X201415 for use in the preparation of a medicament for treating nonalcoholic steatohepatitis
By developing the biaryl-substituted 1,8-naphthyl-4(1H)-ketone compound X201415 as a GPR75 protein antagonist, the problem of the lack of effective treatment for NASH was solved, and significant improvement in liver inflammation and fibrosis was achieved in a mouse model of NASH, providing a new therapeutic approach.
Patent Information
- Application Number
- CN202411565873.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-05
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2044-11-05
AI Technical Summary
Current technologies lack effective drug treatments for non-alcoholic steatohepatitis (NASH), relying heavily on lifestyle modifications, and the application of GPR75 protein in the treatment of NAFLD and NASH has not been reported.
We developed a biaryl-substituted 1,8-naphthyl-4(1H)-ketone compound, X201415, as an antagonist of GPR75 protein. By binding to GPR75 protein, it inhibited related signaling pathways, intervened in a CDAHFD-induced NASH mouse model, reduced body weight and liver index, improved liver fat accumulation and inflammation, and inhibited the expression of related genes.
X201415 significantly improved liver inflammation and fibrosis in NASH mice, reduced liver TC and TG levels, downregulated pro-inflammatory mediator expression, and inhibited lipid metabolism and fibrosis-related genes, providing a new therapeutic approach for NASH.
Smart Images

Figure CN119424426B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of medicine, and relates to application of X201415 acting on GPR75 protein in preparation of a medicine for treating non-alcoholic steatohepatitis. BACKGROUND
[0002] Non-alcoholic steatohepatitis (NASH) is a liver fat accumulation disease unrelated to alcohol consumption, accompanied by necrotic inflammation and hepatocyte damage, and if not intervened, it can develop into liver fibrosis, cirrhosis or liver cancer. Previous epidemiology shows that the global incidence of non-alcoholic fatty liver disease (NAFLD) is about 25%, of which about 30% is NASH, and it has become the main cause of chronic liver disease. The pathogenesis of NASH is not clear, and it may be related to oxidative stress, inflammatory response, mitochondrial damage, and intestinal flora disorder. For a long time, NASH patients lack effective drug treatment and mainly rely on lifestyle changes. Resmetirom, as a thyroid hormone receptor-β (THR-β) agonist, was approved by FDA in March 2024 for the treatment of NASH, filling the gap in this field and opening a new chapter of treatment.
[0003] G protein-coupled receptors (GPRs) are cell surface receptors that activate guanine-nucleotide binding proteins, widely distributed in organisms and involved in most signal transduction, becoming about 40% of modern drug targets. GPR75 is a member of the GPRs family, activated by CCL5 / RANTES and 20-HETE, and initiates downstream signaling pathways such as PI3, Akt and MAPK. Many data show that GPR75 gene is involved in regulating obesity in mice, and recent studies have found that it is related to appetite-regulating neurons, and its absence can prevent obesity and NAFLD progression induced by high-fat diet in mice (DOI: 10.1002 / oby.23692). In addition, patent CN118141920A discloses that a GRP75 inhibitor can be used to prevent the occurrence and development of esophageal squamous cell carcinoma cachexia. Therefore, GPR75 is a promising target for treating metabolic diseases, neurological diseases, cancer and other diseases, and is a hot spot for drug development.
[0004] X201415 is a 1,8-naphthyridine-4(1H)-one compound substituted with a biaryl group. Currently, the same series of compounds of the compound have researches related to chronic obstructive pulmonary disease and asthma (DOI: 10.1016 / j.bmcl.2008.09.009), and currently there is no report on X201415 treating NASH. SUMMARY
[0005] OBJECTIVE
[0006] This invention provides a new use for X201415.
[0007] Technical solution
[0008] The use of a biaryl-substituted 1,8-naphthyl-4(1H)-ketone compound X201415 and its pharmaceutically acceptable salt or prodrug in the preparation of an antagonist for GPR75 protein, characterized in that the structural formula of X201415 is as follows:
[0009]
[0010] The application of the biaryl-substituted 1,8-naphthyl-4(1H)-ketone compound X201415 and its pharmaceutically acceptable salts or prodrugs in the preparation of drugs for treating non-alcoholic steatohepatitis (NAH) acting on GPR75 protein.
[0011] The application is characterized in that X201415 is prepared by the following steps: using 2-chloronicotinyl chloride X201415-a as a raw material, esterification, hydrolysis, nucleophilic substitution, and coupling reaction are performed to obtain compound X201415, and the preparation route is as follows:
[0012]
[0013] The application is characterized in that X201415 is a complex formed by X201415 and a pharmaceutically acceptable carrier or excipient.
[0014] This application uses molecular docking technology to predict that X201415 can directly bind to the GPR75 protein. The applicant synthesized X201415 powder, prepared an X201415 suspension containing 0.5% CMC-Na, and used it to intervene in NASH mice induced by a CDAHFD diet and evaluated the effect. Simultaneously, cell experiments verified that its lipid-lowering effect in hepatocytes is dependent on the GPR75 protein.
[0015] As a preferred option, the aforementioned drugs can effectively reduce mouse body weight and liver index.
[0016] Preferably, the above-mentioned drugs can significantly improve the volume of liver and epididymal fat and reduce the content of TC and TG in the liver.
[0017] Preferably, the above-mentioned drugs can effectively downregulate the mRNA expression levels of downstream pro-inflammatory mediators TNF-α, IL-1β and IL-6 in the NF-κB pathway.
[0018] Preferably, the above-mentioned drugs can effectively inhibit the expression levels of lipid metabolism and liver fibrosis-related gene mRNAs.
[0019] Preferably, the above-mentioned drug can reduce lipid accumulation in HepG2 cells stimulated by 200 μM PA (palmitic acid) in a dose-dependent manner.
[0020] Preferably, the above-mentioned drug reduces the TG level in PA-stimulated HepG2 cells through the GPR75 protein.
[0021] Preferably, the aforementioned drug or health product includes compound X201415, as well as pharmaceutically acceptable carriers, additives or excipients, and unavoidable impurities.
[0022] This application provides a GPR75 protein inhibitory drug or health product, which includes compound X201415.
[0023] In experiments, high-fat diets are often used to model animal disease, such as the choline-deficient methionine-rich high-fat diet (CDAHFD). This involves using amino acids to replace protein in a high-fat model diet. Choline deficiency can exacerbate liver fat accumulation, while supplementing with some methionine can prevent weight loss. The CDAHFD diet formula simulates the pathophysiological conditions of human NAFLD, especially in the NASH mouse model; therefore, this application uses this method for modeling.
[0024] Beneficial effects:
[0025] This application discloses the application of X201415, a biaryl-substituted 1,8-naphthyl-4(1H)-ketone compound obtained through virtual docking, targeting the GPR75 protein in the treatment of NASH. This application is the first to propose and validate a novel binding target and indication for X201415. X201415 effectively inhibits NASH progression by targeting and binding to the GPR75 protein; no previous reports have described X201415.
[0026] Specifically, based on a small molecule database, we used molecular docking virtual screening to discover a compound (named X201415 in this application) with the IUPAC name N-cyclopropyl-1-(3-(6-(2-hydroxypropyl-2-yl)pyridin-3-yl)phenyl)-4-one-1,4-dihydro-1,8-naphthidine-3-carboxamide (CAS: 477252-30-5, chemical formula: C 26 H 24 N4O3 can form key hydrogen bonds and pi-pi interactions with the GPR75 protein, exhibiting stable binding ability.
[0027] This application proposes for the first time that X201415 binds to a novel target, the GPR75 protein, and provides a synthetic route for X201415. X201415 can effectively improve liver inflammation, fibrosis, and lipid accumulation levels induced by CDAHFD in NASH mice. Its lipid-reducing effect in HepG2 cells was verified to be achieved by inhibiting the GPR75 protein, suggesting its potential development as a novel anti-NASH drug. Attached Figure Description
[0028] For ease of explanation, this application is described in detail below with reference to specific embodiments and accompanying drawings.
[0029] Figure 1 BODIPY staining images of lipid content (A) and TG content (B) in HepG2 cells stimulated by PA and treated with compound X201415.
[0030] Figure 2 The images show the following: (A) morphology of the liver of each group of mice; (B) epididymal fat of mice; (C) statistics of mouse body weight and liver index; and (D) statistical results of TC and TG content in the liver of mice.
[0031] Figure 3 Images of liver H&E, OilRedO, and MASSON staining in mice from each group.
[0032] Figure 4 The expression levels of liver lipid metabolism-related gene mRNAs in each group of mice are shown.
[0033] Figure 5 The expression levels of liver inflammation-related gene mRNAs in each group of mice are shown.
[0034] Figure 6 The expression levels of liver fibrosis-related gene mRNAs in each group of mice are shown.
[0035] Figure 7 The images show the virtual docking of compound X201415 with the GPR75 protein in 2D (A) and 3D (B) diagrams. Detailed Implementation
[0036] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions and specific operation processes of the embodiments of this application are now described in detail with reference to the accompanying drawings. However, the content of this application is not limited to the following examples. Reagents or instruments used without a specified manufacturer are considered to be conventional products available on the market.
[0037] All data in this application are expressed as mean ± standard error of the mean (SEM). One-way ANOVA was used, followed by Tukey post-hoc tests for multiple group comparisons. Statistical analysis and bar charts were performed using GraphPad Prism 10.1.1 (GraphPad, LaJolla, California) (*p<0.05, ***p<0.001). Differences with p-values <0.05 were considered statistically significant.
[0038] Example 1: Synthesis of compound X201415
[0039] 1. Synthesis of intermediate X201415-b
[0040]
[0041] Under nitrogen protection, potassium monoethyl malonate (171 mmol, 3 eq), magnesium chloride (171 mmol, 3 eq), and THF (150 mL) were placed in a 500 mL three-necked flask and stirred. Then, triethylamine (342 mmol, 6 eq) was added dropwise to the reaction solution at -10 °C. After 30 minutes, the reaction solution was stirred at room temperature for 1 hour. A THF solution of 2-chloronicotinyl chloride (X201415-a) (57 mmol, 1 eq) was added dropwise to the reaction solution at -10 °C. The reaction solution was allowed to react at room temperature for 30 minutes, then heated to 60 °C and reacted overnight. The reaction was stopped. 100 mL of water and 100 mL of ethyl acetate were added to the reaction solution and stirred. The pH was adjusted to 2 with 2N HCl. The layers were separated, and the aqueous layer was extracted again with 100 mL of ethyl acetate. The combined organic layers were washed successively with water, saturated sodium chloride, and the organic layer was desolventized, prepared into a slurry, and subjected to column chromatography. 8g of intermediate X201415-b was obtained.
[0042] 2. Synthesis of intermediate X201415-c
[0043]
[0044] X201415-b (33.1 mmol, 1 eq), DMFDMA (99.3 mmol, 3 eq), and toluene (70 mL) were placed in a 250 mL three-necked flask and protected with nitrogen. The reaction was then carried out in an oil bath at 100 °C for 3 hours. Once the starting material disappeared, the reaction was stopped, and the solution was directly dissolved to dryness. Then, 3-iodoaniline (39.73 mmol, 1.2 eq), dioxane (100 mL), and potassium carbonate (66.2 mmol, 2 eq) were added to the concentrated residue, and the mixture was purged with nitrogen three times. The reaction solution was placed at 100 °C for 4 hours. After the reaction was complete, the solution was dissolved to dryness. 100 mL of water and 100 mL of dichloromethane were added to the concentrated residue, the mixture was stirred, and the layers were separated. The aqueous phase was extracted once more with 100 mL of dichloromethane. The combined organic phases were washed successively with saturated sodium chloride and dried over anhydrous sodium sulfate. The organic phase was desolventized to dryness, and then 30 mL of methanol was added to the concentrated residue to slurry, followed by filtration. The filter cake was dried to obtain 7.4 g of white solid X201415-c.
[0045] 3. Synthesis of intermediate X201415-d
[0046]
[0047] X201415-c (10 mmol, 1 eq), MeOH (20 mL), and 2NNaOH (20 mL) were added to a 100 mL single-necked flask and stirred for 2 hours. After the reaction was complete, the pH of the reaction solution was adjusted to 7 with 2M HCl, and then dissolved to dryness. 20 mL of water was added to the reaction solution and stirred. The pH was then adjusted to 3 with 2M HCl, and a large amount of solid precipitated. The mixture was filtered and the filter cake was dried. The filter cake, HATU (15 mmol, 1.5 eq), DMF (20 mL), and DIPEA (20 mmol, 2 eq) were then placed in a 100 mL single-necked flask and stirred. Cyclopropylamine (12 mmol, 1.2 eq) was added dropwise to the reaction solution and stirred for 1 hour. After the reaction was complete, 60 mL of water was added to the reaction solution and stirred, and a large amount of solid precipitated. The mixture was filtered, and the filter cake was washed with 100 mL of water. The filter cake was then dried to obtain 3.6g of intermediate X201415-d.
[0048] 4. Synthesis of intermediate X201415-e
[0049]
[0050] X201415-d (5.8 mmol, 1 eq), B2Pin2 (8.7 mmol, 1.5 eq), Pd(dppf)Cl2 (0.58 mmol, 0.1 eq), KOAc (11.6 mmol, 2 eq), and DMF (40 mL) were placed in a 100 mL single-necked flask under nitrogen protection. The reaction mixture was stirred in an oil bath at 100 °C for 5 hours. After the reaction was complete, the mixture was filtered through diatomaceous earth, and the filter cake was washed with 5 mL of DMF. The resulting filtrate, X201415-e, was used directly for the next reaction without further treatment.
[0051] 4. Synthesis of compound X201415
[0052]
[0053] 2-(5-bromopyridin-2-yl)prop-2-ol (8.7 mmol, 1.5 eq), Pd(dppf)Cl2 (0.58 mmol, 0.1 eq), and potassium carbonate (11.6 mmol, 2 eq) were added to a DMF solution of X201415-e under nitrogen protection. The reaction mixture was stirred in an oil bath at 100 °C for 5 hours. After the reaction was complete, 100 mL of water and 100 mL of ethyl acetate were added to the reaction mixture, and the mixture was stirred and separated. The aqueous phase was extracted once again with 100 mL of ethyl acetate. The combined organic phases were washed successively with saturated sodium chloride and dried over anhydrous sodium sulfate. The organic phase was desolventized to dryness, prepared into a slurry, and subjected to column chromatography. 3.6 g of crude X201415 was obtained. 2 g of the target product was purified by column chromatography, and its characteristic results are as follows:
[0054] 1 HNMR(400MHz,DMSO-d6)δ9.73(d,J=4.4Hz,1H),8.87(d,J=2.4Hz,1H),8.84(s,1H),8.79(dd ,J=4.5,1.9Hz,1H),8.73(dd,J=8.0,1.9Hz,1H),8.13(dd,J=8.3,2.4Hz,1H),8.03(t,J=1.9H z,1H),7.95(dt,J=7.9,1.4Hz,1H),7.78–7.69(m,2H),7.69–7.61(m,2H),5.28(s,1H),2.90( td,J=7.3,3.7Hz,1H),1.47(s,6H),0.78(dd,J=7.0,2.2Hz,2H),0.57(dd,J=4.2,2.2Hz,2H).
[0055] MS(ESI)+: 441.2.
[0056] Example 2: HepG2 cell experiment
[0057] 1. Cells and main reagents
[0058] Human hepatocellular carcinoma cell line (HepG2) was purchased from Pronoss; dimethyl sulfoxide (DMSO) was purchased from Solarbio; bovine serum albumin (BSA) and puromycin were purchased from Beyotime; palmitic acid (PA) was purchased from Merck; high glucose medium (DMEM) and fetal bovine serum were purchased from Gibco; shGPR75 lentivirus and co-infection reagents A and B were purchased from Primi Technologies; BODIPY dye was purchased from Thermo Fisher Scientific; and triglyceride (TG) assay kit was purchased from Primi.
[0059] The lentivirus contains the following interfering sequences:
[0060] The nucleotide sequence of the scramble (control group, where shGPR75 is not knocked down) is as follows:
[0061] CCTAAGGTTAAGTCGCCCTCGgctcgaggCGAGGGCGACTTAACCTTAGGC;
[0062] The nucleotide sequence of shGPR75 (experimental group, shGPR75 knocked down by interference sequence) is as follows:
[0063] GAACCTGTCCTTCTGTGACCTTTCAAGAGAAGGTCACAGAAGGACAGGTTC.
[0064] 2. Experimental Methods
[0065] 2.1 Establishment of a lentivirally infected HepG2 cell line
[0066] One day prior to infection, HepG2 cell lines were seeded in 6-well plates. When the cell density reached 40-50%, the culture medium was aspirated, and the lentivirus was diluted to 10 MOI with 2 ml of fresh culture medium. Helper infection reagents A and B were added, and the infection efficiency was observed under an inverted fluorescence microscope 48-72 hours post-infection. Seventy-two hours post-infection, selection was performed using puromycin at a final concentration of 1 μg / mL, with a selection period of 7 days. After puromycin selection, stable HepG2 cell lines were maintained using puromycin at a final concentration of 0.5 μg / mL, and the cell lines were cryopreserved for later thawing.
[0067] 2.2 Establishment of cellular NASH model and drug administration
[0068] Resuscitate lentivir-infected HepG2 cell lines, collect cells in the logarithmic growth phase, and prepare single-cell suspensions in serum-containing DMEM medium. Incubate at 4 × 10⁻⁶ cells / cell. 5Cells were seeded per well in 12-well plates, with 3 replicates per group. After shaking, the cells were incubated at 37°C and 5% CO2 until the cell density reached 70%-80%. The original culture medium was discarded. The control group was treated with blank solvent (10% BSA solution), the model group was treated with 200 μM PA solution, and the drug treatment groups were treated with 200 μM PA solution, followed by 5 μM, 10 μM, and 100 μM X201415, respectively. Serum-free DMEM medium containing 0.1% DMSO was used. Samples were collected 24 hours after drug administration.
[0069] 2.3 Cell BODIPY staining
[0070] Discard the culture medium and wash twice with PBS. Add 100 μL of 4% paraformaldehyde fixative and incubate at room temperature for 30 minutes. After fixing the cells, discard the fixative and wash three times with PBS. Add 100 μL of LODIPY working solution (1:1000 dilution) to each well and incubate in the dark for 25 minutes. Discard the working solution and wash three times with PBS. Finally, add 200 μL of PBS to each well and observe and record lipid droplet accumulation using a live-cell imaging system (GFP channel).
[0071] 2.4 Detection of TG content in cells
[0072] Discard the culture medium, wash twice with PBS, collect the cells, add lysis buffer and mix well, then incubate at room temperature for 10 minutes. Take an appropriate amount of supernatant, heat at 70°C for 10 minutes, and centrifuge at 2000 rpm for 5 minutes. Add 10 μL of supernatant to a 96-well plate, add 190 μL of working solution, and incubate at 37°C for 15 minutes. Measure the OD value at 550 nm. Calculate the TG content of each sample according to the standard curve, and correct for protein content to obtain the final TG content.
[0073] 3. Experimental Results
[0074] PA is a substance that causes lipid accumulation in cells, such as Figure 1 As shown in Figure A, after PA treatment, BODIPY staining of scramble HepG2 cells showed significantly enhanced green fluorescence, indicating increased lipid content. After X201415 intervention (5 μM, 10 μM, and 100 μM), cellular lipid content decreased in a dose-dependent manner, with 100 μM showing the most significant effect. Furthermore, Figure 1 B (left) shows that when GPR75 protein is present, PA-induced TG content in HepG2 cells decreases, and there are significant differences among the groups treated with X201415. Figure 1 B (right) shows that when GPR75 protein was knocked down, there was no significant change after X201415 administration, suggesting that the inhibitory effect of X201415 on PA-induced lipid accumulation in HepG2 cells is exerted through the GPR75 protein.
[0075] Example 3: Animal Experiment
[0076] 1. Materials and Methods
[0077] 1.1 Laboratory Animals
[0078] Six- to seven-week-old male C57BL / 6J mice (SPF grade) weighing 21-23g were purchased from Vital River Laboratory Animal Technology Co., Ltd. They were housed in standard cages with constant temperature (22±1℃) and constant humidity (55±5%), with 12 hours of alternating light and dark, and free access to water and food. Experiments were conducted after one week of acclimatization.
[0079] 1.2 Medicines and Reagents
[0080] 1) CDAHFD feed: purchased from Nantong Trofi Feed Technology Co., Ltd., product number TP36225MCD.
[0081] 2) 0.5% CMC-Na solution: Weigh 2.5g of sodium carboxymethyl cellulose, slowly add it to 500mL of ultrapure water, and let it stand until completely dissolved before use.
[0082] 3) Prepare a 20 mg / kg suspension of X201415: Weigh 20 mg of X201415 powder, grind it, and add 10 mL of 0.5% CMC-Na solution to prepare a 2 mg / mL suspension; for efficacy testing in NASH model mice, administer 0.2 mL / 20 g body weight by gavage, with a dose of 20 mg / kg.
[0083] 4) Main reagents: Triglyceride (TG) and total cholesterol (TC) kits were purchased from Nanjing Jiancheng Biotechnology Institute.
[0084] 2. Experimental Methods
[0085] 2.1 Establishment of NASH mouse model and administration of X201415
[0086] C57BL / 6J mice acclimatized for one week were randomly divided into a CMC-Na group and a drug-treated group, both fed a CDAHFD diet. The CMC-Na group was given 0.5% CMC-Na solution, while the drug-treated group was given 20 mg / kg of X201415 suspension, administered by gavage once daily. A NASH model was established after two weeks of feeding, followed by two weeks of gavage. After the experiment, the mice were fasted and deprived of water for 12 hours, anesthetized with 1% sodium pentobarbital, and weighed. Blood was collected from the orbital cavity, and the mice were euthanized. The livers were harvested and weighed. Some liver tissue was fixed in 4% paraformaldehyde to prepare paraffin sections, some was embedded in OCT to prepare frozen sections, and the remainder was stored at -80°C for later use.
[0087] 2.2 Observation of tissue morphology
[0088] Liver samples fixed with 4% paraformaldehyde and embedded by OCT were sent to the Pathology and PDX Center of China Pharmaceutical University, where pathologists performed H&E, MASSON and Oil Red O staining, and recorded each slide using the Zeiss MDS digital scanning system.
[0089] 2.3 Detection of liver triglyceride (TG) and total cholesterol (TC) levels
[0090] Weigh approximately 20 mg of mouse liver and perform the assay according to the instructions of the triglyceride (TG) and total cholesterol (TC) assay kit. Measure the absorbance and calculate the TG and TC content in the liver based on the protein concentration correction.
[0091] 2.4 qRT-PCR detection of expression levels of metabolism, inflammation, and fibrosis-related genes
[0092] Weigh 15 mg of mouse liver, cut it into small pieces, and add 3 zirconium beads and 1 mL of RNAiso Plus lysis buffer. Homogenize and let stand at room temperature for 5 min. Add 200 μL of chloroform, shake vigorously for 15-30 seconds, let stand for 5 min, and then centrifuge at 12000 g for 15 min at 4 °C. Collect the top 350 μL of aqueous phase. Add an equal volume of isopropanol, mix well to precipitate RNA, let stand for 10 min, and centrifuge at 12000 g for 10 min at 4 °C. Discard the supernatant, add 1 mL of 75% ethanol (anhydrous ethanol: DEPC water = 3:1) to wash the precipitate, and centrifuge at 12000 g for 5 min at 4 °C. Dry the RNA precipitate and dissolve it in DEPC water.
[0093] Dilute 2 μL of RNA 100-fold with 198 μL of DEPC water and read the absorbance at 230 nm, 260 nm, 280 nm, and 320 nm (OD230, OD260, OD280, OD320). RNA purity is defined as OD260 / 280, with values between 1.8 and 2.1 indicating high purity. RNA concentration (μg / μL) is calculated as (OD260-OD320)×0.04×100. Based on the concentration results, dilute the RNA to 0.5 μg / μL with DEPC water and perform reverse transcription at a ratio of RNA:RT reagent:DEPC water = 1:2:7: at 37℃ for 15 minutes, 85℃ for 5 seconds, then cool to 4℃. Store the generated cDNA at -20℃.
[0094] The mRNA content in liver tissue was detected by qRT-PCR using the following mixture: Sybr (7.5 μL), DEPC water (4.5 μL), forward primer (10 μM, 1 μL), reverse primer (10 μM, 1 μL), and cDNA (1 μL).
[0095] 3. Experimental Results
[0096] The results are attached. Figures 2 to 6Compared to the CMC-Na group, Figure 2 A showed that after administration of X201415, the liver morphology of mice was significantly improved, with reduced volume, smooth surface, reddish color, and soft texture; Figure 2 B shows a decrease in epididymal fat volume; Figure 2 C indicates a decrease in body weight and liver index. Liver TC and TG are indicators for assessing an individual's lipid metabolism status. Figure 2 D showed that liver TC and TG levels decreased significantly after 2 weeks of X201415 administration. Figure 3 The results of H&E, Oil Red O, and MASSON staining showed that, compared with the CMC-Na group mice, mice treated with X201415 had more orderly liver lobules, significantly reduced fat accumulation and collagen fiber content, and improved lipid metabolism disorders and fibrosis. Figure 4 This study demonstrates the changes in the expression levels of lipid metabolism-related genes after X201415 drug intervention. Compared with the CMC-Na group, the expression of key enzyme genes such as Srebp-1c, Scd1, Fasn, Dpat, and Gpat was significantly decreased, suggesting that the drug effectively inhibits fatty acid and triglyceride synthesis. However, the expression level of the Acc1 gene showed no significant change. Meanwhile, Il-1β, Tnf-α, Mcp1, Il-6, and ccl2 are genes associated with a series of pro-inflammatory factors. Figure 5 The results showed that, compared with CMC-Na, X201415 administration significantly downregulated the expression of this series of inflammation-related genes. Fibrous processes are often accompanied by NASH, and the expression of Acta2, Col1a1, and Tgfβ genes is usually positively correlated with the degree of fibrosis. Figure 6 As shown, the X201415 drug significantly inhibited the expression of these key fibrosis genes compared to the CMC-Na group, demonstrating its potential efficacy in regulating the fibrosis process.
[0097] Example 4: Virtual molecular docking simulates the binding site of X201415 and GPR75 proteins.
[0098] 1. Materials used
[0099] The SDF file for X201415: Download the 3D structure from the pubchem website, and change it to: 10203632.
[0100] GPR75 protein: PDB file downloaded from the AlphaFold Protein Structure Database website, number AF-O95800-F1-v4.
[0101] Software: Maestro (version 2018), PyMOL.
[0102] 2. Molecular docking method
[0103] GPR75 protein was pretreated, and SiteMap was used to generate potential binding pockets / sites. A receptor grid was then generated using Glide. X201415 was pretreated with ligands, and flexible docking was performed using the Ligand Docking module. Finally, the data was visualized in PyMOL to generate a small molecule ligand-protein interaction map.
[0104] 3. Prediction Results
[0105] Prediction results are as follows Figure 7 As shown, X201415 increases the binding affinity and stability of the target protein by forming hydrogen bonds with ASN78 of the GPR75 protein. The overlap of π-electron clouds with TYR486 forms pi-pi bonds, further enhancing binding stability. This indicates that X201415 exhibits selectivity and strong stability towards the GPR75 protein.
[0106] The above results indicate that X201415 can directly act on the GPR75 protein, thereby improving the NASH effect, reducing liver damage, improving lipid metabolism, inhibiting inflammatory responses, and alleviating fibrosis. These results provide experimental evidence that X201415 can act on the GPR75 protein and has potential applications in the treatment of NAFLD and NASH. They also provide important clues for further research into its mechanism of action and the development of novel lipid metabolism regulators.
[0107] The preferred embodiments described herein are used to illustrate the present application and are not intended to limit the scope of the application. Any substitutions and modifications made without departing from the inventive concept are considered to be included within the scope of the present application. These embodiments were selected and described to better explain the principles and practical applications, and to facilitate understanding and use of the present application by those skilled in the art. The present invention is limited only by the claims and their full scope and equivalents.
Claims
1. The use of a biaryl-substituted 1,8-naphthyl-4(1H)-ketone compound X201415 and its pharmaceutically acceptable salt in the preparation of a medicament for treating non-alcoholic steatohepatitis.
2. The application according to claim 1, characterized in that, X201415 was prepared by the following steps: using 2-chloronicotinyl chloride X201415-a as a raw material, esterification, hydrolysis, nucleophilic substitution, and coupling reactions were performed to obtain compound X201415. The preparation route is as follows:
3. The application according to claim 1, characterized in that, The drug is a complex of X201415 with a pharmaceutically acceptable carrier or excipient.
Citation Information
Patent Citations
Method of preparing inhibitors of phosphodiesterase-4
CN1738818A
20-HETE receptor (GPR75) antagonists and methods of use
US20200030291A1