Application of coprobacterium rodent in preparation of medicine for preventing and treating senescence cognitive impairment

Abstract

The invention discloses application of coprobacterium rodent in preparation of a medicine for preventing and treating senescence cognitive impairment. According to the application disclosed by the invention, by investigating the prevention and treatment effect of the rodent faecalis on the senescence cognitive impairment, the development of the medicine for preventing and treating the senescence cognitive impairment by the rodent faecalis is promoted, and a new evidence is provided for the potential intervention effect of intestinal flora on the senescence cognitive impairment.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and specifically relates to the application of Faecalibacterium rodentium in the preparation of drugs for preventing and treating aging-related cognitive impairment. Background Art

[0002] The global population is aging rapidly. In 2020, the population aged 65 and over reached 398 million, accounting for 9.3% of the total population, and is expected to increase to 2 billion by 2050. This trend has raised multiple challenges to social, economic and medical systems, especially as the risk of cognitive impairment, including dementia and mild cognitive impairment (MCI), increases with age. Therefore, it is crucial to develop drugs that can improve or maintain cognitive abilities in the elderly. Although the FDA has approved four drugs for improving cognition in Alzheimer's disease, potential drugs for age-related cognitive impairment are still under active development. Current drugs cannot cure aging-related cognitive impairment, but can only temporarily relieve symptoms, and patient responses vary significantly. In addition, drug treatment may bring side effects, such as nausea, vomiting, loss of appetite, etc., which affect patients' treatment compliance.

[0003] In recent years, a large number of studies have shown that intestinal flora is closely related to the development of aging-related cognitive impairment. Restoring a healthy intestinal flora may inhibit or even improve the symptoms and progression of cognitive impairment. Therefore, regulating the intestinal microbiota has become a new direction for the treatment of aging-related cognitive impairment. Research in this field is growing, and emerging efforts should focus on developing potential new strategies to prevent and treat the disease. At present, there are no reports in the literature on the use of Faecalibacterium rodentium to prevent and treat aging-related cognitive impairment, which provides a new direction for future research. With the advancement of science and technology, exploring the relationship between intestinal flora and cognitive health may reveal more potential treatments.

[0004] At present, the clinical treatment of cognitive impairment due to ageing has the following defects: 1) The treatment plan is relatively simple, and there are few clinically approved drugs; 2) The current drugs cannot cure cognitive impairment due to ageing, but can only temporarily relieve symptoms; 3) Drug treatment may bring side effects, such as nausea, vomiting, loss of appetite, etc., which affect the patient's treatment compliance; 4) Individual differences: There are obvious individual differences between patients, so there may be differences in the efficacy of the same treatment plan; 5) There is a lack of effective treatment methods. Therefore, it is urgent to seek new methods and new ideas for the treatment of cognitive impairment due to ageing. Summary of the invention

[0005] In view of the technical problems existing in the prior art, the present invention provides the use of Faecalibacterium rodentium in the preparation of drugs for preventing and treating aging-related cognitive impairment.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The present invention seeks to protect the use of Faecalibacterium rodentium in the preparation of drugs for preventing and treating aging-related cognitive impairment.

[0008] Further: the medicine comprises Faecalibacterium rodentium and a pharmaceutically acceptable carrier or conventional edible excipient.

[0009] Further: the dosage form of the drug is an oral dosage form.

[0010] The Faecalibaculum rodentium described in the present invention is a conventional commercially available Faecalibaculum rodentium bacterial agent. The Faecalibaculum rodentium used in the specific embodiment of the present invention is purchased from Ningbo Mingzhou Biotechnology Co., Ltd., faecalibaculum rodentium JCM30274.

[0012] Beneficial effects of the present invention:

[0013] The present invention investigates the preventive and therapeutic effects of Faecalibacterium rodentium on senile cognitive impairment, promotes the development of drugs for preventing and treating senile cognitive impairment with Faecalibacterium rodentium, and provides new evidence for the potential intervention effect of intestinal flora in treating senile cognitive impairment. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 is the relative abundance of bacteria in the body after colonization with Faecalibacterium rodentium.

[0015] Figure 2 The improvement of learning and memory ability of aged mice by Faecalibacterium rodentium;

[0016] Among them, A: heat map of the Y-maze of mice; B: number of entries into the new arm in the novel arm test of the Y-maze; C: time spent entering the new arm in the novel arm test of the Y-maze; D: autonomous alternation rate in the Y-maze; E: trajectory map of new object recognition of mice; F: ratio of new object exploration time in the novel object recognition test; G: discrimination index in the novel object recognition test.

[0017] Figure 3 This is a picture of β-galactosidase staining of senescent cells in the mouse hippocampus.

[0018] Figure 4 The level of oxidative factors in mouse brain measured by the kit;

[0019] Among them, A: malondialdehyde content in mice; B: glutathione peroxidase activity in the brain; C: superoxide dismutase activity. DETAILED DESCRIPTION

[0020] The following operation steps are used to illustrate the present invention, so that the technical content is clearer and easier to understand. The following is an exemplary description, and the modification or replacement of the method, steps or conditions of the present invention without departing from the spirit and essence of the present invention belongs to the scope of the present invention.

[0021] Unless otherwise specified, the experimental methods used below are all conventional methods; the materials and reagents used can be purchased through commercial channels unless otherwise specified.

[0022] Example 1

[0023] Step 1: Establishment of a mouse model of aging-related cognitive impairment

[0024] (1) Preparation of D-galactose solution: Dissolve D-galactose in sterile physiological saline to prepare a 10% (W / V, g / 100 ml) D-galactose solution.

[0025] (2) Establishment of a mouse model of aging-related cognitive impairment: The model group and the treatment group were intraperitoneally injected with 1000 mg / kg of D-galactose for 75 days, and the control group was intraperitoneally injected with an equal amount of normal saline.

[0026] Step 2: Activation and cultivation of freeze-dried powder of Faecalibacterium rodentium

[0027] Resuscitation and culture of freeze-dried powder of Faecalibaculum rodentium: This strain was purchased from Ningbo Mingzhou Biotechnology Co., Ltd., and its English name is Faecalibaculum rodentium JCM 30274. Wipe the surface of the freeze-dried tube with 75% alcohol, use a grinding wheel to make a circle of obvious cracks along the middle of the freeze-dried tube, and then wrap it with sterile gauze to break it. Pipette about 0.5ml of modified PYG culture medium (purchased from Ningbo Mingzhou Biotechnology Co., Ltd.) into the freeze-dried tube, fully dissolve and mix. Pipette about 0.5ml into 10ml of modified PYG culture medium. Place the inoculated bacteria in an anaerobic incubator at 37℃ for culture. Perform subculture after 24h.

[0028] Step 3: Colonization with Faecalibacterium rodentium

[0029] After the expanded culture of Faecalibacterium rodentium was centrifuged at 4000 rpm for 20 min, the upper culture medium was discarded, and the lower sediment was retained. It was then resuspended in sterile anaerobic PBS and prepared into 5×10 9 CFU / mL concentration of Faecalibacterium rodentium suspension. The mice in the treatment group were gavaged with 200 μL Faecalibacterium rodentium suspension (10 9 CFU / mouse). At the same time, the control group and the model group were intragastrically administered with the same volume of sterile anaerobic PBS.

[0030] Step 4: Investigation of the success rate of colonization with F. rodentium

[0031] Fecal genomic DNA extraction: Extraction was performed according to the instructions of the Solebao Fecal Genomic Extraction Kit. First, 400μL-800μL of solution SA was added to the collected fecal culture medium, placed on ice for 10 minutes, and centrifuged at 12000g for 1 minute. Discard the supernatant, add 400μL of solution SB, 20μL of 10mg / mL RNase A, and 20μL of 10mg / mL proteinase k to the precipitate, vortex for 30s, 65℃ water bath for 0-60min, invert several times during the period, and centrifuge at 12000g for 2min. Take the supernatant in a 1.5mL centrifuge tube, add 300-600μL of solution SC, centrifuge at 12000g for 1-2min, transfer the supernatant to the filter column (the filter column is placed in the collection tube), and then centrifuge at 12000rpm for 1min. Pipette the filtrate into the DNA adsorption column, let it stand at room temperature for 1-2min, and centrifuge at 12000g for 0.5-1min (can be repeated once). Pour out the waste liquid in the collection tube, add 500μL of rinsing solution to the adsorption column, and centrifuge at 12000rpm for 1min. (Repeat once). Pour out the waste liquid in the collection tube, put the adsorption column back into the collection tube, and centrifuge at 12000rpm for 0.5-1min. Take out the adsorption column and dry it at room temperature for several minutes (depending on factors such as season and climate). Put the adsorption column into a new centrifuge tube, add 50-100μL of elution solution (preheated at 65℃), and centrifuge at 12000rpm for 1min.

[0032] Table 1 Primers for PCR detection of Faecalibacterium rodentium

[0033] Bacteria Forward Primer Post Primer Faecalibaculumrodentium CCGGGAATACGCTCTGGAAA GCCAACCAACTAATGCACCG

[0034] PCR determination of relative abundance of fecal flora: PCR experiments were performed according to the instructions (primers are shown in Table 1). The reaction system was as follows: SYBR Green, 7.5 μL; PCR Forward Primer (10 μM), 1 μL; PCR Reverse Primer (10 μM), 1 μL; cDNA, 1 μL; RNase Free dH 2 O, 4.5 μL. The total system is 15 μL. The reaction conditions are: 95℃ pre-denaturation reaction for 90s; PCR reaction cycle (95℃30s, annealing temperature 60℃30s, 72℃30s) 40 cycles. The temperature was increased from 65℃ to 95℃ at 0.5℃ / 5s intervals, and the melting curve analysis was performed.

[0035] The results showed that after colonization with Faecalibacterium rodentium, the content of Faecalibacterium rodentium in the model group mice increased significantly, indicating that the colonization was successful. Figure 1 .

[0036] Step 5: Study on the effect of Faecalibacterium rodentium on learning and memory ability of aged mice

[0037] (1) New object experimental test: It is divided into three stages: adaptation stage, familiarization stage and test stage. On the first day of the adaptation stage, the animal was placed in an empty box with its head facing the side closest to the experimenter and allowed to move freely for 5 minutes. After the experiment, the mouse was taken out and returned to the original cage, and the empty box was cleaned with 70% (v / v) alcohol to remove the smell left by the previous animal. On the second day of the familiarization stage, two identical objects (black cylinders) were fixed 5 cm away from the two box walls. Randomization has been performed in advance in different mice and different groups. The animal was then placed in an empty box with its head facing the opposite direction of the two identical objects and allowed to move freely in the box. Anymaze software was used to calculate the exploration time of the animal on the two objects. After the experiment, the animal was taken out and the empty box and objects were cleaned with 70% (v / v) alcohol to remove the smell left by the animal. On the third day of the test stage, 24 hours later, similar to the familiarization stage, one of the identical objects was replaced with another object (white cylinder). Anymaze was used to calculate the exploration time of the animal on the two objects.

[0038] (2) Y-maze novel arm recognition test: Mark the three arms of the maze as A, B, and C. Close one of the arms with a partition. Record which arm is closed. Place the animal into an open arm facing the center and record which arm the animal was placed in to leave the behavioral testing room. Allow the animal to freely explore the maze for 5 minutes. Return the test mouse to its home cage. After waiting for 1 hour, remove the partition and place the same test mouse at the far end of the same arm used in the previous trial, facing the center of the maze. Allow the animal to freely explore the maze for 5 minutes, record the video and save the file. Remove the mouse from the maze and return it to the cage. Clean all walls and floor of the maze before proceeding to the next animal. At the end of the experiment, use Anymaze software to analyze the number of entries into each arm and the time spent in each arm during the test.

[0039] (3) Y-maze spontaneous alternation test: The three arms of the maze are A, B, and C. Place the test animal at the far end of the arm marked A, facing the center of the maze, and gently grasp the base of the tail. Allow the mouse to freely explore the maze for 5 minutes. After the end, remove the mouse from the maze and return it to the original cage. And before proceeding to the next animal, clean all the walls and floors of the maze. Check the video and record all the times of entering the arm and the number of alternations. Spontaneous alternation rate (%) = [(spontaneous alternation number) / (total number of arm entries-2)]×100.

[0040] The results showed that the new object recognition index, Y-maze autonomous alternation rate, and the number and time of entering the new arm of the mice were significantly reduced after modeling, and the neural function was damaged. Colonization with Faecalibacterium rodentium significantly improved the learning and memory ability of the mice. Figure 2 .

[0041] Step 6: Effect of Faecalibacterium rodentium on the number of senescent neurons in the hippocampus of aged mice

[0042] Use a slicer to freeze-section the brain tissue wrapped in OCT glue, with a slice thickness of 20 μm. Soak and wash the tissue 3 times with PBS, each time for no less than 5 minutes. Add an appropriate volume of β-galactosidase staining fixative to fully cover the tissue, and fix at room temperature for no less than 15 minutes. Soak and wash the tissue 3 times with PBS, each time for no less than 5 minutes. Aspirate PBS and add an appropriate amount of staining working solution. Incubate overnight at 37°C and seal with plastic wrap to prevent evaporation.

[0043] The results showed that the number of senescent neurons in the hippocampus of the model group mice increased significantly, and the number of senescent neurons decreased after colonization with Faecalibacterium rodentium. Figure 3 .

[0044] Step 7: Effects of Faecalibacterium rodentium on oxidative stress levels in the brain of aged mice

[0045] (1) Total glutathione peroxidase detection: According to the instructions of the Bio-Tech Total Glutathione Peroxidase Detection Kit, use a 96-well plate, add the detection buffer, the sample to be tested, and the GPx detection working solution in sequence, mix well, add 40 μl of GPx detection working solution, and incubate at room temperature for 15 minutes to consume the GSSG in the sample and eliminate interference with subsequent detection. Add 10 μl of 30 mM peroxide reagent solution to each well and mix well. Immediately use an ELISA reader to measure A340, and record it as the 0-minute reading. Measure A340 every 1 minute.

[0046] (2) Total superoxide dismutase activity detection: According to the instructions of the Bio-Time Total SOD Activity Detection Kit, set up sample wells and various blank control wells in a 96-well plate. Add the sample to be tested and SOD buffer, enzyme working solution and reaction starter solution in sequence according to the table below. After adding the reaction starter working solution, mix thoroughly. Detect enzyme activity at A450.

[0047] (3) Malondialdehyde content detection: According to the instructions of the Solebold Malondialdehyde Content Detection Kit, add 300 μl of detection working solution, 100 μl of sample and 100 ul of reagent three mixed solution into a 1.5 ml EP tube, keep it in a 100°C water bath for 60 min, cool it in an ice bath, and centrifuge it at 10000g for 10 min at room temperature. Pipette 200 mL of supernatant into a 96-well plate, and measure the absorbance of each sample at 532 nm and 600 nm.

[0048] The results showed that the total glutathione peroxidase and total superoxide dismutase activities in the brain of mice after modeling decreased, and the malondialdehyde content increased. The total glutathione peroxidase and total superoxide dismutase activities of mice colonized with Faecalibacterium rodentium increased, and the malondialdehyde content decreased, and the oxidative stress in the body was alleviated. Figure 4 .

[0049] Behavioral experiments have shown that Faecalibacterium rodentium can significantly improve age-related cognitive impairment in mice. The process of age-related cognitive impairment in mice is also accompanied by brain aging and oxidative stress. Through the cell aging β-galactosidase staining experiment, it was found that after colonization with Faecalibacterium rodentium, the number of senescent neurons in the hippocampus of mice was significantly reduced. The results of the oxidative stress test kit showed that Faecalibacterium rodentium can increase the levels of superoxide dismutase and glutathione peroxidase in the mouse brain, while reducing the level of lipid oxidation.

[0050] The research results of the present invention show that colonization with Faecalibacterium rodentium can significantly improve cognitive impairment and brain aging in aging mice.

[0051] Example 2

[0052] A probiotic tablet based on Faecalibacterium rodentium, comprising, by weight, 10 parts of Faecalibacterium rodentium freeze-dried powder, 10 parts of konjac flour, 78.95 parts of direct compression maltitol, 0.05 parts of vitamin C, and 1 part of magnesium stearate. The number of viable bacteria in the Faecalibacterium rodentium freeze-dried powder is 1×10 10 CFU / g. The direct compression excipient is direct compression maltitol. The Faecalibacterium rodentium was purchased from Ningbo Mingzhou Biotechnology Co., Ltd.

[0053] Step 1: Preparation method of Faecalibacterium rodentium freeze-dried powder

[0054] (1) The culture medium used was the modified PYG liquid culture medium produced by Ningbo Mingzhou Biotechnology Co., Ltd.

[0055] (2) Preparation of strain protective agent: The formula of the strain protective agent is 80 g / L skim milk, 100 g / L trehalose, and 20 g / L glycerol.

[0056] (3) Faecalibacterium rodentium was inoculated into a modified PYG medium at an inoculum size of 5%-10% (v / v) under anaerobic conditions at a constant temperature of 37° C. for 18-24 h.

[0057] (4) After the culture is completed, the culture product is collected and centrifuged at a speed of 4000 rpm for 20 min.

[0058] (5) The centrifugal product is mixed with a strain protective agent, and the mixing weight ratio of the centrifugal product to the strain protective agent is 1:1.5.

[0059] (6) freeze-drying;

[0060] (7) The freeze-dried product is crushed and sieved to obtain Faecalibacterium rodentium; the sieve is a 15-mesh standard sieve.

[0061] Step 2: Preparation of probiotic tablets based on Faecalibacterium rodentium

[0062] (1) Weigh each raw material according to the weight ratio and set aside. Mix 0.05 parts of vitamin C and 1.95 parts of direct compression maltitol evenly to obtain a mixed small material;

[0063] (2) 10 parts of Faecalibacterium rodentium, 10 parts of konjac flour, 77 parts of direct-compressed maltitol and the mixed small ingredients are mixed evenly to obtain a preliminary mixture; the mixing speed is controlled at 35 rpm, and the mixing time is controlled at 20 min.

[0064] (3) The obtained preliminary mixture is mixed evenly with 1 part of magnesium stearate to obtain a total mixed semi-finished product; the mixing speed is controlled at 25 rpm and the mixing time is controlled at 20 min.

[0065] (4) The obtained total mixed semi-finished product is compressed by a tablet press to obtain tablets; during the tablet compression process, the tablet compression pressure is controlled at 16 KN.

[0066] (5) The tablets obtained in the step are packaged in a packaging bottle to obtain a finished product; the packaging bottle used for packaging is a high-density polyethylene (HDPE) packaging bottle with a built-in desiccant.

[0067] (6) The above operations are carried out in a constant temperature and humidity environment in a 100,000-level GMP workshop, with the temperature controlled at 20°C and the humidity controlled at 30%. The moisture and water activity of the finished product need to be controlled, with the moisture content controlled at 3% and the water activity controlled at 0.25aW.

Claims

1. Application of Faecalibacterium rodentium in the preparation of drugs for the prevention and treatment of age-related cognitive impairment.

2. The use according to claim 1, characterized in that: The medicine comprises Faecalibacterium rodentium and a pharmaceutically acceptable carrier or a conventional edible auxiliary material.

3. The use according to claim 1 or 2, characterized in that: The dosage form of the drug is an oral dosage form.

Images