Protein variant combination for improving immune function of iNKT cells and application thereof

Abstract

The application discloses a protein variant combination for improving iNKT cell immune function and application, and relates to the technical field of tumor immunity. The protein variant combination comprises protein variant ANTA3, protein variant GLUT3G1, protein variant LDHB B2, protein variant PC P4 and protein variant PCK1K2; the gene sequences of the five protein variants are simultaneously embedded into the genome of iNKT cells in a site-specific manner for the first time, forming metabolic restructured MetaR-iNKT cells, and it is found that the MetaR-iNKT cells can synergistically kill lung cancer solid tumors in combination with ATP mitochondrial transporter protein inhibitor PENAO.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of tumor immunity, and more particularly to a protein variant combination for improving the immune function of iNKT cells and application thereof. BACKGROUND

[0002] iNKT cells (invariant natural killer T cells) are a unique type of T cells that have both innate immunity of NK cells and adaptive immunity of T cells. They recognize lipid antigens through TCR (T cell receptor) and react rapidly within minutes, secrete and release different types of cytokines and directly kill cells to play a role, and can drive DC cells, NK cells, T cells and other immune cells to synergistically exert a combined treatment effect. Since iNKT cells have anti-tumor efficacy, they have become an important immune cell type for clinical immunotherapy.

[0003] However, as a subpopulation of T cells, the persistence of iNKT cells in the process of infiltrating solid tumors is often limited by tumor metabolic immunosuppressive microenvironments such as glucose competition, high lactic acid environment, etc. In order to improve the competition ability of iNKT cells with solid tumor cells for glucose, the present application uses an ATP mitochondrial transporter inhibitor named PENAO in combination with iNKT cells, which can effectively inhibit the metabolism of solid tumor cells for glucose and weaken the competition of tumor cells and iNKT cells for sugar. However, the energy metabolism function of iNKT cells will also be inhibited to some extent by PENAO, limiting the combined effect of iNKT cells and PENAO.

[0004] Therefore, how to improve the immune ability of iNKT cells is a problem that those skilled in the art need to solve. SUMMARY

[0005] Therefore, the present application provides a protein variant combination for improving the immune function of iNKT cells and application thereof.

[0006] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0007] A protein variant combination for improving the immune function of iNKT cells, the protein variant combination being protein variant ANTA3, protein variant GLUT3G1, protein variant LDHB B2, protein variant PC P4 and protein variant PCK1K2.

[0008] The nucleotide sequence of the protein variant ANTA3 is shown in SEQ ID No. 1.

[0009] The nucleotide sequence of the protein variant GLUT3 G1 is shown as SEQ ID No. 2;

[0010] The nucleotide sequence of the protein variant LDHB B2 is shown as SEQ ID No. 3;

[0011] The nucleotide sequence of the protein variant PCK1 K2 is shown as SEQ ID No. 4;

[0012] The nucleotide sequence of the protein variant PC P4 is shown as SEQ ID No. 5.

[0013] A vector combination for improving the immune function of iNKT cells, the vector combination is a gene variant combination vector iNKT-MetaR1, a gene variant combination vector iNKT-MetaR2 and a gene variant combination vector iNKT-MetaR3;

[0014] The gene variant combination vector iNKT-MetaR1 comprises: a homologous arm 1, an HS4 insulator, a CMV promoter, the protein variant ANTA3 gene of claim 1, a P2A, the protein variant GLUT3 G1 gene of claim 1, a P2A, an mStayGold fluorescent reporter protein, a poly(A) tail, an HS4 insulator, a homologous arm 2, and the nucleotide sequence is shown as SEQ ID No. 6;

[0015] The gene variant combination vector iNKT-MetaR2 comprises: a homologous arm 3, an HS4 insulator, a PGK1 promoter, the protein variant LDHB B2 gene of claim 1, a P2A, the protein variant PCK1 K2 gene of claim 1, a P2A, an mTagBFP2 fluorescent reporter protein, a poly(A) tail, an HS4 insulator, a homologous arm 4, and the nucleotide sequence is shown as SEQ ID No. 7;

[0016] The gene variant combination vector iNKT-MetaR3 comprises: a homologous arm 5, an HS4 insulator, an EF1ɑcore promoter, the protein variant PC P4 gene of claim 1, a P2A, an mScarlet fluorescent reporter protein, a poly(A) tail, an HS4 insulator, a homologous arm 6, and the nucleotide sequence is shown as SEQ ID No. 8.

[0017] Further, the gene variant combination vector iNKT-MetaR1 corresponds to the human genome CCR5 safe insertion site cutting sgRNA1, and the gene sequence of sgRNA1 is:

[0018] AGGCTTCCCGCATTCAAAAT, as shown in SEQ ID No. 9;

[0019] The gene variant combination carrier iNKT-MetaR2 corresponds to the safe insertion site cutting sgRNA2 of human genome chromosome 15 (15q25.3), and the gene sequence of sgRNA2 is as follows:

[0020] AAAGCTATTACACGGTTCTG, as shown in SEQ ID No. 11;

[0021] The gene variant combination carrier iNKT-MetaR3 corresponds to the safe insertion site cutting sgRNA3 of human genome chromosome 14 (14q32.3), and the gene sequence of sgRNA3 is as follows:

[0022] GTCGGGCCAGTGATCTTGTA, as shown in SEQ ID No. 13.

[0023] A transgenic iNKT cell, wherein the cell comprises the gene variant combination carrier iNKT-MetaR1, the gene variant combination carrier iNKT-MetaR2 and the gene variant combination carrier iNKT-MetaR3 according to claim 2.

[0024] Application of the protein variant combination in the preparation of tumor immunological drugs.

[0025] According to the technical solutions, compared with the prior art, the present application has the following beneficial effects:

[0026] The present application provides a protein variant ANT A3 of ATP mitochondrial transporter ANT, which can effectively improve the glucose glycolysis activity of iNKT cells, has higher iNKT cell mitochondrial ATP generation activity than the wild type ANT protein, and improves the drug tolerance of iNKT cells to the wild type ANT inhibitor PENAO.

[0027] The present application provides a protein variant GLUT3 G1 of glucose transporter 3, which has higher iNKT cell glucose uptake capacity than the wild type GLUT3, and can effectively enhance the glucose uptake capacity of iNKT cells.

[0028] The present application provides a protein variant LDHB B2 of lactate dehydrogenase B, which has higher iNKT cell lactic acid metabolism efficiency than the wild type LDHB, and can effectively improve the lactic acid metabolism efficiency of iNKT cells.

[0029] The application provides a protein variant PCK1 K2 of phosphoenolpyruvate carboxykinase 1, which has stronger iNKT cell gluconeogenesis than wild-type PCK1, and can effectively improve the iNKT cell gluconeogenesis.

[0030] The application provides a protein variant PCK1 K2 of phosphoenolpyruvate carboxykinase 1, which has stronger iNKT cell gluconeogenesis than wild-type PCK1, and can effectively improve the iNKT cell gluconeogenesis.

[0031] The application first simultaneously inserts the gene sequences of the five protein variants into the iNKT cell genome in a site-specific manner to form MetaR-iNKT cells with metabolic reconstruction, and finds that the MetaR-iNKT cells can synergistically kill lung cancer solid tumors in combination with the ATP mitochondrial transporter protein inhibitor PENAO. BRIEF DESCRIPTION OF DRAWINGS

[0032] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description only constitute the embodiments of the application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of the provided drawings.

[0033] Figure 1 It is a comparison chart of extracellular glucose uptake efficiency of seven iNKT cell lines and H1299 lung cancer cell lines;

[0034] Figure 2 It is a Welch's t test p value comparison chart of extracellular glucose uptake efficiency of iNKT-MetaR1, GLUT3 G1 and other cell lines;

[0035] Figure 3 It is a comparison chart of intracellular ATP generation efficiency of seven iNKT cells such as iNKT-MetaR1 and ANTA3 and H1299 lung cancer cell lines;

[0036] Figure 4 It is a Welch's t test p value comparison chart of intracellular ATP generation efficiency of iNKT-MetaR1, ANTA3 and other cell lines;

[0037] Figure 5 It is a comparison chart of intracellular ATP generation efficiency of seven iNKT cells such as iNKT-MetaR2 and H1299 lung cancer cell lines;

[0038] Figure 6 It is a Welch's t test significance heat map of intracellular ATP generation efficiency of iNKT-MetaR2 and other cell lines.

[0039] Figure 7 Figure 7. Comparison of intracellular lactate levels between 7 iNKT cell lines and H1299 lung cancer cell line;

[0040] Figure 8 Figure 8. Welch's t-test significance heat map of intracellular lactate levels between iNKT-MetaR2, LDHB B4 and other cell lines;

[0041] Figure 9 Figure 9. Comparison of intracellular ROS levels between 7 iNKT cell lines and H1299 lung cancer cell line;

[0042] Figure 10 Figure 10. Welch's t-test significance heat map of intracellular ROS levels between iNKT-MetaR3, iNKT-MetaR2 and other cell lines;

[0043] Figure 11 Figure 11. Comparison of tumor infiltrating cell numbers of each iNKT cell line in lung adenocarcinoma organoid sample 1;

[0044] Figure 12 Figure 12. Comparison of tumor infiltrating cell numbers of each iNKT cell line in lung adenocarcinoma organoid sample 2;

[0045] Figure 13 Figure 13. Comparison of tumor infiltrating cell numbers of each iNKT cell line in lung adenocarcinoma organoid sample 3;

[0046] Figure 14 Figure 14. Comparison of tumor infiltrating cell numbers of each iNKT cell line in lung squamous carcinoma organoid sample 1;

[0047] Figure 15 Figure 15. Comparison of tumor infiltrating cell numbers of each iNKT cell line in lung squamous carcinoma organoid sample 2;

[0048] Figure 16 Figure 16. Comparison of tumor infiltrating cell numbers of each iNKT cell line in lung squamous carcinoma organoid sample 3;

[0049] Figure 17 Figure 17. Total data box plot of tumor infiltrating cell numbers of each iNKT cell line in total lung cancer organoid sample statistics;

[0050] Figure 18 Figure 18. p-value relationship diagram of MetaR-iNKT and each cell line in lung cancer tumor sample infiltration;

[0051] Figure 19 Figure 19. Activation of anti-apoptotic gene expression of each iNKT cell line infiltrating lung adenocarcinoma organoid under PENAO drug treatment;

[0052] Figure 20 Welch's t-test significance heat map for MetaR-iNKT and genes associated with different cell lines

[0053] Figure 21 Figure for expression of activated anti-apoptotic genes in lung adenocarcinoma organoids infiltrated with iNKT cell lines without PENAO drug treatment

[0054] Figure 22 Welch's t-test significance heat map for MetaR-iNKT and genes associated with different cell lines

[0055] Figure 23 Figure for expression of activated anti-apoptotic genes in lung squamous carcinoma organoids infiltrated with iNKT cell lines with PENAO drug treatment

[0056] Figure 24 Welch's t-test significance heat map for MetaR-iNKT and genes associated with different cell lines

[0057] Figure 25 Figure for expression of activated anti-apoptotic genes in lung squamous carcinoma organoids infiltrated with iNKT cell lines without PENAO drug treatment

[0058] Figure 26 Welch's t-test significance heat map for MetaR-iNKT and genes associated with different cell lines

[0059] Figure 27 Figure for comparison of tumor killing ability of MetaR-iNKT and other iNKT cell lines with or without PENAO

[0060] Figure 28 Welch's t-test significance heat map for MetaR-iNKT and other iNKT cell lines. DETAILED DESCRIPTION

[0061] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0062] Embodiment 1

[0063] In order to improve the metabolic adaptability of iNKT cells in the tumor microenvironment, the present application sets up three kinds of transgenic nucleic acid vectors iNKT-MetaR1, iNKT-MetaR2 and iNKT-MetaR3, through CRISPR / Cas9 induction, the ANT A3, GLUT3 G1, LDHB B2, PCK1 K2, PC P4 multiple related gene variants capable of functionally compensating for the inhibition of ATP mitochondrial transporter ANT activity caused by PENAO, improving the antioxidant capacity of immune cells and promoting the metabolic adaptability of tumor infiltrating immune cells in the tumor microenvironment are co-expressed in iNKT cells.

[0064] The nucleotide sequence (894bp) of the protein variant ANTA3 is shown as SEQ ID No. 1;

[0065] The nucleotide sequence (1470bp) of the protein variant GLUT3 G1 is shown as SEQ ID No. 2;

[0066] The nucleotide sequence (993bp) of the protein variant LDHB B2 is shown as SEQ ID No. 3;

[0067] The nucleotide sequence (1866bp) of the protein variant PCK1 K2 is shown as SEQ ID No. 4;

[0068] The nucleotide sequence (3435bp) of the protein variant PC P4 is shown as SEQ ID No. 5;

[0069] (1) Gene variant combination vector iNKT-MetaR1: homologous arm 1-HS4 insulator-CMV promoter-ANT A3-P2A-GLUT3 G1-P2A-mStayGold fluorescent reporter protein-poly(A) tail-HS4 insulator-homologous arm 2;

[0070] The sequence information (4639bp) of the gene variant combination vector iNKT-MetaR1 is shown as SEQ ID No. 6;

[0071] (2) Gene variant combination vector iNKT-MetaR2: homologous arm 3-HS4 insulator-PGK1 promoter-LDHBB2-P2A-PCK1 K2-P2A-mTagBFP2 fluorescent reporter protein-poly(A) tail-HS4 insulator-homologous arm 4;

[0072] The sequence information (5134bp) of the gene variant combination vector iNKT-MetaR2 is shown as SEQ ID No. 7;

[0073] (3) Gene variant combination vector iNKT-MetaR3: homologous arm 5-HS4 insulator-EF1a core promoter-PC P4-P2A-mScarlet fluorescent reporter-poly(A) tail-HS4 insulator-homologous arm 6;

[0074] Gene variant combination vector iNKT-MetaR3 sequence information (5340bp) is shown as SEQ ID No. 8. 3. DETAILED DESCRIPTION

[0076] (1) iNKT cell genome site-directed insertion of gene variant expression vector

[0077] Synthetic guide nucleic acid sequence guide4iNKT containing sgRNA1, sgRNA2 and sgRNA3 guiding eSpCas9-plus to locate to 3 insertion sites of gene variant combination 3;

[0078] The structure of guide4iNKT is:

[0079] U6 promoter-insertion site sgRNA1-poly T tail-H1 promoter-insertion site sgRNA2-poly T tail-7SK promoter-insertion site sgRNA3-poly T tail;

[0080] Gene variant combination vector iNKT-MetaR1 corresponds to human genome CCR5 safe insertion site cutting sgRNA1, and the gene sequence of sgRNA1 is:

[0081] AGGCTTCCCGCATTCAAAAT, shown as SEQ ID No. 9;

[0082] Gene insertion site (156bp) containing sgRNA1, shown as SEQ ID No. 10;

[0083] (>hg38_dna range=chr3:46371907-46372062 5'pad=0 3'pad=0 strand=+ repeatMasking=none)

[0084] Gene variant combination vector iNKT-MetaR2 corresponds to human genome chromosome 15 (15q25.3) safe insertion site cutting sgRNA2, and the gene sequence of sgRNA2 is:

[0085] AAAGCTATTACACGGTTCTG, shown as SEQ ID No. 11;

[0086] Gene insertion site (200bp) containing sgRNA2, as shown in SEQ ID No. 12;

[0087] (>hg38_dna range=chr15:85922854-85923053 5'pad=0 3'pad=0 strand=+ repeatMasking=none)

[0088] Gene variant combination vector iNKT-MetaR3 corresponds to the safe insertion site cutting sgRNA3 on human genome chromosome 14 (14q32.3), the gene sequence of sgRNA3 is:

[0089] GTCGGGCCAGTGATCTTGTA, as shown in SEQ ID No. 13.

[0090] Gene insertion site (200bp) containing sgRNA3, as shown in SEQ ID No. 14;

[0091] (>hg38_dna range=chr14:101467601-101467800 5'pad=0 3'pad=0 strand=+ repeatMasking=none)

[0092] Mix guide4iNKT with the vector expressing eSpCas9-plus (Addgene No. 126767) and the above three gene variant combination vectors iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR3 in the ratio of 3:3:1:1:1, and transfect them into iNKT cells by electric conversion device Nucleofector TM Technology (Lonza) according to the following steps, material preparation:

[0093] 1) Plasmid DNA: Prepare guide4iNKT, eSpCas9-plus, iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR3 plasmids, the concentration of each plasmid should be 1-5 μg;

[0094] 2) iNKT cells: Prepare 1x 106-5x 106 iNKT cells, the cells should be at 70-85% confluence;

[0095] 3) Nucleofector TM Solution: Use Nucleofector TM Solution suitable for iNKT cells;

[0096] 4) Nucleofector TM Device: Ensure the device is calibrated and ready for use;

[0097] 5) Nucleocuvette TM : Use Nucleocuvette suitable for Nucleofector TM Device; TM .

[0098] Operation steps:

[0099] 1) Cell preparation: Centrifuge iNKT cells to collect and remove culture medium; wash cells with PBS twice, then resuspend in appropriate amount of Nucleofector TM Solution;

[0100] 2) Plasmid mixing: Mix 5 plasmids (guide4iNKT, eSpCas9-plus, iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR;

[0101] 3) Mix together, total amount not more than 5 μg; add plasmid mixture to cell suspension, ensure plasmid volume does not exceed 10% of total reaction volume; 3) Electroporation: 1 Transfer cells and plasmid mixture to Nucleocuvette TM ; Insert Nucleocuvette TM into Nucleofector TM Device; Select Nucleofector TM program suitable for iNKT cells (can refer to the optimization program provided by Lonza, or use Cell Line Optimization Nucleofector TM Kit for optimization); Press "Start" button to start the electroporation process;

[0102] 4) Post-transfection treatment: Immediately after electroporation, remove the sample from Nucleocuvette TM with 500 μL preheated medium; transfer cells to preheated medium and incubate in a 37°C, 5% CO2 incubator;

[0103] 5) Subsequent culture: Continue to culture cells and add selective reagents (such as antibiotics) to screen successfully transfected cells after 24-72 hours; according to experimental requirements, analyze gene expression at different time points.

[0104] Notes: Ensure all reagents and equipment are pre-warmed to 37℃ before use. Use high purity plasmid DNA with an A260 / A280 ratio of at least 1.8; minimize the time the cells spend in the Nucleofector TM Solution to improve cell survival.

[0105] By the above steps, the five plasmids were co-transfected into iNKT cells to obtain a high iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR3 gene fragment site-directed co-knock-in efficiency.

[0106] (2) The overexpression plasmids of iNKT-MetaR1, ANTA3, GLUT3 G1, wild-type ANT+ wild-type GLUT3, wild-type ANT (NCBI Reference Sequence: NM_001152.5) or wild-type GLUT3 (NCBI Reference Sequence: NM_006931.3) were respectively introduced into iNKT cells (see the plasmid structure in the figure), and six cell lines were constructed. The glucose uptake and ATP generation efficiency of each of the above cell lines, wild-type iNKT cell line and lung cancer H1299 cell line under the action of 5 μM PENAO drug were compared;

[0107] The Glucose Uptake-Glo TM Reagent Kit was used to quantitatively detect the glucose uptake capacity of each cell line sample treated with PENAO drug; the CellTiter 2.0 Reagent Kit (supplier: Promega, item number: G9242) was used to detect the intracellular ATP content of each cell line sample treated with PENAO drug.

[0108] The results are shown in the following figures: Figures 1-4 Figure 1 Figure 1 is a box plot quantitative analysis of the extracellular glucose uptake capacity of seven iNKT cell lines and H1299 lung cancer cell lines; Figure 2 Figure 2 is a two-tailed Welch's t-test used to compare the significant differences in the extracellular glucose uptake capacity of iNKT-MetaR1, GLUT3 G1 and other cell lines with or without PENAO drug; Figure 3 Figure 3 is a box plot quantitative analysis of the intracellular ATP generation capacity of seven iNKT cell lines and H1299 lung cancer cell lines; Figure 4 Figure 4 is a two-tailed Welch's t-test used to compare the significant differences in the intracellular ATP generation capacity of iNKT-MetaR1, ANTA3 and other cell lines with or without PENAO drug. ​​

[0109] It can be observed that, in the presence or absence of the PENAO drug, the two cell lines MetaR1-iNKT and GLUT3 G1 containing the GLUT3 G1 protein variant all exhibit significantly enhanced extracellular glucose uptake capacity compared to the wild-type GLUT3 cell line and the H1299 lung cancer cell line. Figures 1-2 The two cell lines MetaR1-iNKT and ANT A3 containing the ANT A3 protein variant all exhibit significantly enhanced intracellular ATP generation capacity compared to the wild-type GLUT3 cell line and the H1299 lung cancer cell line. Figures 3-4 Therefore, GLUT3 G1, ANT ANT3 and iNKT-MetaR1 all exhibit a stronger glucose competitive advantage for iNKT cells than for tumor cells.

[0110] (3) The overexpression plasmids of iNKT-MetaR2, iNKT-MetaR3, LDHB B2, PCK1 K2, wild-type LDHB+ wild-type PCK1, wild-type LDHB, wild-type PCK1 or wild-type PC (see the plasmid structure in the figure) were respectively introduced into iNKT cells to construct 6 cell lines, and the ATP generation efficiency, lactic acid metabolism rate and intracellular ROS oxide abundance of the above cell lines, wild-type iNKT cell line and lung cancer H1299 cell line were compared in the presence of 5 μM PENAO drug and 20 mmol / L lactic acid at pH < 6.7;

[0111] The present application uses 2.0 kit (supplier Promega, item number G9242) to detect the intracellular ATP content of each cell line sample treated with the PENAO drug; Lactate-Glo TM kit (supplier Promega, item number J5021) to detect the intracellular lactic acid content of each cell line sample treated with the PENAO drug and lactic acid; DCFDA-cell ROS content detection kit (supplier Abeam, item number ab113851) to detect the intracellular ROS content of each cell line sample treated with the PENAO drug and lactic acid.

[0112] The results are shown in Figures 5-10 , which are box plot quantitative analysis of intracellular ATP generation capacity of 7 iNKT cells and H1299 lung cancer cell lines; Figure 5 is a box plot quantitative analysis of intracellular ATP generation capacity of 7 iNKT cells and H1299 lung cancer cell lines; Figure 6 is a comparison of the significant difference in intracellular ATP generation capacity between iNKT-MetaR2 and other cell lines in the presence or absence of the PENAO drug using a two-tailed Welch's t test; Figure 7Boxplot quantitative analysis of intracellular lactate content of 7 iNKT cell lines and H1299 lung cancer cell line; Figure 8 Significant difference of intracellular lactate content of iNKT-MetaR2, LDHB B2 and other cell lines with or without PENAO drug was compared using two-tailed Welch's t-test. Figure 9 Boxplot quantitative analysis of intracellular ROS content of 7 iNKT cell lines and H1299 lung cancer cell line; Figure 10 Significant difference of intracellular ROS content of iNKT-MetaR3, iNKT-MetaR2 and other cell lines with or without PENAO drug was compared using two-tailed Welch's t-test.

[0113] It can be found that MetaR2-iNKT cell lines containing LDHB B2 and PCK1 K2 protein variants perform best in both ATP generation efficiency and intracellular lactate content tests in the presence or absence of PENAO drug Figures 5-8 ); and MetaR3-iNKT cell lines containing PC P4 protein variants perform best in intracellular ROS content test Figures 9-10 ).

[0114] (4) The present application equally mixes overexpressed metabolic reconstruction MetaR-iNKT cell lines (iNKT-MetaR1 / R2 / R3), iNKT-MetaR1 / R2, iNKT-MetaR1 / R3, iNKT-MetaR2 / R3, iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR3, iNKT genetically modified cell lines and wild-type iNKT cell lines, and adds these equally mixed iNKT cells to 3 lung adenocarcinoma LUAD-Orga1, LUAD-Orga2, LUAD-Orga3 organoids and 3 lung squamous carcinoma LUSC-Orga1, LUSC-Orga2, LUSC-Orga3 organoids for treatment, after 7 days of co-culture in the presence or absence of PENAO drug (PENAO concentration is 2 μM), the suspended cells in the culture medium are washed away, and tumor organoid tissue DNA is extracted, sequencing is performed, and the relative number of metabolic reconstruction MetaR-iNKT cell lines (iNKT-MetaR1 / R2 / R3), iNKT-MetaR1 / R2, iNKT-MetaR1 / R3, iNKT-MetaR2 / R3, iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR3, and wild-type iNKT 8 cell lines is obtained.

[0115] The results are shown in Figures 11-18 . Figures 11-16The number of tumor infiltrating cells of each iNKT cell line in each sample of lung squamous carcinoma and lung adenocarcinoma organoids is compared; Figure 17 The box plot quantitative analysis is obtained by summarizing the sample data for lung cancer organoid total sample data analysis, Figure 18 The statistical significance of MetaR-iNKT cell lines and other iNKT cell lines in lung cancer tumor sample infiltration is analyzed by using two-tailed Welch's t test.

[0116] The results show that, compared with the other 7 iNKT genetically modified cell lines and the wild-type iNKT cell line, the number of tumor infiltrating cells of the metabolic reconstruction type MetaR-iNKT cell is significantly increased in the environment with the addition of the PENAO drug, and the number of tumor infiltrating cells of the multiple combination type iNKT-MetaR1 / R2, iNKT-MetaR1 / R3 and iNKT-MetaR2 / R3 is also higher than that of iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR3 and the wild-type iNKT cell.

[0117] The present application further carries out single cell sequencing on 5 LUAD-Orga1 lung adenocarcinoma and 5 LUSC-Orga1 lung squamous carcinoma organoid samples respectively co-cultured with the metabolic reconstruction type MetaR-iNKT cell (iNKT-MetaR1 / R2 / R3), iNKT-MetaR1 / R2, iNKT-MetaR1 / R3, iNKT-MetaR2 / R3 and wild-type iNKT in the environment of the PENAO drug.

[0118] The results are shown in Figures 19-26 , Figures 19-20 The IFNγ, CD25, HLA-DR, FOXO1 and BCL2 gene expression of each infiltrating iNKT cell line in the lung adenocarcinoma organoid under the treatment of the PENAO drug; Figures 21-22 The IFNγ, CD25, HLA-DR, FOXO1 and BCL2 gene expression of each infiltrating iNKT cell line in the lung adenocarcinoma organoid without the treatment of the PENAO drug; Figures 23-24 The IFNγ, CD25, HLA-DR, FOXO1 and BCL2 gene expression of each infiltrating iNKT cell line in the lung squamous carcinoma organoid under the treatment of the PENAO drug; Figures 25-26 The IFNγ, CD25, HLA-DR, FOXO1 and BCL2 gene expression of each infiltrating iNKT cell line in the lung squamous carcinoma organoid without the treatment of the PENAO drug. The statistical significance of MetaR-iNKT cell lines and other iNKT cell lines in lung cancer tumor sample infiltration is analyzed by using two-tailed Welch's t test method.

[0119] The results showed that the expression of activation markers IFNγ, CD25, HLA-DR, cell stemness marker FOXO1, and anti-apoptotic marker BCL2 in metabolically remodeled MetaR-iNKT tumor-infiltrating cells exhibited superior cell states in both the presence and absence of PENAO drug and in both lung adenocarcinoma and lung squamous cell carcinoma conditions. The expression of IFNγ, CD25, HLA-DR, cell stemness marker FOXO1, and anti-apoptotic marker BCL2 in these cells combined the advantages of various cell lines such as MetaR1-iNKT, MetaR2-iNKT, MetaR3-iNKT, MetaR1 / 2-iNKT, MetaR1 / 3-iNKT, and MetaR2 / 3-iNKT.

[0120] (5) Seven iNKT gene-modified cell lines (2×10⁶ cells each) overexpressing iNKT-MetaR1 / R2 / R3 (metabolic remodeled MetaR-iNKT cells), iNKT-MetaR1 / R2, iNKT-MetaR1 / R3, iNKT-MetaR2 / R3, iNKT-MetaR1, iNKT-MetaR2, and iNKT-MetaR3, and wild-type iNKT cell lines were added to LUAD-Orga1, LUAD-Orga2, and LUAD-Orga3 lung adenocarcinoma and LUSC-Orga1, LUSC-Orga2, and LUSC-Orga3 lung squamous cell carcinoma organoids containing 1×10⁷ cells, respectively. After 14 days of co-culturing in a drug environment with or without PENAO (PENAO concentration of 4 μM), the suspension cells were removed, and the cells were used... The 2.0 kit (supplier Promega, catalog number G9242) is used to detect cell viability in tumor organoid tissues.

[0121] The results are as follows Figures 27-28 As shown, Figure 27 To compare the killing effects of MetaR-iNKT cells and other iNKT cells on lung cancer tumor organoids with and without PENAO drug. Figure 28 Welch's t-test was used to analyze the significance of cell viability values ​​for each iNKT cell line.

[0122] The results showed that, in all six lung cancer organoid tissues, the metabolically remodeled MetaR-iNKT cells, compared with the other six partially genetically modified iNKT cell lines and wild-type iNKT cell lines, exhibited a significantly greater synergistic killing effect on tumor cells when combined with PENAO compared to the absence of PENAO.

[0123] The foregoing description of the disclosed embodiments enables a person skilled in the art to make or use the application. Modifications of these embodiments will occur to persons of skill in the art, and that the appended claims are intended to cover all such modifications that do not depart from the true spirit and scope of the application. Therefore, the application is not limited to the embodiments shown but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A combination of protein variants for improving the immune function of iNKT cells, characterized in that, The protein variants are protein variant ANTA3, protein variant GLUT3G1, protein variant LDHB B2, protein variant PC P4 and protein variant PCK1 K2; The nucleotide sequence of the protein variant ANTA3 is shown as SEQ ID No. 1; The nucleotide sequence of the protein variant GLUT3G1 is shown as SEQ ID No. 2; The nucleotide sequence of the protein variant LDHB B2 is shown as SEQ ID No. 3; The nucleotide sequence of the protein variant PCK1 K2 is shown as SEQ ID No. 4; The nucleotide sequence of the protein variant PC P4 is shown as SEQ ID No.

5.

2. A vector combination for improving the immune function of iNKT cells, characterized by, The gene variant combination vectors are gene variant combination vector iNKT-MetaR1, gene variant combination vector iNKT-MetaR2 and gene variant combination vector iNKT-MetaR3; The gene variant combination vector iNKT-MetaR1 comprises: homologous arm 1, HS4 insulator, CMV promoter, the protein variant ANTA3 gene of claim 1, P2A, the protein variant GLUT3G1 gene of claim 1, P2A, mStayGold fluorescent reporter protein, poly(A) tail, HS4 insulator, homologous arm 2, and the nucleotide sequence is shown as SEQ ID No. 6; The gene variant combination vector iNKT-MetaR2 comprises: homologous arm 3, HS4 insulator, PGK1 promoter, the protein variant LDHB B2 gene of claim 1, P2A, the protein variant PCK1 K2 gene of claim 1, P2A, mTagBFP2 fluorescent reporter protein, poly(A) tail, HS4 insulator, homologous arm 4, and the nucleotide sequence is shown as SEQ ID No. 7; The gene variant combination vector iNKT-MetaR3 comprises: homologous arm 5, HS4 insulator, EF1ɑ core promoter, the protein variant PC P4 gene of claim 1, P2A, mScarlet fluorescent reporter protein, poly(A) tail, HS4 insulator, homologous arm 6, and the nucleotide sequence is shown as SEQ ID No. 8; The gene variant combination vector iNKT-MetaR1 corresponds to human genome CCR5 safe insertion site cutting sgRNA1, and the gene sequence of sgRNA1 is: AGGCTTCCCGCATTCAAAAT, shown as SEQ ID No. 9; The gene variant combination vector iNKT-MetaR2 corresponds to human genome chromosome 15 (15q25.3) safe insertion site cutting sgRNA2, and the gene sequence of sgRNA2 is: AAAGCTATTACACGGTTCTG, shown as SEQ ID No. 11; The gene variant combination vector iNKT-MetaR3 corresponds to the safe insertion site cutting sgRNA3 of human genome chromosome 14 (14q32.3), and the gene sequence of sgRNA3 is as follows: GTCGGGCCAGTGATCTTGTA, as shown in SEQ ID No.

13.

3. A transgenic iNKT cell, characterized in that, The cells include the gene variant combination vector iNKT-MetaR1, the gene variant combination vector iNKT-MetaR2 and the gene variant combination vector iNKT-MetaR3 according to claim 2.

4. The use of the transgenic iNKT cell of claim 3 in the preparation of a tumor immunological drug, characterized in that, The tumor is a lung cancer tumor.

Images