

[0432] For detected RNA splicing, TA cloning was performed according to the protocol of the pEASY-T5 Zero Cloning kit (TransGen Biotech, CT501-01). In short, the PCR product was used for agarose gel electrophoresis to verify the quality and quantity. 4 μl of PCR product and pEASY-T5 Zero Cloning vector were gently mixed, incubated at room temperature for 10 minutes, and then the ligation product was added to 50 μl of Trams1-T1 phage-resistant chemical competent cells and plated on LB / Amp+, followed by sequencing with M13F.

[0433] Western blotting

[0434] The muscle samples were homogenized with RIPA buffer supplemented with a protease inhibitor cocktail. Lysate supernatant was quantified with Pierce BCA protein assay kit (Thermo Fisher Scientific, 23225), and H2O was used to adjust to the same concentration. Samples were mixed with NuPAGE LDS sample buffer (Invitrogen, NP0007) and 10% β-mercaptoethanol, then boiled at 70°C for 10min. 20 μg total protein / lane was loaded into 3% to 8% tris-acetate gel (Invitrogen, EA03752BOX), and electrophoresed at 200V for 1 hour. At 350mA, under wet conditions, protein was transferred to a PVDF membrane for 3.5 hours. The membrane was blocked in 5% skim milk in TBST buffer, and then incubated with the primary antibody of the marker-specific protein. After washing three times with TBST, the membrane was further incubated with HRP-conjugated secondary antibody (1:1000 dilution, Beyotime, A0216) specific for IgG of the species of the primary antibody against dystrophin (1:1000 dilution, Sigma, D8168) and primary antibody against vinculin (1:1000 dilution, CST, 13901 S). Target proteins were visualized using chemiluminescent substrate (Invitrogen, WP20005).

[0435] Immunofluorescence

[0436] The tissue was collected and sealed in the optimal cutting temperature (OCT) compound and rapidly frozen in liquid nitrogen. The frozen serial cryosections (10 μm) were fixed at 37°C for 2 hours, then permeabilized with PBS + 0.4% Triton-X for 30 min. After washing with PBS, the samples were blocked with 10% goat serum at room temperature for 1 hour. Then, the slides were incubated overnight at 4°C with a primary antibody for dystrophin (1:100 dilution, Abcam, ab15277) and a primary antibody for spectrin (1:500 dilution, Millipore, MAB1622). Thereafter, the samples were washed thoroughly with PBS and incubated with compatible secondary antibodies (Alexa Fluor 488AffiniPure donkey anti-rabbit IgG (1:1000 dilution, Jackson ImmunoResearch labs, 711-545-152) or Alexa Fluor 647AffiniPure donkey anti-mouse IgG (1:1000 dilution, Jackson ImmunoResearch labs, 715-605-151)) and DAPI at room temperature for 2 h. The samples were washed with PBS for 10 min and repeated three times. And then, the slides were sealed with fluoromount-G mounting medium. All images were visualized under Nikon C2. The amount of dystrophin-positive myofibers was expressed as the percentage of total spectrin-positive myofibers.

[0437] Efficiency testing of micro-CRISPRoff

[0438] One microgram of plasmids expressing mini-CRISPRoff and CRIPSRoff containing mCherry was transfected into HEK293T cells stably expressing Snrp-GFP. Two days after transfection, mCherry-positive cells were sorted and cultured for FACS analysis at the indicated times.

[0439] For bisulfite sequencing analysis, genomic DNA was processed by BisulFlash DNA Modification kit (EPIGENTEK) according to the manufacturer's protocol. The PCR amplicon of the GAPDH-Snrp promoter was purified and cloned into a TA cloning vector (VAYZYME). Randomly picked colonies were used for Sanger sequencing.

[0440] Statistics and reproducibility

[0441] Frequencies, means, and standard deviations were calculated using GraphPad Prism 8. Whole genome sequencing analysis was performed using BWA (v0.7.17-r1188) with parameters "bwa mem-A2-O3-E1". PEM-seq data analysis was performed using the PEM-Q pipeline with default parameters. Two or three biologically independent replicates were performed, as demonstrated in the legends. In this study, no statistical methods were used to predetermine sample size, and no data were excluded from the analysis. The experiment was not randomized, and the investigators were not blinded to the allocation during the experiment and outcome assessment.

[0442] Example 1.2 Identification and characterization of class VF type CRISPR-Cas (Cas12f) system

[0443] 34 previously unrecorded and uncharacterized CRISPR-Cas12f systems (Table 1) were identified using a self-developed computational pipeline to annotate Cas12f orthologs, CRISPR arrays, tracrRNA, and PAM preferences. The amino acid sequences of the Cas12f1 proteins of the 34 identified systems and 4 reported Cas12f systems (controls; Table 1) are listed in SEQ ID NOs: 1-38, respectively. The codon-optimized coding sequences of the 34 identified Cas12f1 proteins are listed in SEQ ID NOs: 39-72, respectively. The direct repeat (DR) sequences accompanying the Cas12f1 proteins are listed in SEQ ID NOs: 179-212, respectively. The reported CRISPR-Cas12f system was used as a control for comparison.

[0444] Table 1. List of identified and reported CRISPR-Cas12f systems

[0445]

[0446]

[0447] To evaluate the efficiency of spacer sequence-specific (on-target) dsDNA cleavage (referred to as “dsDNA cleavage” unless otherwise indicated) in eukaryotic cells by these CRISPR-Cas12f systems, an enhanced green fluorescent protein (EGFP) reporter system ( Figure 1 b and Fig. 22). For disclosures of similar assays, see also CN 202111290670.8, CN 202111289092.6, CN202210081981.1, PCT / CN2022 / 129376, and PCT / CN2023 / 073420, each of which is incorporated herein by reference in its entirety. The reporter system relies on co-transfection with a reporter plasmid and an expression plasmid.

[0448] Reporter plasmid ( Figure 1 b and Fig. 22 ) carries a BFP-T2A-GFxxFP expression cassette having an inactivated EGFP coding sequence (GFxxFP) containing an insertion sequence (SEQ ID NO: 213; containing an alternative 5' PAM (to accommodate the PAM preferences of various Cas12 proteins), premature stop codons (to prevent EGFP expression) and 3' PAM (to adapt to Cas9 protein)) (refer to the PAM of each Cas12f1 protein in Table 1). BFP indicates successful transfection and expression of the reporter plasmid in the host cell.

[0449] SEQ ID NO:213, insert sequence containing PAM and stop codon

[0450]

[0451] SEQ ID NO: 214, protospacer sequence / targeting spacer sequence

[0452] CCATTACAGTAGGAGCATAC

[0453] SEQ ID NO: 215, non-targeting spacer sequence

[0454] GGGTCTTCGAGAAGACCT

[0455] Expression plasmid ( Figure 1 b and Fig. 22 ) An expression cassette carrying each Cas12f1 protein and its sgRNA targeting the insertion sequence in the reporter plasmid and mCherry, which indicates that the expression plasmid was successfully transfected and expressed in the host cell.

[0456] Each Cas12f1 protein was tagged at its N-terminus with an SV40 nuclear localization sequence (SV40 NLS) (SEQ ID NO: 216; encoded by SEQ ID NO: 217) and at its C-terminus with a nucleoplasmic protein NLS (NP NLS, npNLS) (SEQ ID NO: 218; encoded by SEQ ID NO: 219).

[0457] SEQ ID NO:216, SV40 NLS amino acid sequence

[0458] PKKKRKV

[0459] SEQ ID NO:217, SV40 NLS coding sequence

[0460] CCTAAGAAGAAGAGAAAGGTG

[0461] SEQ ID NO:218, NP NLS amino acid sequence

[0462] KRPAATKKAGQAKKKK

[0463] SEQ ID NO:219, NP NLS coding sequence

[0464] AAAAGGCCGGCGGCCACGAAGAAGGCCGGCCAGGCAAAGAAGAAGAAG

[0465] The polynucleotide sequences corresponding to the scaffold sequences of sgRNAs of 34 identified systems and 4 reported systems are listed in SEQ ID NOs: 73-110, respectively.

[0466] The sgRNA encoded on the expression plasmid consists of a scaffold sequence (one of SEQ ID NOs: 73-110), a targeting spacer sequence (SEQ ID NO: 214) that can hybridize with the insertion sequence (SEQ ID NO: 213) in the reporter plasmid, and a stabilizing sequence (SEQ ID NO: 220) for increasing the stability of the sgRNA from 5' to 3', and there is no linker between any two of the aforementioned components. Each scaffold sequence of SEQ ID NOs: 73-106 consists of a tracrRNA (one of SEQ ID NOs: 111-144), a GAAA tetraloop as a linker, and a repeat sequence (one of SEQ ID NOs: 145-178) from 5' to 3'. In other words, the sgRNA consists of a tracrRNA (SEQ ID NO: 111-144), a GAAA tetraloop as a linker, a crRNA and a stabilizing sequence (SEQ ID NO: 220) from 5' to 3', without a linker between any two of the aforementioned components, wherein the crRNA consists of a repeat sequence (SEQ ID NO: 145-178) and a targeting spacer sequence (SEQ ID NO: 214) from 5' to 3', without a linker between them. A non-targeting (NT) spacer sequence (SEQ ID NO: 215) that cannot hybridize with the insertion sequence (SEQ ID NO: 213) is used instead of the spacer sequence (SEQ ID NO: 214) as a negative control. It should be noted that in the scaffold sequence (SEQ ID NO: 88) of MsCas12f1 (ME-B.13), tracrRNA (SEQ ID NO: 126) is directly fused to the repeat sequence (SEQ ID NO: 160) without the GAAA tetraloop. Each of the repeat sequences (SEQ ID NOs: 145-178) is derived from a corresponding DR sequence (SEQ ID NOs: 179-212).

[0467] SEQ ID NO: 220, stabilizing sequence

[0468] TTTTATTTTTTT

[0469] As guided by the sgRNA targeting the insert sequence, DSBs generated in the reporter plasmid by dsDNA cleavage by the Cas12f1 protein induce SSA-mediated repair of the GFxxFP coding sequence, thereby activating EGFP expression ( Figure 1 b and Figure 7 e), indicating dsDNA cleavage, which is represented by the percentage of GFP-positive cells among mCherry and BFP double-positive cells (GFP +Cell / mCherry + BPF + % of cells).

[0470] Using this fluorescence screening method, the following nine identified CRISPR-Cas12f systems ( Figure 1 c, Figure 7 f, Fig.23 ) were functionally characterized to show dsDNA cleavage activity: OsCas12f1 (ME-B.3, SEQ ID NO:1), RhCas12f1 (ME-A.1, SEQ ID NO:2), Ob3Cas12f1 (ME-B.5, SEQ ID NO:4), Cb1Cas12f1 (ME-B.14, SEQ ID NO:5), HsCas12f1 (ME-B.12, SEQ ID NO:15), BsCas12f1 (ME-A.12, SEQ ID NO:28), Pt2Cas12f1 (ME-A.9, SEQ ID NO:29), ChCas12f1 (ME-A.2, SEQ ID NO:31) and Cs2Cas12f1 (ME-A.6, SEQ ID NO:32).

[0471] Based on the observation of robust EGFP activation by OsCas12f1, HsCas12f1, Cb1Cas12f1, and RhCas12f1 in HEK293T cells, the frequency of indels generated by these Cas12f1 at endogenous genomic loci (PCKS9, TTR, DMD, and DNMT1 genes) was also verified. dsDNA cleavage activity (genome editing efficiency) is represented by indel %. The results show that the genome editing efficiency of OsCas12f1, HsCas12f1, Cb1Cas12f1, and RhCas12f1 is moderate, with indel frequencies ranging from about 1% to about 20% ( Figure 8 ).for Figure 8 a- Figure 8 d, The four groups of columns from left to right are OsCas12f1, HsCas12f1, Cb1Cas12f1, and Un1Cas12f1_ge4.1.

[0472] Two CRISPR-Cas12f systems, OsCas12f1 (433 aa) and RhCas12f1 (415 aa), with the highest dsDNA cleavage activity (as indicated by GPF activation efficiency) were selected for further study, recognizing 5' T-rich PAM (e.g., 5'-TTTC) and 5' C-rich PAM (e.g., 5'-CCCA / TCCA), respectively. Both OsCas12f1 and RhCas12f1 are ultra-compact, with gene sizes less than half of those of SpCas9, LbCas12a, and SaCas9 ( Figure 1 d and Figure 1 e).

[0473] Further, in vitro cleavage of a library of DNA fragments containing 7-bp random sequences indicated that OsCas12f1 and RhCas12f1 recognized 5'-{C / T; T / C / A; T / C / A; C / A / T} (i.e., in a four-letter 5'PAM, the first nucleotide can be C or T; the second nucleotide can be T or C or A; the third nucleotide can be T or C or A; and the fourth nucleotide can be C or A or T) and 5'-{N; C / A / G; C; A / T / G} (i.e., in a four-letter 5'PAM, the first nucleotide can be A or T or G or C; the second nucleotide can be C or A or G; the third nucleotide can be Cl; and the fourth nucleotide can be A or T or G), respectively. Figure 1 f).

[0474] By designing insert sequences and corresponding sgRNAs with different lengths of target sequences and corresponding spacer sequences, the effect of spacer length on the cleavage efficiency of OsCas12f1 and RhCas12f1 was explored, which showed that a length of at least 16 nt and an optimal length of 20 nt worked for both OsCas12f1 and RhCas12f1 ( Fig. 9 a and Fig. 9 b).

[0475] The cleavage activity of OsCas12f1 was abolished by introducing point mutations leading to D228A (SEQ ID NO: 221) or D406A (SEQ ID NO: 222) residue conversions in the conserved active site of the RuvC domain, generating endonuclease-deficient (inactive) OsCas12f1 variants ( Fig. 9 c and Fig. 9 d). Similarly, RhCas12f1 can be inactivated by non-synonymous point mutations resulting in D210A (SEQ ID NO: 223) or D388A (SEQ ID NO: 224) conversion mutations, generating endonuclease-deficient (inactive) RhCas12f1 variants ( Fig. 9e). Each single mutation is in the conserved active site of the RuvC domain of the Cas12f1 protein.

[0476] The biochemical properties of OsCas12f1 and RhCas12f1 proteins were tested ( Fig.10 a). Linear plasmid cleavage assays showed that both OsCas12f1 and RhCas12f1 had dsDNA cleavage activity over a wide range of temperatures (preferably 37°C-50°C) ( Fig.10 b). The cleavage activity of OsCas12f1 and RhCas12f1 was confirmed on both supercoiled plasmids and linear plasmids ( Fig.10 c). In order to characterize the dsDNA cleavage pattern of OsCas12f1 and RhCas12f1, run-off sequencing of the in vitro cleavage products was performed, indicating that OsCas12f1 and RhCas12f1 cleave dsDNA at sites 21-25 bp downstream of 5'-PAM to form sticky ends ( Fig.10 d and Fig.10 e).

[0477] Size exclusion chromatography was performed to determine complex formation between Cas12f1 proteins and their sgRNAs, indicating that, at least under the conditions tested, both OsCas12f1 and RhCas12f1 can form dimers in the presence of sgRNAs, similar to Un1Cas12f1 ( Fig.11 ).

[0478] Together, these results indicate that OsCas12f1 and RhCas12f1 provide ultracompact DNA editing tools with moderate genome editing efficiency and relatively broad target range.

[0479] Example 2. Arginine substitution in the REC / RuvC domain and CG base pair substitution in sgRNA enhance the cleavage efficiency of OsCas12f1 and RhCas12f1

[0480] To increase the cleavage efficiency of OsCas12f1 and RhCas12f1, these Cas12f1 proteins were engineered by mutagenesis and screening for more efficient variants using the same GFP-activated reporter system as described above ( Figure 1 b and Fig. 22 ).

[0481] Based on protein alignment of OsCas12f1 and RhCas12f1 with Un1Cas12f1, three regions that potentially respond to binding nucleic acids were defined ( Fig.12The amino acids in regions 1-3 of OsCas12f1 and RhCas12f1, except for the positively charged residues including lysine, arginine, and histidine, were individually mutated to arginine by mutagenesis as previously reported ( Fig.13 , Table 2).

[0482] In the first round, two mutant libraries were generated in these three regions, each containing more than 100 mutants of OsCas12f1 or RhCas12f1. These mutants were then co-transfected into HEK293T cells with reporter plasmids individually, and the EGFP activation efficiency of the reporter system in Example 1 was evaluated by flow cytometry ( Figure 2 a). Although most mutants showed similar or lower efficiency than wild-type OsCas12f1 (WTOsCas12f1), a subset of mutants exhibited increased activity ( Figure 2 b and Table 2).

[0483] Compared with WTOsCas12f1, the most effective OsCas12f1 mutant D52R (OsCas-D52R; SEQ ID NO: 225) showed a 1.31-fold increase ( Figure 2 b). To determine whether substitutions with other amino acids could further enhance cleavage efficiency beyond that of the D52R variant, D52 was mutagenized to saturation and it was found that the R substitution did confer better or slightly better OsCas12f1 nuclease activity ( Fig.14 a). "NT" refers to a negative control using a non-targeting spacer (SEQ ID NO: 215).

[0484] Table 2. Cleavage activity of OsCas12f1 and RhCas12f1 mutants

[0485]

[0486]

[0487]

[0488]

[0489] A second round of iterative screening was performed by mutating OsCas12f1-D52R, identified as an enhanced OsCas12f1 mutant in the first round of screening, with an additional mutation. Using a library containing 15 double mutants of OsCas12f1, it was found that R substitutions at A54, S119, T132, and S141 further increased the activity of OsCas12f1-D52R ( Figure 2c). Therefore, the most effective OsCas12f1 mutant containing the T132R+D52R double mutation (OsCas12f1-D52R+T132R; SEQ ID NO: 226) was selected for further engineering.

[0490] The stabilizing sequence 5'-TTTTATTTTTTT-3' was fused to the 3' end of the sgRNA to increase stability and thus improve editing efficiency, and an sgRNA optimization strategy was used for the scaffold sequence of the sgRNA, including truncating or deleting base pairs in the RNA stem region ( Figure 2 d and Table 3).

[0491] In the scaffold sequence of the sgRNA, AU or mismatched base pairs are replaced with thermodynamically stable CG base pairs, which increases the stability of the sgRNA ( Figure 2 d and Table 3). As measured by the reporter system in Example 1, these sgRNA variants resulted in significantly higher OsCas12f1-mediated cleavage activity, especially Os-sg1.1 (SEQ ID NO: 234), which contained AU substituted with CG at the stem 1 region of tracrRNA and showed a 1.56-fold increase in GFP activation efficiency compared to WTOsCas12f1 (SEQ ID NO: 73). Figure 2 e). Therefore, the Os-sg1.1 variant (SEQ ID NO: 234) was selected for further optimization of OsCas12f1. Based on the first round of optimization of OsCas12f1 sgRNA, it was speculated that substitution with CG base pairs in sgRNA might be beneficial for increasing the activity of OsCas12f1. To confirm this hypothesis, more base pairs on Os-sg1.1 were substituted with CG base pairs, resulting in an sgRNA library with 13 variants. Through the second round of sgRNA screening, several sgRNA variants that showed higher activity compared to Os-sg1.1 were identified. Among these sgRNA variants, Os-sg2.6 (SEQ ID NO: 244) outperformed the other variants ( Figure 2 f).

[0492] Table 3. Scaffold sequence variants

[0493]

[0494]

[0495]

[0496] We further determined whether the corresponding increase in the cleavage activity of OsCas12f1 obtained by Cas protein engineering and sgRNA engineering was an additive effect. We first used the Os-sg1.1 sgRNA variant to guide the OsCas12f1-D52R protein variant. This combined variant system showed higher cleavage activity ( 100 ng / ml) than the individual variant systems (Cas12f1 variant plus WT sgRNA, or WT Cas12f1 plus sgRNA variant). Fig.14 b). Os-sg2.6 was then used to guide OsCas12f1-D52R, which was superior to the D52R+Os-sg1.1 combinatorial variant system ( Fig.14 c- Fig.14 f). Finally, by combining T132R with D52R+Os-sg2.6, the most effective combinatorial variant system was generated, named the "enOsCas12f1" system, which consists of OsCas12f1-D52R+T132R (SEQ ID NO: 226) and the Os-sg2.6 scaffold sequence (SEQ ID NO: 244) ( Figure 2 g and Fig.14 g). At the DMD locus, enOsCas12f1 showed a 9.4-fold increase compared to WT OsCas12f1 ( Fig.14 h).

[0497] To generate enRhCas12f1, seven high-performance protein variants (T131R, S130R, A273R, I264R, L270R, Y125R, A56R) were selected in combination with the most efficient sgRNA variant, Rh-sg1.1 (SEQ ID NO: 257) ( Figure 2 h- Figure 2 j). Among these combinatorial variants, the RhCas12f1-L270R (SEQ ID NO: 227) + Rh-sg1.1 scaffold sequence (SEQ ID NO: 257) combinatorial variant system (named "enRhCas12f1" system) outperformed the other systems, showing a 1.61-fold increase ( Figure 2 k and Fig.14 i).

[0498] Additionally, in vitro PAM characterization assays were performed to determine the PAM preferences of the engineered Cas12f1 proteins, indicating that enOsCas12f1 prefers PAM 5'-TTH (H = non-G) (compared to 5'-TTG), while enRhCas12f1 prefers PAM 5'-CCD (D = non-C) ( Fig.15). Based on the in vitro PAM characterization results, the PAM preferences of different Cas12f1 proteins (including OsCas12f1, enOsCas12f1, and Un1Cas12f1_ge4.1) were further compared in HEK293T cells using GFP activation reporters with fixed T at positions 2 and 3 of the 5'-PAM (5'-NTTN). The GFP activation results showed that enOsCas12f1 recognized the PAM 5'-TTN, showing a wider target range than WT OsCas12f1 and Un1Cas12f1_ge4.1, which prefer 5'-YTTH (Y = C or T, H = non-G) and 5'-TTTR (R = A or G), respectively ( Figure 3 a). Reporter with fixed C at positions 2 and 3 of 5'-PAM (5'-NCCN) was used for RhCas12f1 and enRhCas12f1. Compared with WT RhCas12f1, enRhCas12f1 had improved efficiency at all 5'-CCN PAM sites ( Figure 3 b). In addition, indel frequency analysis at 44 endogenous loci further confirmed that enOsCas12f1 was active at the 5'-NTTN target site, with indels >10% at 5'-TTC (12 of 12 sites), 5'-TTA (7 of 9 sites), 5'-TTT (9 of 11 sites), and 5'-TTG (4 of 11 sites), indicating that the PAM preference of enOsCas12f1 is

[0499] 5'-TTC > 5'-TTA>5'-TTT >5'-TTG( Figure 3 c and Figure 3 e). As expected, Un1Cas12f1_ge4.1 induced indels primarily at 5'-TTTR sites, showing >10% indels at 5'-TTA (4 of 9 sites) and 5'-TTG (2 of 11 sites) ( Figure 3 c and Figure 3 e). The PAM preference of enRhCas12f1 was also analyzed by evaluating the indel frequencies at 45 endogenous loci, revealing that enRhCas12f1 achieved >10% indels at 5'-CCA (9 of 12 sites), 5'-CCT (4 of 11 sites), and 5'-CCG (3 of 11 sites), indicating that enRhCas12f1 can recognize 5'-CCD PAM (D = non-C) ( Figure 3 d and Figure 3 f).

[0500] Therefore, protein engineering (which can increase the ability of Cas12f1 protein to bind nucleic acids) combined with CG base pair substitutions in the scaffold sequence of sgRNA can improve the cleavage activity of OsCas12f1 and RhCas12f1 and broaden the target range of OsCas12f1.

[0501] Example 3. enOsCas12f1 and enRhCas12f1 enable robust genome editing in human cells

[0502] Further evaluation of whether enOsCas12f1 and enRhCas12f1 can effectively edit endogenous genomic loci in human cells. In order to comprehensively compare the editing efficiency of enOsCas12f1, enRhCas12f1 and the disclosed high-performance Cas12f1 (Un1Cas12f1_ge4.1), the targeting of all accessible sites (access site) in PCSK9, TTR and VEGFA exons was quantified strictly based on the PAM sequence without considering the potential sgRNA and target features (such as GC content) that contribute to the activity of Cas nuclease. In summary, the insertion and deletion frequencies were quantified at 30 sites targeted by enOsCas12f1 (5'-NTTC PAM), 61 sites targeted by enRhCas12f1 (5'-TCCA and 5'-CCCA PAM), and 27 sites targeted by Un1Cas12f1_ge4.1 (5'-TTTR PAM).

[0503] The results showed that enOsCas12f1 induced indels (>1%) at a maximum efficiency of 96.2% in all 30 tested loci, while enRhCas12f1 induced indels (>1%) at a maximum efficiency of 93.3% in 53 of 61 tested loci. In contrast, Un1Cas12f1_ge4.1 produced relatively low indel frequencies (>1%) in 22 of the 27 tested loci, with a maximum efficiency of 60.6% ( Figure 4 a). Thus, on average, enOsCas12f1 (54.7% ± 29.8%, mean ± sd) showed 3.9 times the efficiency of Un1Cas12f1_ge4.1 (14.0% ± 18.1%), and enRhCas12f1 (23.3% ± 26.8%) showed 1.7 times the efficiency of Un1Cas12f1_ge4.1 (14.0% ± 18.1%). Figure 4b). When evaluating the indel frequencies induced by enOsCas12f1 and Un1Cas12f1_ge4.1 (targeting the PCSK9 and TTR loci by exactly the same sgRNA), it was found that enOsCas12f1 showed an average of 78.6 times higher indel frequency than Un1Cas12f1_ge4.1 at the 5'-TTC PAM site and 8.4 times higher efficiency at their respective preferred 5'-PAMs (5'-TTC for enOsCas12f1 and 5'-TTTR for Un1Cas12f1_ge4.1) ( Figure 4 c and Figure 4 d). According to these advantages of enOsCas12f1 over Un1Cas12f1_ge4.1, editing efficiencies as high as 54.4% ± 29.9% and 59.1% ± 23.1% were achieved at the therapeutic target loci PCSK9 and TTR, respectively, while Un1Cas12f1_ge4.1 showed relatively low editing efficiencies with average efficiencies of 2.3% ± 1.9% and 15.2% ± 18.7% ( Figure 4 c and Figure 4 d) In addition, the 5'-TTC-N 20 Indel analysis was performed at the endogenous sites of -3'-NGN and the activities of enOsCas12f1 and SpG were compared, indicating that enOsCas12f1 was superior to SpG at these target sites ( Figure 4 e).

[0504] High-throughput sequencing of the target loci revealed that both enOsCas12f1 and enRhCas12f1 primarily produced deletions rather than insertions that altered the protospacer sequence ( Figure 4 f, Fig.16 The center of the deletion is located in the PAM-distal region outside the protospacer sequence ( Figure 4 f, Fig.16 ), which is similar to Un1Cas12f1 and AsCas12f1.

[0505] Example 4. Specificity of genome editing mediated by enOsCas12f1 and enRhCas12f1

[0506] The mismatch tolerance of enOsCas12f1 and enRhCas12f1 was first evaluated by filling single or adjacent double mismatches in the spacer sequence. For the PCSK9 locus, enOsCas12f1 was intolerant to single mismatches at positions 3 / 5 / 11, while mismatches at other positions slightly reduced the editing efficiency mediated by enOsCas12f1 ( Figure 5a), which was also verified by the GFP activation system ( Fig.17 Two adjacent mismatches at positions 1-16 significantly reduced enOsCas12f1 activity ( Figure 5 a).

[0507] The mismatch tolerance of enRhCas12f1 was evaluated at the endogenous PCSK9 locus or by a GFP-activated reporter system, indicating that enRhCas12f1 partially tolerated base pair mismatches at the PAM-distal region (especially at positions 19 and 20), while mismatches close to the PAM significantly reduced the activity of enRhCas12f1 ( Figure 5 b and Fig.17 ).

[0508] Targeted deep sequencing was performed at computer-predicted off-target sites (P2RX5-TAX1BP3, intergenic regions, NLRC4, and CLIC4). Targeted deep sequencing indicated that the on-target editing efficiency of enOsCas12f1 was comparable to that of LbCas12a and slightly higher than that of Un1Cas12f1_ge4.1. Similar to LbCas12a and Un1Cas12f1_ge4.1, enOsCas12f1 showed extremely low off-target effects at potential off-target sites, while for enOsCas12f1, low off-target effects were found at the CLIC4 OT7 site ( Figure 5 c).

[0509] Finally, PEM-seq was performed to quantify the genome-wide editing specificity of enOsCas12f1 and enRhCas12f1. When targeting target 36 sites, enOsCas12f1 and Un1Cas12f1_ge4.1 were found to induce five off-target sites, while LbCas12a and SpCas9 were found to induce four of the off-target sites and one ( Figure 5 d). When targeting target site 36, enOsCas12f1 exhibited a translocation rate of 7.03%, which is comparable to Un1Cas12f1_ge4.1 (8.44%), LbCas12a (9.22%), and SpCas9 (8.19%) ( Figure 5 e). When targeting the PCSK9 locus, enRhCas12f1 showed no detectable off-target sites and had low translocation efficiency, whereas 2 off-target sites were found for SpCas9 ( Figure 5 d and Figure 5 e). Taken together, these results indicate that enOsCas12f1 and enRhCas12f1 exhibit high genome editing efficiency, broad target range, and low off-target effects.

[0510] Example 5. enOsCas12f1-mediated in vivo genome editing and enOsCas12f1-based epigenome editing and gene activation via a single AAV delivery

[0511] The relatively small size of enOsCas12f1 suggests that its expression cassette can be packaged with multiple sgRNAs in a single rAAV vector, which may enable its therapeutic application to treat genetic disorders that require large deletions, such as Duchenne muscular dystrophy (DMD). To test whether enOsCas12f1 can be used for DMD exon 51 deletion, effective sgRNAs (5'gRNA and 3'gRNA) flanking exon 51 were first screened, indicating that enOsCas12f1 efficiently induced indels at the four target sites, while enRhCas12f1 and Un1Cas12f1_ge4.1 exhibited relatively low editing efficiencies ( Fig.18 a; The Cas proteins from left to right are enOsCas12f1, Un1Cas12f1_ge4.1, and enRhCas12f1). Then, the effective 5'gRNA was combined with the 3'sgRNA to target enOsCas12f1 to DMD exon 51 in HEK293T cells ( Figure 6 a) PCR-based assays revealed

[0512] Robust genomic deletion of exon 51 by enOsCas12f1 targeting by sg1 (SEQ ID NO: 486) + sg16 (SEQ ID NO: 501) (~1700 bp deletion), which is more efficient than SpCas9 (~850 bp deletion), although the indel frequency of enOsCas12f1 alone sgRNA is lower than that of SpCas9 ( Figure 6 b and Fig.18 a).

[0513] Precise control of enOsCas12f1 activity across multiple dimensions, such as dosage and timing, can undoubtedly reduce potential toxicity and off-target effects induced by enOsCas12f1, especially for in vivo scenarios where enOsCas12f1 is constitutively expressed via AAV delivery. To achieve precise control of enOsCas12f1, enOsCas12f1 was fused to the destabilization domain (DD) of Escherichia coli dihydrofolate reductase (ecDHFR). The newly synthesized DD-enOsCas12f1 protein (SEQ ID NO: 260) was rapidly targeted for proteasomal degradation, which can be blocked by the small molecule trimethoprim (TMP) ( Figure 6 c).

[0514] To evaluate the in vivo deletion efficiency of DMD exon 51 induced by enOsCas12f1 and DD-enOsCas12f1, a DMD mouse model was created in which exon 52 was deleted and exon 51 was replaced by human exon 51 with flanking intronic sequences ( Figure 6 a). Deletion of exon 52 prematurely terminates dystrophin protein production, which can be restored by removing exon 51. AAV serotype 9 (AAV9) was used to deliver enOsCas12f1 or DD-enOsCas12f1 and its sgRNA expression cassette locally to skeletal muscle ( Figure 6 d). Because of the single AAV packageable size of the CRISPR-OsCas12f1 system, AAV9 was injected into the tibialis anterior muscle at a lower titer than in the case of SpCas9 (SpCas9 requires dual AAVs due to its large size). PCR-based detection across the genomic locus indicated the expected ~1700 bp deletion ( Figure 6 e). RT-PCR of mRNA extracted from whole muscle showed that the efficiency of exon 51 deleted transcripts was 22.7% ± 9.2% (mean ± sd) for enOsCas12f1 and 15.0% ± 7.0% ( Fig.18 b- Fig.18 d). Western blotting and immunostaining results of whole muscle further confirmed that dystrophin protein production was rescued by enOsCas12f1 and DD-enOsCas12f1 ( Figure 6 f- Figure 6 h). Restoration of dystrophin occurred in 11.6% ± 4.0% and 7.6% ± 2.4% of myofibers treated with enOsCas12f1 and DD-enOsCas12f1, respectively ( Figure 6 i).

[0515] Next, the efficiency of epigenome editing mediated by enOsCas12f1 was tested by adopting the CRISPRoff strategy, which was named micro-CRISPRoff (1444aa) with a protein size of 2,361aa. Four forms of micro-CRISPRoff (v1-v4; SEQ ID NOs: 261-264) were generated using an inactive enOsCas12f1 (denOsCas12f1 (OsCas12f1-D52R+T132R+D228A+T406A), SEQ ID NO: 513) ( Fig.19 ), where mini-CRISPRoff-v1, v3, and v4 silenced GFP in HEK293T cells stably expressing GAPDH-Snrp-GFP ( Figure 6j and Fig. 20 a). Bisulfite sequencing indicated that the Snrp promoter was hypermethylated by treatment with mini-CRISPRoff ( Figure 6 k). Finally, the ability of enOsCas12f1-mediated gene activation was evaluated by fusing denOsCas12f1 (SEQ ID NO: 513) to VPR (enOsCas12f1-VPR; SEQ ID NO: 265), which showed robust gene activation of GFP in TRE3G-GFP HEK293T cells ( Figure 6 l and Figure 6 m, and Fig. 20 b). Overall, these results indicate that enOsCas12f1 can be engineered as a versatile genome and epigenome editor.

[0516] All protospacer sequences and spacer sequences used in the above examples are listed in Table 4.

[0517] discuss

[0518] Although compact Cas12f orthologs have been tested in genome editing delivered by single AAV vectors in human cells, their relatively low editing efficiency and restrictive PAM requirements have limited their further application. Here, a group of class 2 VF-type CRISPR-Cas (Cas12f) subfamily members from bacteria were characterized, and nine ( Figure 1 ). Through protein engineering combined with sgRNA optimization, the enOsCas12f1 system and the enRhCas12f1 system were obtained ( Figure 2 ), showing significantly higher genome editing efficiency and wider target range compared to Un1Cas12f1_ge4.1, the most efficient Cas12f reported to date and comparable to SpCas9 ( Figure 3 and Figure 4 ). The discovery of the enOsCas12f1 and enRhCas12f1 systems greatly expanded the target range of the Cas12f system. Un1Cas12f1_ge4.1 requires a 5'-TTTR (R = A or G) PAM, while enOsCas12f1 is active at loci containing 5'-NTTN. Therefore, enOsCas12f1 broadens the target range by 8 times compared to Un1Cas12f1_ge4.1. The 5'-NCCN PAM of enRhCas12f1 is also a promising compensation for the 5' T-rich PAM constraints of enOsCas12f1 and Un1Cas12f1_ge4.1 ( Figure 3 ).

[0519] In the current study, it has been verified that rational protein engineering combined with sgRNA optimization enables enhanced interaction of Cas proteins with nucleic acids or sgRNAs and increased sgRNA stability. Notably, by replacing the AU base pair in the first stem of the sgRNA with a GC base pair, the efficiency of both OsCas12f1 and RhCas12f1 was significantly improved ( Figure 2 ).

[0520] enOsCas12f1 enables robust and specific genome editing in vitro and in vivo and can be applied to efficiently delete large fragments in the human genome, such as the approximately 1700 bp deletion of exon 51 of dystrophin ( Figure 5 and Figure 6 ). It has been shown that increased off-target mutations and DNA damage responses can be triggered by the constitutive nuclease activity of Cas proteins. Acute manipulation of the activity of enOsCas12f1 within a specified time window and within a specific type of cell is a promising way to reduce these potential unintended side effects. By conjugating the destabilizing domain of ecDHFR to enOsCas12f1 (DD-enOsCas12f1), highly specific regulation of enOsCas12f1-mediated gene editing was achieved in vivo. It is worth mentioning that DD-enOsCas12f1 can be packaged into a single AAV vector with two sgRNAs, which circumvents the obstacles associated with the larger size of Cas9 / 12 that cannot be packaged into a single AAV. In addition, cell type-specific promoters, which typically contain longer sequences, can be used to drive the expression of enOsCas12f1 and DD-enOsCas12f1 to achieve more precise control of OsCas12f1 activity using systemic delivery via AAV, which is undoubtedly safer for therapeutic applications.

[0521] The ultra-compact size of enOsCas12f1 (433aa) and enRhCas12f1 (415aa) can potentially enable them to be used for derived genome engineering applications, including base editing, lead editing, reverse transcriptase editing, epigenome editing, and gene expression regulation. Here, enOsCas12f1 is engineered for full epigenome editing (micro-CRISPRoff) and gene activation (enOsCas12f1-VPR). Interestingly, micro-CRISPRoff is engineered to obtain a more efficient and smaller size so that it can be packaged by a single AAV in the future.

[0522] In conclusion, enOsCas12f1 and enRhCas12f1 represent high-performance gene editing tools with versatile applications, and temporally and spatially controlled DD-enOsCas12f1 is a promising platform for gene therapy.

[0523] Table 4. Indel frequencies in the sequences of the target loci.

[0524]

[0525]

[0526]

[0527] Table 4 (continued)

[0528]

[0529]

[0530] Table 4 (continued)

[0531]

[0532] Table 4 (continued)

[0533]

[0534] Table 4 (continued)

[0535]

[0536] Table 4 (continued)

[0537]

[0538]

[0539] Table 4 (continued)

[0540]

[0541]

[0542] Table 4 (continued)

[0543]

[0544]

[0545] Table 4 (continued)

[0546] Protospacer / spacer sequence Attached photos SEQ ID NO of protospacer / spacer sequence TTGTGCTGGACGGTGACGTA Fig.14 d- Fig.14 f 511 CCTAGGGTCCAGCTTCAAAr Fig.14 d- Fig.14 f 512

[0547] Table 5. sgRNA IVT

[0548]

[0549] ***

[0550] Without departing from the scope and spirit of the present disclosure, various modifications and variations of the products, methods and uses of the present disclosure will be clear to those skilled in the art. Although the present disclosure has been described in conjunction with specific embodiments, it will be understood that further modifications can be made, and the disclosure claimed for protection should not be unduly limited to such specific embodiments. In fact, various modifications of the described manner for performing the present disclosure that are obvious to those skilled in the art are intended to fall within the scope of the present disclosure. The present application is intended to cover any changes, uses or adaptations of the present disclosure that generally follow the principles of the present disclosure, and includes such deviations from the present disclosure: it is within the known customary operations in the field to which the present disclosure belongs and is applicable to the basic features shown heretofore.

[0551]

[0552]

[0553]

[0554]

[0555]

[0556]

[0557]

[0558]

[0559]

[0560]

[0561]

[0562]

[0563]

[0564]

[0565]

[0566]

[0567]

[0568]

[0569]

[0570]

[0571]

[0572]

[0573]

[0574]

[0575]

[0576]

[0577]

[0578]

[0579]

[0580]

[0581]

[0582]

[0583]

[0584]

[0585]

[0586]

Claims

1. A Cas12f polypeptide comprising an amino acid sequence having at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31 and 32).

2. A system, comprising: (1) a Cas12f polypeptide or a polynucleotide encoding the Cas12f polypeptide, the Cas12f polypeptide comprising an amino acid sequence having at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31 and 32); and (2) a guide nucleic acid or a polynucleotide encoding the guide nucleic acid, wherein the guide nucleic acid comprises: (i) a scaffold sequence capable of forming a complex with the Cas12f polypeptide; and (ii) a guide sequence capable of hybridizing to a target sequence of a target DNA, thereby directing the complex to the target DNA.

3. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide is not any one of SEQ ID NO: 1-34 (optionally any one of SEQ ID NO: 1, 2, 4, 5, 15, 28, 29, 31 and 32).

4. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide has a function (e.g., a modified function that is increased or decreased compared to) of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32) (e.g., the ability to form a complex with a guide nucleic acid, the guide nucleic acid being able to form a complex with any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32); and / or guide sequence-specific dsDNA cleavage activity).

5. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide has guide sequence-specific (on-target) dsDNA cleavage activity; Optionally, the Cas12f polypeptide substantially retains the guide sequence-specific (on-target) dsDNA cleavage activity of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31 and 32).

6. A Cas12f polypeptide or system as described in any preceding claim, wherein when both are used in combination with the same guide nucleic acid, with any one of SEQ ID NO: 1-34 (optionally SEQ ID NO: 1, 2, 4, 5, 15, 28, 29, 31 and 32), the Cas12f polypeptide has an increased guide sequence-specific (on-target) dsDNA cleavage activity, for example, an increase of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300% or more.

7. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises an amino acid substitution at position 46, 49, 50, 52, 53, 54, 56, 57, 62, 63, 66, 70, 71, 72, 119, 120, 127, 132, 136, 141, 144, 146, 147, 148, 150, 264, 292, 293, 311, 313, 314 and / or 315 of SEQ ID NO:

1.

8. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises positions 10, 11, 13, 14, 15, 17, 18, 19, 20, 27, 28, 31, 32, 40, 44, 47, 49, 51, 52, 55, 56, 59, 61, 63, 65, 68, 71, 84, 91, 94, 96, 99, 111, 112, 124, 125, 126, 127, 1 28, 129, 130, 131, 139, 140, 141, 146, 147, 150, 151, 156, 160, 163, 167, 170, 173, 178, 179, 180, 183, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 206, 215, 224, 225, 226, 227, 230, 235, 249, 254, 256, 257, 264, 265, 266, 269, 270, 272, 273, 276, 280, 283, 292, 295, 303, 309, 311, 313, 314, 316, 318, 319, 320, 32 1, 334, 337, 341, 344, 346, 349, 358, 363, 365, 366, 367, 368, 371, 372, 374, 375, 377, 380, 382, ​​393, 399, 403, 404, 406, 408, 409, 410, 411, 413 and / or 414 amino acid substitutions.

9. A Cas12f polypeptide or system as described in any preceding claim, wherein the amino acid substitution is a substitution with a positively charged amino acid residue (such as lysine (Lys / K), arginine (Arg / R), histidine (His / H), and optionally a substitution with arginine (Arg / R).

10. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises amino acid substitutions D52R and / or T132R relative to SEQ ID NO: 1; Optionally, wherein the Cas12f polypeptide comprises substitutions D52R and T132R relative to SEQ ID NO: 1; and / or Optionally, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 226, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO:

226.

11. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises amino acid substitutions A56R, Y125R, S130R, T131R, I264R, L270R and / or A273R relative to SEQ ID NO: 2; Optionally, wherein the Cas12f polypeptide comprises an amino acid substitution L270R relative to SEQ ID NO: 2; and / or Optionally, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 227, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO:

227.

12. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide substantially lacks guide sequence-independent (off-target) dsDNA cleavage activity; Optionally, wherein the Cas12f polypeptide substantially lacks the guide sequence-independent (off-target) dsDNA cleavage activity of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31 and 32); and / or Optionally, wherein the Cas12f polypeptide has reduced guide sequence-independent (off-target) dsDNA cleavage activity compared to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31 and 32) when both are used in combination with the same guide nucleic acid, for example, reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

13. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide is further engineered to substantially lack guide sequence-specific (on-target) dsDNA cleavage activity; Optionally, wherein the Cas12f polypeptide substantially lacks the guide sequence-specific (on-target) dsDNA cleavage activity of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31 and 32); and / or Optionally, wherein the Cas12f polypeptide has reduced guide sequence-specific (on-target) dsDNA cleavage activity compared to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32), for example, reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

14. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises an amino acid substitution at position 44, 79, 81, 82, 125, 131, 133, 138, 149, 151, 153, 228, 268, 270, 271, 274, 275, 277, 279, 282, 287, 291, 305, 308, 312 and / or 406 of SEQ ID NO:

1.

15. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises position 4, 7, 9, 23, 30, 33, 34, 35, 37, 38, 39, 41, 42, 46, 60, 62, 67, 69, 72, 75, 76, 77, 78, 80, 81, 82, 86, 90, 93, 97, 98, 101, 105, 107, 108, 114, 116, 121, 123, 135, 137, 143, 145, 148, 162, 165, 177, 185, 187, 189, 190, 207, 392, 395, 396, 397, 398, 399, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 450, 451, 452, 453, 454, 455, 456, 457, 458, 460, 461, 462, 463, 464, 471 16. A Cas12f polypeptide or system as described in any preceding claim, wherein the amino acid substitution is a substitution with (1) a positively charged amino acid residue (such as lysine (Lys / K), arginine (Arg / R), histidine (His / H), and optionally a substitution with arginine (Arg / R); or a substitution with (2) a non-polar amino acid residue (such as glycine (Gly / G), alanine (Ala / A), valine (Val / V), cysteine ​​(Cys / C), proline (Pro / P), leucine (Leu / L), isoleucine (Ile / I), methionine (Met / M), tryptophan (Trp / W), phenylalanine (Phe / F), and optionally a substitution with alanine (Ala / A).

17. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises amino acid substitutions D228A and / or T406A relative to SEQ ID NO: 1; Optionally, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 221 or 222, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 221 or 222.

18. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises amino acid substitutions D52R, T132R, D228A and T406A relative to SEQ ID NO: 1; Optionally, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 513, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO:

513.

19. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises amino acid substitutions D210A and / or D388A relative to SEQ ID NO: 2; Optionally, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 223 or 224, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 223 or 224.

20. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises amino acid substitutions D210A, L270R and D388A relative to SEQ ID NO: 2; Optionally, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 515, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO:

515.

21. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide is further engineered into a nickase.

22. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide further comprises a functional domain fused to the Cas12f polypeptide; Optionally, the functional domain is selected from a nuclear localization signal (NLS), a nuclear export signal (NES), a base editing domain such as a deaminase or a catalytic domain thereof, a base excision domain, a uracil glycosylase inhibitor (UGI) or a catalytic domain thereof, a uracil glycosylase (UNG) or a catalytic domain thereof, a methylpurine glycosylase (MPG) or a catalytic domain thereof, a methylase or a catalytic domain thereof, a demethylase or a catalytic domain thereof, a transcriptional activation domain (e.g., VP64 or VPR), a transcriptional repression domain (e.g., a KRAB portion or a SID portion), a reverse transcriptase or a catalytic domain thereof, an exonuclease (e.g., T5E) or a catalytic domain thereof coli dihydrofolate reductase (ecDHFR) destabilizing domain, histone residue modifying domain, nuclease catalytic domain (e.g., FokI), transcription modifier, light gating factor, chemical inducible factor, chromatin visualization factor, targeting polypeptide for providing binding to a cell surface moiety on a target cell or target cell type, reporter (e.g., fluorescent) polypeptide or detection label (e.g., GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP), localization signal, polypeptide targeting moiety, DNA binding domain (e.g., MBP, LexA DBD, Gal4 DBD), epitope tags (e.g., His, myc, V5, FLAG, HA, VSV-G, Trx, etc.), transcription release factors, HDACs, portions having ssRNA cleavage activity, portions having dsRNA cleavage activity, portions having ssDNA cleavage activity, portions having dsDNA cleavage activity, DNA or RNA ligases, functional domains exhibiting target DNA modification activity and catalytic domains thereof and functional fragments thereof (e.g., functional truncations), and any combination thereof, wherein the target DNA modification activity is selected from: methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkane alkylation activity, dealkylation activity, depurination activity, oxidation activity, deoxygenation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, glycosylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylation activity, deSUMOylation activity, ribosylation activity, deribosylation activity, myristoylation activity, demyristoylation activity, glycosylation activity (e.g., from O-GlcNAc transferase), deglycosylation activity; Optionally, wherein the NLS comprises or is a SV40 NLS (such as SEQ ID NO: 216; encoded by, for example, SEQ ID NO: 217), a bpSV40 NLS (BP NLS, bpNLS) or a NP NLS (Xenopus laevis nucleoplasmin NLS, nucleoplasmin NLS) (such as SEQ ID NO: 218; encoded by, for example, SEQ ID NO: 219); Optionally, wherein the deaminase or its catalytic domain is an adenine deaminase (e.g., TadA, such as TadA8e, TadA8.17, TadA8.20, TadA9) or its catalytic domain, e.g., TadA8e-V106W, TadA8e-W106V; Optionally, wherein the deaminase or its catalytic domain is a cytidine deaminase (e.g., APOBEC, such as APOBEC3, e.g., APOBEC3A, APOBEC3B, APOBEC3C; DddA) or its catalytic domain, e.g., hAPOBEC3-W104A; and / or Optionally, wherein the UGI is a human UGI domain.

23. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises amino acid substitutions D52R, T132R, D228A and T406A relative to SEQ ID NO: 1, and comprises a base editing domain, such as a deaminase or a catalytic domain thereof.

24. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises an amino acid sequence of any one of SEQ ID NOs: 260-265, or an amino acid sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to an amino acid sequence of any one of SEQ ID NOs: 260-265.

25. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide is used in combination with a guide nucleic acid, the guide nucleic acid comprising: (i) a scaffold sequence capable of forming a complex with the Cas12f polypeptide; and (ii) a guide sequence capable of hybridizing to a target sequence of a target DNA, thereby directing the complex to the target DNA.

26. A Cas12f polypeptide or system as described in any preceding claim, wherein the guide nucleic acid is a guide RNA (gRNA), such as a single guide RNA (sgRNA).

27. A Cas12f polypeptide or system as described in any preceding claim, wherein the scaffold sequence is 5' to the guide sequence.

28. The Cas12f polypeptide or system of any preceding claim, wherein the guide nucleic acid further comprises a polyU sequence having at least four consecutive U (uridines) 3' to the guide sequence; Optionally, wherein the polyU sequence further comprises an A (adenosine) downstream of the at least four consecutive Us; and / or Optionally, the sequence encoding the polyU sequence comprises a sequence that has at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity to the sequence of SEQ ID NO: 220; or a sequence that has at most 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide differences, whether contiguous or not, compared to the sequence of SEQ ID NO:

220.

29. A Cas12f polypeptide or system as described in any preceding claim, wherein the scaffold sequence has a secondary structure substantially identical to the secondary structure of any one of SEQ ID NOs: 73-106 (optionally any one of SEQ ID NOs: 73, 74, 76, 77, 87, 100, 101, 103 and 104).

30. A Cas12f polypeptide or system as described in any preceding claim, wherein the scaffold sequence comprises a polynucleotide sequence having at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to any one of SEQ ID NOs: 73-106 (optionally any one of SEQ ID NOs: 73, 74, 76, 77, 87, 100, 101, 103 and 104).

31. A Cas12f polypeptide or system as described in any preceding claim, wherein when both are used in combination with the same Cas12f polypeptide (e.g., the Cas12f polypeptide described in any preceding claim) in an otherwise identical guide nucleic acid, with any one of SEQ ID NOs: 73-106 (optionally SEQ ID In some embodiments, the scaffold sequence results in increased guide sequence-specific (on-target) dsDNA cleavage activity, such as at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300% or more, compared to any one of NOS:73, 74, 76, 77, 87, 100, 101, 103 and 104).

32. A Cas12f polypeptide or system as described in any preceding claim, wherein the scaffold sequence comprises a base pair substitution of a thermodynamically unstable base pair (e.g., an AU base pair or a mismatched base pair) with a GC base pair.

33. A Cas12f polypeptide or system as described in any preceding claim, wherein the scaffold sequence comprises a base pair substitution of a thermodynamically unstable base pair (e.g., an AU base pair or a mismatched base pair) with a GC base pair relative to SEQ ID NO: 73, and comprises a polynucleotide sequence of any one of SEQ ID NOs: 234-236, 239-242, 244-247 and 250-251, or a polynucleotide sequence with SEQ ID NOs: NO:234-236, 239-242, 244-247 and 250-251 have a polynucleotide sequence with at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity; optionally, wherein the scaffold sequence comprises the polynucleotide sequence of SEQ ID NO:

244.

34. A Cas12f polypeptide or system as described in any preceding claim, wherein the scaffold sequence comprises a base pair substitution of a thermodynamically unstable base pair (e.g., an AU base pair or a mismatched base pair) with a GC base pair relative to SEQ ID NO: 74, and comprises the polynucleotide sequence of SEQ ID NO: 257, or a polynucleotide sequence having at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to the polynucleotide sequence of SEQ ID NO:

257.

35. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 1 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 226), and wherein the scaffold sequence comprises SEQ ID NO: 73 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 244).

36. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 2 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 227), and wherein the scaffold sequence comprises SEQ ID NO: 74 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 257).

37. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 3 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 75 or a mutant thereof as defined in any preceding claim.

38. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 4 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 76 or a mutant thereof as defined in any preceding claim.

39. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 5 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 77 or a mutant thereof as defined in any preceding claim.

40. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 6 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 78 or a mutant thereof as defined in any preceding claim.

41. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 7 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 79 or a mutant thereof as defined in any preceding claim.

42. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 8 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 80 or a mutant thereof as defined in any preceding claim.

43. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 9 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 81 or a mutant thereof as defined in any preceding claim.

44. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 10 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 82 or a mutant thereof as defined in any preceding claim.

45. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 11 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 83 or a mutant thereof as defined in any preceding claim.

46. ​​The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 12 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 84 or a mutant thereof as defined in any preceding claim.

47. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 13 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 85 or a mutant thereof as defined in any preceding claim.

48. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 14 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 86 or a mutant thereof as defined in any preceding claim.

49. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 15 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 87 or a mutant thereof as defined in any preceding claim.

50. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 16 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 88 or a mutant thereof as defined in any preceding claim.

51. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 17 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 89 or a mutant thereof as defined in any preceding claim.

52. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 18 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 90 or a mutant thereof as defined in any preceding claim.

53. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 19 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 91 or a mutant thereof as defined in any preceding claim.

54. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 20 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 92 or a mutant thereof as defined in any preceding claim.

55. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 21 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 93 or a mutant thereof as defined in any preceding claim.

56. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 22 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 94 or a mutant thereof as defined in any preceding claim.

57. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 23 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 95 or a mutant thereof as defined in any preceding claim.

58. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 24 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 96 or a mutant thereof as defined in any preceding claim.

59. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 25 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 97 or a mutant thereof as defined in any preceding claim.

60. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 26 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 98 or a mutant thereof as defined in any preceding claim.

61. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 27 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 99 or a mutant thereof as defined in any preceding claim.

62. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 28 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 100 or a mutant thereof as defined in any preceding claim.

63. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 29 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 101 or a mutant thereof as defined in any preceding claim.

64. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 30 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 102 or a mutant thereof as defined in any preceding claim.

65. The Cas12f polypeptide or system of any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 31 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 103 or a mutant thereof as defined in any preceding claim.

66. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 32 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 104 or a mutant thereof as defined in any preceding claim.

67. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 33 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 105 or a mutant thereof as defined in any preceding claim.

68. A Cas12f polypeptide or system as described in any preceding claim, wherein the Cas12f polypeptide comprises SEQ ID NO: 34 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 106 or a mutant thereof as defined in any preceding claim.

69. A Cas12f polypeptide or system as described in any preceding claim, wherein the target sequence comprises about or at least about 16 consecutive nucleotides of the target DNA, such as about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 6, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more consecutive nucleotides, or in a numerical range between any two of the aforementioned values, such as about 16 to about 50 or about 17 to about 22 consecutive nucleotides of the target DNA; optionally, wherein the target sequence comprises about 20 consecutive nucleotides of the target DNA.

70. A Cas12f polypeptide or system as described in any preceding claim, wherein the reverse complement of the target sequence is immediately 3' of the protospacer adjacent motif (PAM); optionally, wherein the PAM is 5'-TTN or 5'-CCN, wherein N is A, T, G or C.

71. The Cas12f polypeptide or system of any preceding claim, wherein the guide sequence is about or at least about 16 nucleotides in length, such as about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more nucleotides, or a range of lengths between any two of the aforementioned values, for example, a length of about 16 to about 50 nucleotides or about 17 to about 22 nucleotides; optionally, wherein the spacer sequence has a length of about 20 nucleotides.

72. A Cas12f polypeptide or system as described in any preceding claim, wherein (1) the guide sequence is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% (completely) reverse complementary to the target sequence, optionally about 100% (completely) reverse complementary; (2) the guide sequence contains no more than 5, 4, 3, 2 or 1 mismatches with the target sequence or no mismatches; or (3) the guide sequence is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10% (completely) reverse complementary to the target sequence; 64, 65, 66, 67, 68, 69, or 70 nucleotides thereof.

73. A Cas12f polypeptide or system as described in any preceding claim, wherein the system comprises two or more guide nucleic acids, the two or more guide nucleic acids comprising two or more guide sequences capable of hybridizing to two or more target sequences of the same target DNA or different target DNAs, wherein the two or more guide sequences are the same or different, and wherein the two or more target sequences are the same or different.

74. A Cas12f polypeptide or system as described in any preceding claim, wherein the target DNA is dsDNA, such as eukaryotic dsDNA, e.g., a gene in a eukaryotic cell.

75. A polynucleotide encoding a Cas12f polypeptide according to any preceding claim, such as any one of SEQ ID NOs: 39-72.

76. A delivery system comprising (1) a Cas12f polypeptide of any preceding claim, a polynucleotide of any preceding claim, or a system of any preceding claim; and (2) a delivery vehicle.

77. A vector comprising the polynucleotide of any preceding claim; optionally, wherein the vector encodes a guide nucleic acid as defined in any preceding claim; optionally, wherein the vector is a plasmid vector, a recombinant AAV (rAAV) vector (vector genome) or a recombinant lentiviral vector.

78. A recombinant AAV particle comprising the rAAV vector genome of any preceding claim.

79. A ribonucleoprotein (RNP) comprising a Cas12f polypeptide as described in any preceding claim and optionally a guide nucleic acid as defined in any preceding claim.

80. A lipid nanoparticle (LNP) comprising an RNA (eg, mRNA) encoding the Cas12f polypeptide of any preceding claim and optionally a guide nucleic acid as defined in any preceding claim.

81. A method for modifying a target DNA, the method comprising contacting the target DNA with the system of any preceding claim, the vector of any preceding claim, the ribonucleoprotein of any preceding claim, or the lipid nanoparticle of any preceding claim, wherein the spacer sequence is capable of hybridizing with a target sequence of the target DNA, wherein the target DNA is modified by the complex.

82. The method of any preceding claim, wherein the target DNA is intracellular; Optionally, wherein the cell is a eukaryotic cell (e.g., an animal cell, a vertebrate cell, a mammalian cell, a non-human mammalian cell, a non-human primate cell, a rodent (e.g., a mouse or rat) cell, a human cell, a plant cell, or a yeast cell) or a prokaryotic cell (e.g., a bacterial cell); Optionally, wherein the cell is from a plant or an animal; Optionally, wherein the plant is a dicot; optionally selected from soybean, cabbage (e.g., Brassica rapa), rapeseed, Brassica, watermelon, melon, potato, tomato, tobacco, eggplant, pepper, cucumber, cotton, alfalfa, eggplant, grape; Optionally, wherein the plant is a monocot; optionally selected from rice, corn, wheat, barley, oats, sorghum, millet, grass, Poaceae, Zizania, Avena, Coix, Hordeum, Oryza, Panicum (e.g., broomcorn millet), Secale, Setaria (e.g., foxtail millet), Sorghum, Triticum, Zea, Cymbopogon, Saccharum (e.g., sugarcane), Phyllostachys, Phyllostachys, Bambusa, and Phyllostachys; and / or Optionally, the animal is selected from pigs, cows, sheep, goats, mice, rats, alpacas, monkeys, rabbits, chickens, ducks, geese, fish (eg, zebrafish).

83. The method of any preceding claim, wherein the modification comprises one or more of cleavage, base editing, repair, and insertion or integration of an exogenous sequence of the target DNA.

84. A cell modified by the method of any preceding claim.

85. A pharmaceutical composition comprising (1) the system of any preceding claim, the vector of any preceding claim, the ribonucleoprotein of any preceding claim, the lipid nanoparticle of any preceding claim, or the cell of any preceding claim; and (2) a pharmaceutically acceptable excipient.

86. A method for diagnosing, preventing or treating a disease in a subject in need thereof, the method comprising administering to the subject the system of any preceding claim, the vector of any preceding claim, the ribonucleoprotein of any preceding claim, the lipid nanoparticle of any preceding claim, the cell of any preceding claim, or the pharmaceutical composition of any preceding claim, wherein the disease is associated with a target DNA, wherein the spacer sequence is capable of hybridizing to a target sequence of the target DNA, wherein the target DNA is modified by the complex, and wherein modification of the target DNA diagnoses, prevents or treats the disease.

87. The method of any preceding claim, wherein the disease is selected from Angelman syndrome (AS), Alzheimer's disease (AD), transthyretin amyloidosis (ATTR), transthyretin amyloid cardiomyopathy (ATTR-CM), cystic fibrosis (CF), hereditary angioedema, diabetes, Duchenne muscular dystrophy, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), spinal muscular atrophy (SMA), alpha-1-antitrypsin deficiency, Pompe disease, myotonic dystrophy, Huntington's disease (HTT), fragile X syndrome, Friedreich's Ataxia, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, inherited chronic kidney disease, hyperlipidemia, Leber congenital amaurosis (LCA), sickle cell disease, thalassemia (e.g., beta thalassemia), Parkinson's disease (PD), myelodysplastic syndrome (MDS), retinitis pigmentosa (RP), age-related macular degeneration (AMD), hepatitis B, non-alcoholic fatty liver disease (NAFLD), acquired immunodeficiency syndrome, corneal dystrophy (CD), hypercholesterolemia, familial hypercholesterolemia (FH), heart disease (e.g., hypertrophic cardiomyopathy (HCM)), and cancer.

88. A method for detecting a target DNA, the method comprising contacting the target DNA with the system of any preceding claim, wherein the target DNA is modified by the complex, and wherein the modification detects the target DNA; optionally, wherein the modification generates a detectable signal, such as a fluorescent signal.

Images