CRISPR-Cas-based one-tube nucleic acid detection method and corresponding product

Abstract

The invention relates to a one-tube nucleic acid detection method based on CRISPR-Cas and a corresponding product, in particular to a detection method based on Cas protein, which can realize nucleic acid amplification and detection without uncovering and adding reagents. Specifically, the invention provides a system for amplifying and detecting a target nucleic acid molecule by a one-tube method, the system comprises an isothermal amplification reagent, a Cas protein, a guide RNA, a Cas protein trans-cleavage reporter molecule, and oligonucleotide or an oligonucleotide analogue, and the oligonucleotide or the oligonucleotide analogue can be complementary with the guide RNA to form a closed guide RNA. Only oligonucleotides or oligonucleotide analogues and two sections of variable temperature conditions are used, so that the method is relatively easy to implement and can be directly adapted to the existing fluorescence detection platform.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for detecting a target nucleic acid molecule based on a one-tube method and corresponding products. Background Art

[0002] The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system is an immune system that exists naturally in bacteria and archaea. It can cut invading viruses to achieve an immune effect. In recent years, CRISPR technology has been widely used in fields such as gene editing and genome transcription regulation, and the CRISPR molecular diagnostic system is an emerging application of CRISPR technology. The CRISPR molecular diagnostic system has been successfully used in the detection of microorganisms such as viruses, bacteria, and fungi, especially in the detection of the new coronavirus, showing high accuracy and sensitivity. In addition, it can also be used for gene mutation detection, methylation detection, non-nucleic acid target detection, etc. As an emerging molecular diagnostic technology, the CRISPR molecular diagnostic system has extremely high application potential and will bring more accurate and convenient detection methods to the fields of biomedicine and disease diagnosis.

[0003] Dr. Wang Jin and others took the lead in developing the HOLMESv2 detection system based on the CRISPR one-step detection technology based on the HOLMES detection system. CRISPR one-step detection technology is a fast and convenient detection technology developed on the basis of the CRISPR molecular diagnostic system. It can simultaneously amplify and detect the target nucleic acid in one reaction tube. This technology combines the CRISPR-Cas system with isothermal amplification technology. It does not require the amplified nucleic acid product to be opened, and the target nucleic acid can be specifically detected in a short time. CRISPR one-step detection technology is a fast, accurate, highly sensitive and highly specific detection technology. It is not only easy to operate, but also can improve the detection specificity of the current isothermal amplification technology. Therefore, it is widely used in the fields of pathogenic microorganism detection. Compared with traditional PCR technology, CRISPR one-step detection does not require complex temperature control and multi-step operation, and has higher real-time and portability. Although CRISPR one-step detection technology has many advantages, as an emerging molecular diagnostic technology, it still has some disadvantages. Specifically, the Cas enzyme in the CRISPR one-step system will cut the cis-cutting substrate (target nucleic acid molecule) and primer, thereby affecting the detection sensitivity and the peak time of the fluorescence signal.

[0004] Since the CRISPR one-step detection technology has some of the above-mentioned shortcomings, it is of great significance to improve the CRISPR one-step detection technology. Recently, some scholars have developed a method based on photosensitive substances to control the activation of the CRISPR-Cas system, so as to achieve the priority of isothermal amplification in the CRISPR one-step system, and the Cas enzyme will not interfere with the isothermal amplification. The CRISPR-Cas system is subsequently activated by UV irradiation (PMCID: PMC9245704, DOI: 10.1073 / pnas.2202034119; PMID: 35762828, DOI: 10.1021 / acs.analchem.2c01193; PMID: 37016515 DOI: 10.1002 / anie.202300663, the silent oligonucleotide and the photocleavable linker (asilent oligonucleotide connected with a photocleavable linker) mentioned in the article are referred to as photocleavable sequences in this article). Although the above method can overcome some shortcomings of the current CRISPR one-step detection technology, there are still some shortcomings. For example, it is necessary to introduce an additional UV irradiation hardware template, which is not compatible with the current common fluorescence detection platform. In addition, the synthesis of the photosensitive material used is expensive, which will increase the detection cost.

[0005] Therefore, there is an urgent need in the art to develop a method that is relatively easy to implement and can be directly adapted to the existing fluorescence detection platform for simultaneous nucleic acid amplification and detection. Summary of the invention

[0006] The purpose of the present invention is to provide a method for simultaneously amplifying and detecting nucleic acids which is relatively easy to implement and can be directly adapted to an existing fluorescence detection platform.

[0007] In a first aspect of the present invention, a use of an oligonucleotide or an oligonucleotide analogue for blocking a guide RNA is provided.

[0008] In another preferred embodiment, the oligonucleotide or oligonucleotide analog does not have a photo-cleavable sequence.

[0009] The second aspect of the present invention provides a closed guide RNA, comprising:

[0010] A guide RNA, wherein the guide RNA includes a direct repeat (DR) sequence capable of binding to a Cas protein and a guide sequence capable of targeting a target sequence; and

[0011] An oligonucleotide or oligonucleotide analogue, wherein the oligonucleotide or oligonucleotide analogue is complementary to the guide RNA to form a closed guide RNA.

[0012] In another preferred embodiment, the guide RNA includes sgRNA (including tracrRNA) and crRNA.

[0013] In another preferred embodiment, the guide RNA and the oligonucleotide or oligonucleotide analog form a double-stranded molecule or a hairpin molecule.

[0014] The third aspect of the present invention provides a detection system for one-tube nucleic acid detection based on CRISPR-Cas, the system comprising:

[0015] (a) a Cas protein, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity;

[0016] (b) a guide RNA, wherein the guide RNA comprises a direct repeat (DR) sequence capable of binding to the Cas protein and a guide sequence capable of targeting a target sequence;

[0017] (c) a Cas protein trans-cleavage reporter molecule, wherein the Cas protein trans-cleavage reporter molecule comprises a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA in the system; and

[0018] (d) an oligonucleotide or an oligonucleotide analog, wherein the oligonucleotide or the oligonucleotide analog is complementary to the guide RNA to form a closed guide RNA.

[0019] In another preferred embodiment, the Cas protein is selected from the following group: type V Cas protein, type VI Cas protein or a combination thereof.

[0020] In another preferred embodiment, the type VI Cas protein is Cas13.

[0021] In another preferred example, the type VI Cas protein is selected from the following group: type VI-A Cas protein, type VI-B Cas protein, type VI-C Cas protein, type VI-D Cas protein, type VI-E Cas protein, type VI-F Cas protein, type VI-X Cas protein, type VI-Y Cas protein or a combination thereof.

[0022] In another preferred embodiment, the type VI Cas protein is selected from the following group: Cas13a, Cas13b, Cas13c, Cas13d, Cas13e, Cas13f, Cas13x, Cas13y or a combination thereof.

[0023] In some embodiments, the Cas13 protein is or is derived from the following species: Alistipes, Anaerosalibacter, Bacteroides, Bacteroidetes, Bergeyella, Blautia, Butyrivibrio, Capnocytophaga, Carnobacterium, Chloroflexus, Chryseobacterium, Clostridium, Demequina, Eubacteriaceae, Eubacterium, Flavobacterium, Fusobacterium, Herbinix, Insolitispirillum, Lachnospiraceae, Leptotrichia, Listeria, Myroides, Paludibacter, Phaeodactylibacter, Porphyromonadaceae, Porphyromonas, Prevotella, Pseudobutyrivibrio, Psychroflexus, Reichenbachiella, Rhodobacter, Riemerella, Sinomicrobium, Thalassospira, Ruminococcus; preferably, Leptotrichia shahii, Listeria seeligeri), Lachnospiraceae bacteria (such as Lb MA2020, Lb NK4A179, Lb NK4A144), Clostridium aminophilum (such as CaDSM 10710), Carnobacterium gallinarum (such as Cg DSM4847), Propionibacterium propionicigenes (such as PpWB4), Listeria weihenstephanensis (such as Lw FSL R9-0317), Listeriaceae bacterium (such as Lb FSL M6-0635), Leptotrichia wadei (such as Lw F0279), Rhodobacter capsulatus (such as Rc SB 1003, Rc R121, Rc DE442), Leptotrichia buccalis (such as Lb C-1013-b), Herbinix hemicellulosilytica, Eubacteriaceae bacterium (such as Eb CHKCI004), Blautia sp. Marseille-P2398, Leptotrichia sp.) oral taxon 879str.F0557, Chloroflexus aggregans, Demequina aurantiaca, Thalassospira sp. TSL5-1, Pseudobutyrivibrio sp. OR37, Butyrivibrio sp. YAB3001, Leptotrichia sp. Marseille-P3007, Bacteroides ihuae, Porphyromonadaceae bacterium (such as PbKH3CP3RA), Listeria riparia, Insolitispirillum peregrinum, Alistipes sp. ZOR0009, Bacteroides pyogenes (such as Bp F0041), Bacteroidetes bacterium (such as Bb GWA2_31_9), Bergeyella zoohelcum (such as Bz ATCC 43767), Capnocytophaga canimorsus, Capnocytophaga cynodegmi, Chryseobacterium carnipullorum, Chryseobacteriumjejuense), Chryseobacterium ureilyticum, Flavobacterium branchiophilum, Flavobacterium columnare, Flavobacterium sp. 316, Myroides odoratimimus (e.g., Mo CCUG 10230, Mo CCUG 12901, Mo CCUG 3837), Paludibacter propionicigenes, Phaeodactylibacter xiamenensis, Porphyromonas gingivalis (e.g., Pg F0185, Pg F0568, Pg JCVI SC001, Pg W4087), Porphyromonas gulae, Porphyromonas sp. sp.)COT-052OH4946, Prevotella aurantiaca, Prevotella buccae (such as Pb ATCC33574), Prevotella falsenii, Prevotella intermedia (such as Pi 17, PiZT), Prevotella pallens (such as Pp ATCC 700821), Prevotella pleuritidis, Prevotella saccharolytica (such as Ps F0055), Prevotella sp. MA2016, Prevotella sp. MSX73, Prevotella sp. P4-76, Prevotella sp. P5-119, Prevotella sp. sp.) P5-125, Prevotella sp. P5-60, Psychroflexus torquis, Reichenbachiella agariperforans, Riemerella anatipestifer, Sinomicrobium oceani, Fusobacterium necrophorum (such as Fnsubsp. funduliforme ATCCFunduliforme), Fusobacterium perfoetens (e.g., Fp ATCC 29250), Fusobacterium ulcerans (e.g., Fu ATCC 49185), Anaerosalibacter sp. ND1, Eubacterium siraeum, Ruminococcus flavefaciens (e.g., RfxXPD3002), Ruminococcus albus, or a combination thereof.

[0024] In another preferred embodiment, the Cas13a protein is selected from the group consisting of LwaCas13a, LbaCas13a, LshCas13a, PprCas13a, EreCas13a, LneCa13a, CamCas13a, RcaCas13a, HheCas13a, LbuCas13a, LseCas13a, LbmCas13a, LbnCas13a, RcsCas13a, RcrCas13a, RcdCas13a, CgCas13a, Cg2Cas13a, LweCas13a, LbfCas13a, Lba4Cas13a, Lba9Cas13a, LneCas13a, HheCas13a, RcaCas13a, TccCas13a (from article PMID: 35763567PMCID: PMC9282225 DOI:10.1073 / pnas.2118260119), or a combination thereof.

[0025] In another preferred embodiment, the Cas13a protein is selected from the following species: Bacteroides, Blautia, Butyrivibrio, Carnobacterium, Chloroflexus, Clostridium, Demequina, Eubacterium, Herbinix, Insolitispirillum, Lachnospiraceae, Leptot richia), Listeria, Paludibacter, Porphyromonadaceae, Pseudobutyrivibrio, Rhodobacter or Thalassospira; preferably, Leptotrichia shahii, Listeria seeligeri, Lachnospiraceae bacteria (such as Lb MA2020, Lb NK4A179, LbNK4A144, Clostridium aminophilum (such as CaDSM 10710), Carnobacterium gallinarum (such as Cg DSM 4847), Paludibacter propionicigenes (such as Pp WB4), Listeria weihenstephanensis (such as Lw FSL R9-0317), Listeriaceaebacterium (such as Lb FSL M6-0635), Leptotrichiawadei (such as Lw F0279), Rhodobacter capsulatus (such as Rc SB 1003, Rc R121, RcDE442), Leptotrichia buccalis (such as Lb C-1013-b), Herbinix hemicellulosilytica, Eubacteriaceae bacterium (such as Eb CHKCI004), Blautia sp. Marseille-P2398, Leptotrichia sp.) Oral taxon 879str.F0557, Chloroflexus aggregans, Demequina aurantiaca, Thalassospira sp. TSL5-1, Pseudobutyrivibrio sp. OR37, Butyrivibrio sp. YAB3001, Leptotrichias sp. Marseille-P3007, Bacteroides ihuae, Porphyromonadaceae bacterium (such as PbKH3CP3RA), Listeria riparia, Insolitispirillum peregrinum, Thermoclostridium caenicola, or a combination thereof. .

[0026] In another preferred embodiment, the Cas13b is selected from the following group: Cas13b-t1, Cas13b-t2, Cas13b-t3, Cas13b-t4, Cas13b-t5, Cas13b-t6 or a combination thereof.

[0027] In another preferred embodiment, the Cas13b is selected from the following group: BzCas13b, PbCas13b, PspCas13b, RanCas13b, PguCas13b, PsmCas13b, CcaCas13b, AspCas13b, PauCas13b, Pin2Cas13b, Pin3Cas13b or a combination thereof.

[0028] In another preferred embodiment, the Cas13b is or is derived from the following species: Alistipes, Bacteroides, Bacteroidetes, Bergeyella, Capnocytophaga, Chryseobacterium, Flavobacterium, Myroides, Paludibacter, Phaeodactylibacter, Porphyromonas, Prevotella, Psychroflexus, Reichenbachiella, Riemerella or Sinomicrobium; preferably, Alistipes sp. ZOR0009, Bacteroides pyogenes (such as Bp F0041), Bacteroidetes bacterium (such as BbGWA2_31_9), Bergeyella zoohelcum (such as Bz ATCC 43767), Capnocytophaga canimorsus, Capnocytophaga cynodegmi, Chryseobacterium carnipullorum, Chryseobacterium jejuense, Chryseobacterium ureilyticum, Flavobacterium branchiophilum, Flavobacterium columnare, Flavobacterium sp.)316, Myroides odoratimimus (such as Mo CCUG 10230, Mo CCUG12901, Mo CCUG 3837), Paludibacter propionicigenes, Phaeodactylibacter xiamenensis, Porphyromonas gingivalis (such as Pg F0185, Pg F0568, PgJCVI SC001, Pg W4087), Porphyromonas gulae, Porphyromonas sp. COT-052OH4946, Prevotella aurantiaca, Prevotella buccae (such as Pb ATCC 33574), Prevotella falsenii, Prevotella intermedia (such as Pi 17, Pi ZT), Prevotella pallens (such as Pp ATCC 700821), Prevotella pleuritidis, Prevotella saccharolytica (such as Ps F0055), Prevotella sp. MA2016, Prevotella sp. MSX73, Prevotella sp. P4-76, Prevotella sp. P5-119, Prevotella sp. P5-125, Prevotella sp. P5-60, Psychroflexus torquis, Reichenbachiella agariperforans, Riemerella anatipestifer, Sinomicrobium oceani or a combination thereof.

[0029] In another preferred embodiment, the Cas13c protein is or is derived from the following species: Fusobacterium or Anaerosalibacter; preferably, Fusobacterium necrophorum (such as Fn subsp. funduliforme ATCC 51357, Fn DJ-2, FnBFTR-1, Fn subsp. Funduliforme), Fusobacterium perfoetens (such as Fp ATCC29250), Fusobacterium ulcerans (such as Fu ATCC 49185), Anaerosalibacter sp. ND1 or a combination thereof.

[0030] In another preferred example, the Cas13d is selected from the following group: RspCas13d, RfxCas13d, EsCas13d, AdmCas13d or a combination thereof.

[0031] In another preferred embodiment, the Cas13d is derived from the following species: Eubacterium or Ruminococcus, preferably Eubacterium siraeum, Ruminococcus flavefaciens (such as Rfx XPD3002), Ruminococcus albus or a combination thereof.

[0032] In another preferred example, the Cas protein is a V-type Cas protein; or the Cas protein is a Cas protein with a RuvC structure at the C-terminus.

[0033] In another preferred example, the V-type Cas protein is Cas12 or the Cas protein with a RuvC structure at the C-terminus is Cas12.

[0034] In another preferred embodiment, the V-type Cas protein is selected from the group consisting of a VA-type Cas protein, a VB-type Cas protein, a VC-type Cas protein, a VD-type Cas protein, a VE-type Cas protein, a VF-type Cas protein, a VG-type Cas protein, a VH-type Cas protein, a VI-type Cas protein, a VJ-type Cas protein, a VL-type Cas protein, a VM-type Cas protein, or a combination thereof;

[0035] Alternatively, the V-type Cas protein is selected from the group consisting of Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12l, Cas12m, or a combination thereof;

[0036] In another preferred embodiment, the Cas12a is selected from the group consisting of FnCas12a, LbCas12a, ErCas12a, Evcas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, CeCas12a, PrCas12a, CsbCas12a, BhCas12a, SsCas12a 2a, Lb3Cas12a, BpCas12a, PdCas12a, BfCas12a, PcCas12a, cMtCas12a, PeCas12a, LiCas12a, Lb2Ca s12a, PmCas12a, MbCas12a, EeCas12a, CsbCas12a, ArCas12a, BsCas12a, AbCas12a, AsCas12a, or combinations thereof.

[0037] In another preferred embodiment, the source of Cas12a is selected from the group consisting of Leptotrichia, Listeria, Corynebacterium, Sutterella, Legionella, Treponema, Linebacteria, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Azospirillum, Sphaerochaeta, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, Lachnospira, or a combination thereof.

[0038] In another preferred embodiment, the source of Cas12a is selected from the following group: Francisella tularensis (FnCas12a), Acidaminococcus sp. BV3L6 (Acidaminococcus sp. BV3L6) (AsCas12a), Lachnospiraceae bacterium ND2006 (LbCas12a), Lachnospiraceae bacterium NC2008 (Lb5Cas12a), Helcococcus sp kunzii (HkCas12a), Oribacterium sp. NK2B42 (OsCas12a), Thiomicrospira sp. XS5 (TsCas12a), Bacteroides KA00251 (Bacteroidales bacterium KA00251) (BbCas12a), Bacteroidetes oral taxon 274)(BoCas12a), Lachnospiraceaebacterium MC2017(Lb4Cas12a), Coprococcus eutactus(CeCas12a), Prevotella ruminicola strain BPI-34(PrCas12a), CandidatusSaccharibacteria bacterium(CsbCas12a), Butyrivibrio hungateistrain MB2003(BhCas12a), Smithella sp.SC_K08D17)(SsCas12a), Lachnospiraceae bacterium MC2017(Lb3Cas12a), Bytyrivibrio proteoclasticus(BpCas12a), Prevotelladisens(PdCas12a), Butyrivibrio fibrisolvens MD2001(BfCas12a), Porphyromonas crevioricanis(PcCas12a), CandidatusMethanoplasma termitum(CMtCas12a), Peregrinibacteria bacterium(PeCas12a), Leptospira inadaiserovar Lyme(LiCas12a), Lachnospiraceae bacterium MA2020(Lachnospiraceae bacterium MA2020)(Lb2Cas12a), Porphyromonas macaca(PmCas12a), Moraxella bovoculi237(MbCas12a), Eubacterium eligens(EeCas12a), Candidatus Saccharibacteria bacterium(CsbCas12a), Eubacterium rectal(ErCas12a), Agathobacter rectalis strain(ArCas12a), Butyrivibrio sp. NC3005(BsCas12a), Arcobacter butzleri(AbCas12a), or a combination thereof. .

[0039] In another preferred embodiment, the source of Cas12b is selected from the following group: Alicyclobacillus kakegawensis, Bacillus V3-13, Bacillushisashii, Lentisphaeria bacterium, Laceyella sediminis or a combination thereof.

[0040] In another preferred example, the Cas12b is selected from the following group: AapCas12b, AacCas12b, AaCas12b, BthCas12b, AkCas12b, AmCas12b, Bs3Cas12b, LsCas12b, BrCas12b or a combination thereof.

[0041] In another preferred embodiment, the oligonucleotide or oligonucleotide analog has a length of 5-50 nt, preferably 15-30 nt, and more preferably 10-20 nt.

[0042] In another preferred embodiment, when the target nucleic acid molecule exists in the system and the temperature of the system matches the reaction temperature of the amplification reaction (meaning that the temperature of the system is within the reaction temperature range of the amplification reaction, including the range boundary of the reaction temperature), the oligonucleotide or oligonucleotide analog is complementary to the guide RNA to form a closed guide RNA, and an amplification reaction of the target nucleic acid molecule is carried out in the system.

[0043] In another preferred embodiment, when the target nucleic acid molecule is present in the system and the system temperature matches the active temperature of the Cas protein (referring to the system temperature being within the active temperature range of the Cas protein, including the range boundary of the reaction temperature, and the system temperature is higher than the system temperature during the amplification reaction by heating), the oligonucleotide or oligonucleotide analog is unzipped from the guide RNA, and the target nucleic acid molecule is detected in the system.

[0044] In another preferred embodiment, the target sequence comprises a DNA or RNA target derived from a plant, an animal, an insect, a microorganism, a virus, or a combination thereof.

[0045] In another preferred embodiment, the target sequence is from a nucleic acid molecule selected from the following groups: a nucleic acid molecule of a pathogenic microorganism, a nucleic acid molecule of a gene mutation, a specific target nucleic acid molecule, or a combination thereof.

[0046] In another preferred embodiment, the target sequence is from a target gene selected from the group consisting of: virus, bacteria, Chlamydia, Mycoplasma, or a combination thereof.

[0047] In another preferred embodiment, the bacteria include but are not limited to the following group: Group B Streptococcus, Bacillus anthracis, Salmonella typhi, Yersinia pestis or a combination thereof.

[0048] In another preferred embodiment, the virus is selected from the following group: plant virus, animal virus, or a combination thereof.

[0049] In another preferred embodiment, the virus includes but is not limited to the following group: poxvirus (for example, smallpox, vaccinia virus, cowpox virus, monkeypox virus, aphthous stomatitis virus, pseudocowpox virus, bovine papular stomatitis virus, Tenapox virus, Yaba monkey tumor virus, molluscum contagiosum virus (MCV)), Geminiviridae, Cynomorviridae, Phycodnaviridae, astrovirus, arenavirus, filovirus, etc. or a combination thereof.

[0050] In another preferred embodiment, the virus is monkeypox virus.

[0051] In another preferred embodiment, the target sequence is derived from a DNA or RNA target.

[0052] In another preferred embodiment, the target sequence is an artificially synthesized or naturally occurring nucleic acid.

[0053] In another preferred embodiment, the target sequence includes a wild-type or mutant nucleic acid.

[0054] In another preferred example, the DNA target includes DNA formed based on RNA reverse transcription.

[0055] In another preferred embodiment, the DNA target includes cDNA.

[0056] In another preferred embodiment, the DNA target is selected from the following group: single-stranded DNA, double-stranded DNA, or a combination thereof.

[0057] In another preferred example, the RNA target includes RNA formed based on DNA transcription.

[0058] In another preferred embodiment, the Cas protein trans-cleavage reporter molecule includes a molecule selected from the following group: a single-stranded nucleic acid molecule, a single-stranded nucleic acid analog molecule; preferably, the single-stranded nucleic acid molecule, the single-stranded nucleic acid analog molecule is a hairpin structure or a linear structure.

[0059] In another preferred embodiment, the single-stranded nucleic acid molecule is selected from the following group: an unmodified single-stranded nucleic acid molecule, a modified single-stranded nucleic acid molecule, a single-stranded nucleic acid molecule containing an abasic spacer, or a combination thereof.

[0060] In another preferred embodiment, the Cas protein trans-cleavage reporter molecule is selected from the following group: a reporter molecule based on gold nanoparticles, a reporter molecule based on fluorophores, a reporter molecule based on fluorescence polarization, a reporter molecule based on colloidal phase change / dispersion, a reporter molecule based on electrochemical signals, a reporter molecule based on semiconductor signals, and a color-based reporter molecule.

[0061] In another preferred embodiment, the Cas protein trans-cleavage reporter molecule is a nucleic acid probe.

[0062] In another preferred embodiment, the nucleic acid probe carries a detectable label.

[0063] In another preferred embodiment, the detectable label includes a fluorescent group and a quencher group.

[0064] In another preferred embodiment, the fluorescent group is selected from the following group: FAM, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200, NED, Atto 425, Quasar 670, or a combination thereof.

[0065] In another preferred embodiment, the quenching group is selected from the following group: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse, MGB, or a combination thereof.

[0066] In another preferred embodiment, the fluorescent group and the quenching group are independently located at the 5' end, 3' end and the middle of the nucleic acid of the nucleic acid probe trans-cleaved by the Cas protein.

[0067] In another preferred embodiment, the single-stranded nucleic acid molecule or single-stranded nucleic acid analog molecule in the Cas protein trans-cleavage reporter molecule is a linear structure with a length of 5-50nt, preferably 15-30nt, and more preferably 5-10nt; or the single-stranded nucleic acid molecule or single-stranded nucleic acid analog molecule in the Cas protein trans-cleavage reporter molecule is a hairpin structure with a length of 15-100nt, preferably 20-50nt, and more preferably 20-40nt.

[0068] In another preferred embodiment, the nucleic acid probe includes single-stranded DNA or single-stranded RNA.

[0069] In another preferred embodiment, the nucleic acid probe comprises single-stranded DNA or single-stranded RNA with a detectable label.

[0070] In another preferred embodiment, the single-stranded DNA is single-stranded DNA or single-stranded RNA labeled with fluorescence and biotin.

[0071] In another preferred embodiment, the single-stranded DNA is fluorescently labeled single-stranded DNA or single-stranded RNA.

[0072] In another preferred embodiment, the guide RNA is 30-200 nt in length.

[0073] In another preferred embodiment, when the Cas protein is Cas12a, the guide RNA is crRNA with a length of 30-80nt, preferably 35-45nt, and more preferably 39-41nt.

[0074] In another preferred embodiment, when the Cas protein is Cas12b, the guide RNA is sgRNA with a length of 80-150nt, preferably 90-120nt, and more preferably 101-111nt.

[0075] In another preferred embodiment, when the Cas protein is Cas13a, the guide RNA is crRNA with a length of 40-80nt, preferably 50-70nt, and more preferably 60-65nt.

[0076] In another preferred embodiment, the detection includes: qualitative detection or quantitative detection.

[0077] In another preferred embodiment, the system further contains (e) a buffer solution.

[0078] In another preferred embodiment, the system further contains a target nucleic acid molecule to be detected.

[0079] In another preferred embodiment, the system further contains components or reagents for isothermal amplification reaction of target sequences.

[0080] In another preferred embodiment, the isothermal amplification or target sequence isothermal amplification reaction is selected from the following group: LAMP (Loop-mediated isothermal Amplification), RPA (Recombinase Polymerase Amplification), LCR (Ligase Chain Reaction), bDNA (branched DNA Amplification), NASBA (Nuclear Acid Sequence-Based Amplification), SDA (Strand Displacement Amplification), TMA (Transcription-Mediated Amplification), RCA (Rolling Circle Amplification), HDA (Helicase-Dependent Amplification), SPIA (Single Primer Isothermal Amplification), NEAR (Nicking Enzyme Amplification Reaction), SMAP (Smart Amplification Process, smart amplification method), SMAP2 (Smart Amplification Process version2), CPA (Cross Priming Amplification), MDA (Multiple Displacement Amplification), RAM (Ramification), cHDA (circular Helicase-Dependent Amplification,Helicase-dependent circular amplification), SMART (Signal Mediated Amplification of RNA Technology), 3SR (Self-Sustained Sequence Replication), GEAR (Genome Exponential Amplification Reaction), IMDA (Isothermal Multiple Displacement Amplification), ERA (Enzymatic Recombinase Amplification), TAS (Transcription-based amplification system), RIDA (Rapid isothermal detection and amplification), NEMA (nicking enzyme mediated isothermal amplification), EXPAR (Exponential Isothermal Amplification Reaction), ICAN (Isothermal and chimeric primer-initiated amplification of nucleic acids), SEA (Strand exchange amplification, strand exchange amplification), SHARP (SSB-Helicase Assisted Rapid PCR, SSB-helicase-mediated rapid PCR) or a combination thereof.

[0081] In another preferred embodiment, the concentration of the target sequence in the system is 0.01-10 8 The amount of the nucleic acid in the present invention is 0.1-100 copies / microliter, preferably 0.1-10 copies / microliter.

[0082] In another preferred embodiment, the concentration of the target nucleic acid molecule to be detected in the detection system is 0.01-10 8 The amount of the nucleic acid in the present invention is 0.1-100 copies / microliter, preferably 0.1-10 copies / microliter.

[0083] In another preferred embodiment, the concentrations of Cas protein, guide RNA, Cas protein trans-cleavage reporter molecule, oligonucleotide or oligonucleotide analog are each independently 25nM-5000nM, preferably 100nM-2500nM, and more preferably 200nM-1000nM.

[0084] In another preferred embodiment, the system further comprises:

[0085] (d1) a polymerase for amplifying a target sequence, including a DNA polymerase with strand displacement activity;

[0086] (d2) optionally a reverse transcriptase for reverse transcription;

[0087] (d3) optionally a transcriptase for transcription;

[0088] (d4) optionally a recombinase;

[0089] (d5) optionally a single-chain binding protein;

[0090] (d6) optionally a recombinant regulatory protein;

[0091] (d7) optionally a nicking endonuclease;

[0092] (d8) optionally RNase H;

[0093] (d9) optionally a helicase;

[0094] (d10) dNTPs for amplification reaction and / or reverse transcription reaction;

[0095] (d11) NTPs used in transcription reaction.

[0096] In another preferred embodiment, the molar concentration ratio between the guide RNA and the oligonucleotide or oligonucleotide analog is in the range of 1:1-1:100.

[0097] A fourth aspect of the present invention provides a CRISPR-Cas-based one-tube nucleic acid detection kit, the kit comprising:

[0098] (i) a first container and a Cas protein located in the first container, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity;

[0099] (ii) a second container and a guide RNA located in the second container, wherein the guide RNA comprises a direct repeat (DR) sequence capable of binding to the Cas protein and a guide sequence capable of targeting a target sequence;

[0100] (iii) a third container and a Cas protein trans-cleavage reporter molecule located in the third container, wherein the Cas protein trans-cleavage reporter molecule comprises a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA in the system; and

[0101] (iv) a fourth container and an oligonucleotide or oligonucleotide analog located in the fourth container, wherein the oligonucleotide or oligonucleotide analog is complementary to the guide RNA to form a closed guide RNA;

[0102] and labels or instructions.

[0103] In another preferred embodiment, the label or instructions state the following:

[0104] (i) when the target nucleic acid molecule is present in the detection system and the temperature of the system matches the reaction temperature of the amplification reaction (meaning that the temperature of the system is within the reaction temperature range of the amplification reaction, including the boundary of the reaction temperature range), the oligonucleotide or oligonucleotide analog is complementary to the guide RNA to form a closed guide RNA, and an amplification reaction of the target nucleic acid molecule is performed in the detection system;

[0105] (ii) When the target nucleic acid molecule is present in the detection system and the system temperature matches the active temperature of the Cas protein (the system temperature is within the active temperature range of the Cas protein, including the range boundary of the reaction temperature, and the system temperature is higher than the system temperature during the amplification reaction by heating), the oligonucleotide or oligonucleotide analog is unzipped from the guide RNA, and the target nucleic acid molecule is detected in the detection system.

[0106] In another preferred embodiment, the kit further comprises:

[0107] (v) a fifth container and a target nucleic acid molecule in the fifth container.

[0108] In another preferred embodiment, the kit further comprises:

[0109] (vi) a sixth container and components or reagents located in the sixth container for an isothermal amplification reaction of a target sequence in a target nucleic acid molecule.

[0110] In another preferred embodiment, the kit further comprises:

[0111] (vii) a seventh container and a buffer solution in the seventh container.

[0112] In another preferred embodiment, the target nucleic acid molecule is a target DNA and / or a target RNA.

[0113] In another preferred embodiment, any two, three, or four (or all) of the first container, the second container, the third container, and the fourth container may be the same (identical) or different containers.

[0114] In another preferred embodiment, any two or three (or all) of the fifth container, the sixth container, and the seventh container may be the same (identical) or different containers.

[0115] In another preferred embodiment, two, more or all of the first to seventh containers may be the same container or different containers.

[0116] A fifth aspect of the present invention provides a one-tube nucleic acid detection method based on CRISPR-Cas, comprising the following steps:

[0117] i) contacting the sample to be detected with the system as described in the third aspect of the present invention, and performing an amplification reaction of the target nucleic acid molecule at the first system temperature;

[0118] ii) performing trans-cleavage at the temperature of system II, detecting the detectable signal generated by the trans-cleavage of the reporter molecule by the Cas protein in the system, thereby detecting the target nucleic acid molecule.

[0119] In another preferred embodiment, the temperature of the first system matches the reaction temperature of the amplification reaction.

[0120] In another preferred embodiment, the temperature of the first system is 30°C-70°C, preferably, 37°C-42°C.

[0121] In another preferred embodiment, the temperature of the second system matches the active temperature of the Cas protein.

[0122] In another preferred embodiment, the temperature of the system II is 37°C-70°C, preferably, 48°C-60°C.

[0123] In another preferred embodiment, the sample to be detected includes a non-amplified sample.

[0124] In another preferred embodiment, the sample is derived from a non-cultured sample or a sample obtained by a culture method selected from the group consisting of cell culture, bacterial culture, virus culture, fungal culture, microbial culture, organoid culture, animal in vivo enrichment culture and plant culture.

[0125] In another preferred embodiment, the method is used to detect whether the nucleic acid at the target site has a SNP, a point mutation, a deletion, and / or an insertion.

[0126] In another preferred embodiment, the detection in step (ii) includes fluorescence detection method and colloidal gold method.

[0127] In another preferred embodiment, the detection in step (ii) includes a detection method based on gold nanoparticles, a detection method based on fluorophores, a detection method based on fluorescence polarization, a detection method based on colloidal phase change / dispersion, a detection method based on electrochemical signals, a detection method based on semiconductor signals, and a color-based detection method.

[0128] In another preferred embodiment, the fluorescence detection method is performed using an enzyme reader or a fluorescence spectrophotometer.

[0129] In another preferred embodiment, the method is an in vitro method.

[0130] In another preferred embodiment, the method is a one-tube two-stage method.

[0131] In another preferred embodiment, the method is non-disease diagnostic and non-disease therapeutic.

[0132] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0133] Figure 1 Schematic diagram of the one-tube two-stage detection principle based on CRISPR-Cas.

[0134] Figure 2 is a schematic diagram of the structure of a closed guide RNA, where Figure 2 a is a double-stranded molecule (a closed guide RNA in double-stranded form), Figure 2 b is a hairpin molecule (a closed guide RNA in the form of a hairpin).

[0135] Figure 3 The results of the GBS RAA / Cas12b one-tube two-stage method detection in Example 1 are shown.

[0136] Figure 4 The results of the MPX RAA / Cas12b one-tube two-stage method detection in Example 2 are shown.

[0137] Figure 5 The results of the oligo screening test of the MPX RAA / Cas12b one-tube two-stage method for detecting blocked guide RNA (sgRNA) or crRNA in Example 3 are shown.

[0138] Figure 6 The detection results of the CRISPR-Cas one-tube two-stage method system based on guide RNA fusion oligo (ie, the closed guide RNA is a hairpin molecule) in Example 4 are shown.

[0139] Figure 7 The test results of the CRISPR-Cas one-tube two-stage system under constant temperature conditions in Comparative Example 1 are shown. DETAILED DESCRIPTION

[0140] After extensive and in-depth research, the inventors have developed for the first time a method that can amplify and detect target nucleic acid molecules in one system without opening the lid to add reagents, named "one tube two-stage method". Figure 1 , Figure 2 Specifically, the present invention introduces a segment of oligo (referring to oligonucleotide or oligonucleotide analog, the same below) under the system temperature condition matching the isothermal amplification reaction temperature to block the guide RNA (guide RNA) to form a closed guide RNA, so that the isothermal amplification reaction can be carried out preferentially, and at the same time, the Cas protein with an active temperature higher than the system temperature during the isothermal amplification reaction is selected to participate in the reaction, and then the system temperature is increased by heating to melt the oligo and the guide RNA, thereby forming a ternary complex of Cas protein-guide RNA-cis-cutting substrate, cutting the Cas protein trans-cutting reporter molecule, and performing the detection function. The guide RNA, and the oligonucleotide or oligonucleotide analog form a double-stranded molecule or a hairpin molecule.

[0141] The present invention is designed to separate the isothermal amplification and the Cas protein enzymatic activity into two stages, so the Cas protein will not take the lead in cutting the cis-cutting substrate (and the trans-cutting reporter molecule), so as not to affect the sensitivity of the detection. Another advantage of the present invention is that the system does not require large-scale screening and testing, and the guide RNA and the ion concentration in the system can be used without large-scale screening, which greatly facilitates the establishment of the CRISPR one-tube system. In addition, the present invention only uses oligo and two-stage variable temperature conditions, which is relatively easy to implement, can be directly adapted to the existing fluorescence detection platform, and there is no need to open the lid during the one-tube detection process, which simplifies the experimental operation process and avoids the risk of aerosol cross-contamination of amplified products during the detection process. On this basis, the inventors have completed the present invention.

[0142] the term

[0143] Unless defined otherwise, technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0144] The term "oligonucleotide" refers to a sequence containing 5-50 nucleotides, preferably 15-30 nucleotides, more preferably 10-20 nucleotides, preferably ribonucleotides for type V Cas proteins, and preferably deoxyribonucleotides for type VI Cas proteins; oligonucleotides also include modified oligonucleotides, such as: base site modifications include 2-thiouridine, N6-methyladenosine, Pseudouridine, abasic, etc.; ribose site modifications include 2'-OMe, 2'-F, 2'-NH2, LNA, etc.; backbone site modifications include Phosphorothioate, Boranophosphate, etc. In addition, RNA / DNA chimeric structures are also included. The selected oligonucleotide itself cannot activate the guide RNA as a substrate.

[0145] The term "oligonucleotide analog" refers to a sequence containing 5-50 monomers, preferably 15-30 monomers, and more preferably 10-20 monomers. The term "oligonucleotide analog" includes sequences that are partially nucleotide analogs, and also includes sequences that are all nucleotide analogs, that is, the monomers in the oligonucleotide analogs can all be nucleotide analogs, or partially be nucleotide analogs, and the rest are ribonucleotides and (or) deoxynucleotides. For type V Cas proteins, ribonucleotides are preferred, and for type VI Cas proteins, deoxyribonucleotides are preferred; oligonucleotide analogs also include modified oligonucleotide analogs, such as: base site modifications include 2-thiouridine, N6-methyladenosine, Pseudouridine, abasic, etc.; ribose site modifications include 2'-OMe, 2'-F, 2'-NH2, LNA, etc.; backbone site modifications include Phosphorothioate, Boranophosphate, etc. The selected oligonucleotide analogs themselves cannot activate the guide RNA as a substrate.

[0146] As used herein, the "CRISPR" refers to Clustered regularly interspaced short palindromic repeats, which are derived from the immune system of microorganisms.

[0147] As used herein, "biotin" is also called vitamin H, which is a small molecule vitamin with a molecular weight of 244 Da. The extremely strong affinity of biotin can be used to amplify or enhance the detection signal in the detection system. For example, biotin can easily bind to proteins (such as antibodies, etc.) by covalent bonds, and the avidin molecules bound to the enzyme react with the biotin molecules bound to the specific antibody, which not only plays a multi-stage amplification role, but also produces color due to the catalytic effect of the enzyme when it encounters the corresponding substrate, thereby achieving the purpose of detecting unknown antigen (or antibody) molecules.

[0148] CRISPR-Cas: A unique genomic element derived from bacteria and archaea that serves as an adaptive immune defense system to resist invading phages or foreign nucleic acids. The system consists of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (abbreviated as Cas proteins, Cas).

[0149] The term "Cas protein" refers to CRISPR-associated protein, which is the associated protein in the CRISPR system.

[0150] The term "Cas12a" (formerly known as "Cpf1") refers to a crRNA-dependent endonuclease, which is a type VA enzyme in the CRISPR system classification.

[0151] The terms "Cas12b" and "C2c1" are used interchangeably and refer to the sgRNA-dependent endonuclease, which is a type VB enzyme in the CRISPR system classification.

[0152] The term "PAM" refers to the protospacer-adjacent motif, which is a short DNA sequence directly adjacent to the DNA sequence targeted by the CRISPR effector protein and is required for Cas12a or Cas12b to cut double-stranded DNA. For example, the PAM of Cas12a is TTTV, and the PAM of AacCas12b is the TTN sequence.

[0153] The term "target DNA or RNA molecule" refers to the DNA or RNA to be detected or a specific portion thereof when the molecule to be detected is a nucleic acid molecule; when the molecule to be detected is a non-nucleic acid molecule, the target DNA or RNA molecule is a pre-designed nucleic acid sequence.

[0154] The term "blocked guide RNA" refers to the introduction of an oligo (referring to an oligonucleotide or an oligonucleotide analog) to complementarily pair with the guide RNA under system temperature conditions that match the isothermal amplification reaction temperature, so that the guide RNA cannot perform its normal function. The position of the oligo blocking the guide RNA can only block all or part of the spacer, or can only block all or part of the rest outside the spacer, as long as it can ensure that the trans-cutting activity is stimulated after the guide RNA and Cas protein are blocked from binding, and the trans-cutting activity of the Cas protein can be restored after the temperature is raised.

[0155] system

[0156] It should be understood in a broad sense and may be a composition, product combination, reagent, kit, or an instrument containing the aforementioned composition, product combination, reagent, kit, or a mixture formed when the composition, product combination, reagent, kit is used for detection, as well as an instrument containing the aforementioned mixture, etc.

[0157] System temperature

[0158] The system temperature refers to the temperature of the system (the mixture formed during the test).

[0159] Cas proteins

[0160] The "Cas protein" described herein refers to a CRISPR-related protein (some documents are translated as CRISPR-Cas effector protein, CRISPR / Cas effector protein, CRISPR-Cas effector, CRISPR / Cas effector), which can be a V-type Cas protein or a VI-type Cas protein. Once the V-type Cas protein binds to the cis-cleavage substrate under the guidance of the guide RNA to form a ternary complex of Cas protein-guide RNA-cis-cleavage substrate, it can induce its trans-cleavage activity, that is, randomly cleave single-stranded nucleic acids and their equivalents (nucleic acid equivalents such as nucleic acid analogs).

[0161] The Cas protein described in this specific embodiment is a protein with trans-cleavage activity. In particular, it is a Cas protein that is still active, especially trans-cleavage activity, at a temperature higher than the system temperature for isothermal amplification reaction.

[0162] The type VI Cas protein is Cas13.

[0163] The type VI Cas protein is selected from the following group: type VI-A Cas protein, type VI-B Cas protein, type VI-C Cas protein, type VI-D Cas protein, type VI-E Cas protein, type VI-F Cas protein, type VI-X Cas protein, type VI-Y Cas protein or a combination thereof.

[0164] The type VI Cas protein is selected from the group consisting of Cas13a, Cas13b, Cas13c, Cas13d, Cas13e, Cas13f, Cas13x, Cas13y or a combination thereof.

[0165] In some embodiments, the Cas13 protein is or is derived from the following species: Alistipes, Anaerosalibacter, Bacteroides, Bacteroidetes, Bergeyella, Blautia, Butyrivibrio, Capnocytophaga, Carnobacterium, Chloroflexus, Chryseobacterium, Clostridium, Demequina, Eubacteriaceae, Eubacterium, Flavobacterium, Fusobacterium, Herbinix, Insolitispirillum, Lachnospiraceae, Leptotrichia, Listeria, Myroides, Paludibacter, Phaeodactylibacter, Porphyromonadaceae, Porphyromonas, Prevotella, Pseudobutyrivibrio, Psychroflexus, Reichenbachiella, Rhodobacter, Riemerella, Sinomicrobium, Thalassospira, Ruminococcus; preferably, Leptotrichia shahii, Listeria seeligeri), Lachnospiraceae bacteria (such as Lb MA2020, Lb NK4A179, Lb NK4A144), Clostridium aminophilum (such as CaDSM 10710), Carnobacterium gallinarum (such as Cg DSM4847), Propionibacterium propionicigenes (such as PpWB4), Listeria weihenstephanensis (such as Lw FSL R9-0317), Listeriaceae bacterium (such as Lb FSL M6-0635), Leptotrichia wadei (such as Lw F0279), Rhodobacter capsulatus (such as Rc SB 1003, Rc R121, Rc DE442), Leptotrichia buccalis (such as Lb C-1013-b), Herbinix hemicellulosilytica, Eubacteriaceae bacterium (such as Eb CHKCI004), Blautia sp. Marseille-P2398, Leptotrichia sp.) oral taxon 879str.F0557, Chloroflexus aggregans, Demequina aurantiaca, Thalassospira sp. TSL5-1, Pseudobutyrivibrio sp. OR37, Butyrivibrio sp. YAB3001, Leptotrichia sp. Marseille-P3007, Bacteroides ihuae, Porphyromonadaceae bacterium (such as PbKH3CP3RA), Listeria riparia, Insolitispirillum peregrinum, Alistipes sp. ZOR0009, Bacteroides pyogenes (such as Bp F0041), Bacteroidetes bacterium (such as Bb GWA2_31_9), Bergeyella zoohelcum (such as Bz ATCC 43767), Capnocytophaga canimorsus, Capnocytophaga cynodegmi, Chryseobacterium carnipullorum, Chryseobacteriumjejuense), Chryseobacterium ureilyticum, Flavobacterium branchiophilum, Flavobacterium columnare, Flavobacterium sp. 316, Myroides odoratimimus (e.g., Mo CCUG 10230, Mo CCUG 12901, Mo CCUG 3837), Paludibacter propionicigenes, Phaeodactylibacter xiamenensis, Porphyromonas gingivalis (e.g., Pg F0185, Pg F0568, Pg JCVI SC001, Pg W4087), Porphyromonas gulae, Porphyromonas sp. sp.)COT-052OH4946, Prevotella aurantiaca, Prevotella buccae (such as Pb ATCC33574), Prevotella falsenii, Prevotella intermedia (such as Pi 17, PiZT), Prevotella pallens (such as Pp ATCC 700821), Prevotella pleuritidis, Prevotella saccharolytica (such as Ps F0055), Prevotella sp. MA2016, Prevotella sp. MSX73, Prevotella sp. P4-76, Prevotella sp. P5-119, Prevotella sp. sp.) P5-125, Prevotella sp. P5-60, Psychroflexus torquis, Reichenbachiella agariperforans, Riemerella anatipestifer, Sinomicrobium oceani, Fusobacterium necrophorum (such as Fnsubsp. funduliforme ATCCFunduliforme), Fusobacterium perfoetens (e.g., Fp ATCC 29250), Fusobacterium ulcerans (e.g., Fu ATCC 49185), Anaerosalibacter sp. ND1, Eubacterium siraeum, Ruminococcus flavefaciens (e.g., RfxXPD3002), Ruminococcus albus, or a combination thereof.

[0166] In another preferred embodiment, the Cas13a protein is selected from the group consisting of LwaCas13a, LbaCas13a, LshCas13a, PprCas13a, EreCas13a, LneCa13a, CamCas13a, RcaCas13a, HheCas13a, LbuCas13a, LseCas13a, LbmCas13a, LbnCas13a, RcsCas13a, RcrCas13a, RcdCas13a, CgCas13a, Cg2Cas13a, LweCas13a, LbfCas13a, Lba4Cas13a, Lba9Cas13a, LneCas13a, RcaCas13a, and TccCas13a (from article PMID: 35763567PMCID: PMC9282225 DOI:10.1073 / pnas.2118260119) or a combination thereof.

[0167] In another preferred embodiment, the Cas13a protein is selected from the following species: Bacteroides, Blautia, Butyrivibrio, Carnobacterium, Chloroflexus, Clostridium, Demequina, Eubacterium, Herbinix, Insolitispirillum, Lachnospiraceae, Leptot richia), Listeria, Paludibacter, Porphyromonadaceae, Pseudobutyrivibrio, Rhodobacter or Thalassospira; preferably, Leptotrichia shahii, Listeria seeligeri, Lachnospiraceae bacteria (such as Lb MA2020, Lb NK4A179, LbNK4A144, Clostridium aminophilum (such as CaDSM 10710), Carnobacterium gallinarum (such as Cg DSM 4847), Paludibacter propionicigenes (such as Pp WB4), Listeria weihenstephanensis (such as Lw FSL R9-0317), Listeriaceaebacterium (such as Lb FSL M6-0635), Leptotrichiawadei (such as Lw F0279), Rhodobacter capsulatus (such as Rc SB 1003, Rc R121, RcDE442), Leptotrichia buccalis (such as Lb C-1013-b), Herbinix hemicellulosilytica, Eubacteriaceae bacterium (such as Eb CHKCI004), Blautia sp. Marseille-P2398, Leptotrichia sp.) Oral taxon 879str.F0557, Chloroflexus aggregans, Demequina aurantiaca, Thalassospira sp. TSL5-1, Pseudobutyrivibrio sp. OR37, Butyrivibrio sp. YAB3001, Leptotrichias sp. Marseille-P3007, Bacteroides ihuae, Porphyromonadaceae bacterium (such as PbKH3CP3RA), Listeria riparia or Insolitispirillum peregrinum, Thermoclostridium caenicola or a combination thereof. .

[0168] In another preferred embodiment, the Cas13b is selected from the following group: Cas13b-t1, Cas13b-t2, Cas13b-t3, Cas13b-t4, Cas13b-t5, Cas13b-t6 or a combination thereof.

[0169] In another preferred embodiment, the Cas13b is selected from the following group: BzCas13b, PbCas13b, PspCas13b, RanCas13b, PguCas13b, PsmCas13b, CcaCas13b, AspCas13b, PauCas13b, Pin2Cas13b, Pin3Cas13b or a combination thereof.

[0170] In another preferred embodiment, the Cas13b is or is derived from the following species: Alistipes, Bacteroides, Bacteroidetes, Bergeyella, Capnocytophaga, Chryseobacterium, Flavobacterium, Myroides, Paludibacter, Phaeodactylibacter, Porphyromonas, Prevotella, Psychroflexus, Reichenbachiella, Riemerella or Sinomicrobium; preferably, Alistipes sp. ZOR0009, Bacteroides pyogenes (such as Bp F0041), Bacteroidetes bacterium (such as BbGWA2_31_9), Bergeyella zoohelcum (such as Bz ATCC 43767), Capnocytophaga canimorsus, Capnocytophaga cynodegmi, Chryseobacterium carnipullorum, Chryseobacterium jejuense, Chryseobacterium ureilyticum, Flavobacterium branchiophilum, Flavobacterium columnare, Flavobacterium sp.)316, Myroides odoratimimus (such as Mo CCUG 10230, Mo CCUG12901, Mo CCUG 3837), Paludibacter propionicigenes, Phaeodactylibacter xiamenensis, Porphyromonas gingivalis (such as Pg F0185, Pg F0568, PgJCVI SC001, Pg W4087), Porphyromonas gulae, Porphyromonas sp. COT-052OH4946, Prevotella aurantiaca, Prevotella buccae (such as Pb ATCC 33574), Prevotella falsenii, Prevotella intermedia (such as Pi 17, Pi ZT), Prevotella pallens (such as Pp ATCC 700821), Prevotella pleuritidis, Prevotella saccharolytica (such as Ps F0055), Prevotella sp. MA2016, Prevotella sp. MSX73, Prevotella sp. P4-76, Prevotella sp. P5-119, Prevotella sp. P5-125, Prevotella sp. P5-60, Psychroflexus torquis, Reichenbachiella agariperforans, Riemerella anatipestifer, Sinomicrobium oceani or a combination thereof.

[0171] In another preferred embodiment, the Cas13c protein is or is derived from the following species: Fusobacterium or Anaerosalibacter; preferably, Fusobacterium necrophorum (such as Fn subsp. funduliforme ATCC 51357, Fn DJ-2, FnBFTR-1, Fn subsp. Funduliforme), Fusobacterium perfoetens (such as Fp ATCC29250), Fusobacterium ulcerans (such as Fu ATCC 49185), Anaerosalibacter sp. ND1 or a combination thereof.

[0172] In another preferred embodiment, the Cas13d is selected from the following group: RspCas13d, RfxCas13d, EsCas13d, AdmCas13d, or a combination thereof.

[0173] In another preferred embodiment, the Cas13d is derived from the following species: Eubacterium or Ruminococcus, preferably Eubacterium siraeum, Ruminococcus flavefaciens (such as Rfx XPD3002), Ruminococcus albus or a combination thereof.

[0174] The Cas protein described in this specific embodiment can be a V-type Cas protein; the Cas protein is selected from the following groups: VA-type Cas protein, VB-type Cas protein, VC-type Cas protein, VD-type Cas protein, VE-type Cas protein, VF-type Cas protein, VG-type Cas protein, VH-type Cas protein, VI-type Cas protein, VJ-type Cas protein, VL-type, VM-type Cas protein or a combination thereof; the Cas protein described in this specific embodiment includes Cas12, such as Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12l, Cas12m or a combination thereof.

[0175] In a specific embodiment, the Cas protein referred to herein has trans-cleavage activity, such as Cas12 or Cas13, and also covers functional variants of Cas proteins or homologs or orthologs thereof. As used herein, the "functional variant" of a protein refers to a variant of such a protein that at least partially retains the trans-cleavage activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs, etc. Functional variants also include fusion products of such proteins with another generally unrelated nucleic acid, protein, polypeptide or peptide. Functional variants may be naturally occurring or may be artificial. Advantageous embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.

[0176] In one embodiment, a V-type Cas protein, a VI-type Cas protein, or an ortholog or homolog thereof may comprise one or more mutations, and thus the nucleic acid molecule encoding it may have one or more mutations. Mutations may be artificially introduced mutations and may include, but are not limited to, one or more mutations in the catalytic domain.

[0177] In one embodiment, the V-type Cas protein can be from: Leptotrichia, Listeria, Corynebacterium, Sutterella, Legionella, Treponema, Proteobacterium, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Azospirillum, Sphaerochaeta, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, Lachnospira, or a combination thereof.

[0178] Table 1 V-type family effector properties (Source: doi:10.3389 / fcell.2020.622103)

[0179]

[0180] a V stands for A, C, and G.

[0181] b R stands for A and G

[0182] C B stands for C, G and T.

[0183] Guide RNA (gRNA)

[0184] As used herein, the "guide RNA" is a mature crRNA fused with tracrRNA as a guide RNA, or a mature crRNA fused with scoutRNA as a guide RNA, or crRNA alone as a guide RNA.

[0185] In general, the guide RNA may include direct repeat sequences (also known as DR sequences) and guide sequences, or may consist essentially of or consist of direct repeat sequences and guide sequences (also known as spacers in the context of endogenous CRISPR systems). In different CRISPR systems, gRNA may include crRNA and tracrRNA, or may include crRNA and scoutRNA, or may contain only crRNA, depending on the Cas protein on which it depends. crRNA and tracrRNA may be artificially modified and fused to form a single guide RNA (sgRNA). In some cases, the guide sequence is a polynucleotide sequence that has sufficient complementarity with the cis-cutting substrate DNA to hybridize with the cis-cutting substrate DNA and guide the CRISPR / Cas protein-guide RNA complex to specifically bind to the cis-cutting substrate DNA, typically having a sequence length of 15-28nt. The direct repeat sequence may be folded to form a specific structure (such as a stem-loop structure) for recognition by the Cas protein to form a complex. The guide sequence does not need to be 100% complementary to the cis-cutting substrate DNA. The guide sequence is not complementary to the nucleic acid in the trans-cleavage reporter molecule.

[0186] In certain embodiments, when optimally aligned, the degree of complementarity (match) between the guide sequence and its corresponding cis-cleaved substrate DNA is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining optimal alignment is within the capabilities of one of ordinary skill in the art. For example, there are publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalW, Smith-Waterman in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0187] The terms "polynucleotide", "nucleotide sequence", "nucleic acid sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

[0188] The terms "homology" or "identity" are used to refer to the matching of sequences between two polypeptides or between two nucleic acids. When a position in the two sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of the two DNA molecules is occupied by adenine, or a position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position between the two sequences. Typically, the comparison is made when the two sequences are aligned to produce maximum identity. Such comparison can be by using, for example, the identity of amino acid sequence can be determined by conventional methods, with reference to, for example, Smith and Waterman, 1981, Adv. Appl. Math. 2: 482 Pearson & Lipman, 1988, Pro. Natl. Acad. Sci. USA 85: 244, Thompson et al., 1994, Nucleic Acids Res 22: 467 380, etc., by computerized operation algorithm (GAP, BESTFIT, FASTA, and TFASTA, Genetics Computer Group in Wisconsin Genetics Software Package). It can also be determined using the BLAST algorithm available from the National Center for Biotechnology Information (NCBI www.ncbi.nlm.nih.gov / ) using default parameters.

[0189] In the present invention, a closed guide RNA is also provided, comprising:

[0190] A guide RNA, wherein the guide RNA includes a direct repeat (DR) sequence capable of binding to a Cas protein and a guide sequence capable of targeting a target sequence; and

[0191] An oligonucleotide or oligonucleotide analogue, wherein the oligonucleotide or oligonucleotide analogue is complementary to the guide RNA to form a closed guide RNA.

[0192] In a preferred embodiment, the length of the oligonucleotide or oligonucleotide analog is 5-50 nt, preferably, 15-30 nt, more preferably, 10-20 nt.

[0193] In the present invention, when the target nucleic acid molecule is present in the detection system and the system temperature of the detection system matches the reaction temperature of the amplification reaction (referring to the system temperature being within the reaction temperature range of the amplification reaction, including the range boundary of the reaction temperature), the oligonucleotide or oligonucleotide analog is complementary to the guide RNA to form a closed guide RNA, and the amplification reaction of the target nucleic acid molecule is carried out in the detection system; when the target nucleic acid molecule is present in the detection system and the system temperature of the detection system matches the active temperature of the Cas protein (referring to the system temperature being within the active temperature range of the Cas protein, including the range boundary of the protein active temperature, and the system temperature at this stage is higher than the system temperature at the amplification reaction stage), the oligonucleotide or oligonucleotide analog in the closed guide RNA is unzipped from the guide RNA, the trans-cleavage activity of the Cas protein is activated, and the target nucleic acid molecule is detected in the detection system.

[0194] Nucleic acid analogs

[0195] Nucleic acid analogs are a class of derivatives of RNA and DNA. Nucleic acids are mainly composed of phosphate, pentose and bases, while nucleic acid analogs replace at least one of them with some other substances. The main nucleic acid analogs include peptide nucleic acid (PNA), morpholino (MNA), bridged nucleic acid (BNA), locked nucleic acid (LNA), glycol nucleic acid (GNA) and threose nucleic acid (TNA). Some of these nucleic acid analogs can even carry out biological processes such as replication and translation in vitro (Brudno, Yevgeny; Birnbaum, Michael E; Kleiner, Ralph E; Liu, David R. "An invitro translation, selection and amplification system for peptide nucleic acids". Nature Chemical Biology. 6(2): 148–155. doi: 10.1038 / nchembio.280.PMC2808706. PMID 20081830).

[0196] Target nucleic acid molecule

[0197] As used herein, when nucleic acid molecules are to be detected, the "target nucleic acid molecule" refers to a polynucleotide molecule extracted from a biological sample (sample to be detected) or its amplified product, transcription product, or reverse transcription product. When non-nucleic acid molecules are to be detected, the "target nucleic acid molecule" is a pre-designed nucleic acid sequence. The biological sample is any solid or fluid sample obtained, excreted or secreted from any organism, including but not limited to single-cell organisms, such as bacteria, yeast, protozoa and amoeba, etc., multicellular organisms (such as plants or animals, including samples from healthy or apparently healthy human subjects or human patients affected by the condition or disease to be diagnosed or investigated, such as infection by pathogenic microorganisms such as pathogenic bacteria or viruses). For example, a biological sample can be a biological fluid obtained from, for example, blood, plasma, serum, urine, feces, sputum, mucus, lymph, synovial fluid, bile, ascites, pleural effusion, seroma, saliva, cerebrospinal fluid, aqueous or vitreous humor, or any body secretion, exudate, exudate (e.g., fluid obtained from an abscess or any other infection or inflammation site) or fluid obtained from a joint (e.g., a normal joint or a joint affected by a disease, such as rheumatoid arthritis, osteoarthritis, gout or septic arthritis), or a swab of a skin or mucosal surface. A sample can also be a sample obtained from any organ or tissue (including a biopsy or autopsy specimen, such as a tumor biopsy) or can contain cells (primary cells or cultured cells) or a culture medium conditioned by any cell, tissue or organ. Exemplary samples include, but are not limited to, cells, cell lysates, blood smears, cytocentrifuge preparations, cytology smears, body fluids (e.g., blood, plasma, serum, saliva, sputum, urine, bronchoalveolar lavage, semen, etc.), tissue biopsies (e.g., tumor biopsies), fine needle aspirates, and / or tissue sections (e.g., cryostat tissue sections and / or paraffin-embedded tissue sections).

[0198] In other embodiments, the biological sample can be plant cells, callus, tissue or organ (such as roots, stems, leaves, flowers, seeds, fruits), etc.

[0199] In the present invention, the target nucleic acid molecule includes a DNA molecule, and also includes an RNA molecule or a DNA molecule formed by reverse transcription of RNA, or further, the target nucleic acid molecule can be amplified by a technique known in the art, and the amplification technique is an isothermal amplification technique, and the isothermal amplification can be LAMP (loop-mediated isothermal amplification), RPA (recombinase polymerase amplification), RAA (recombinase-mediated amplification), LCR (ligase chain reaction), bDNA (branched DNA amplification), NASBA (nucleic acid sequence-dependent amplification), SDA (strand displacement amplification), TMA (transcription-mediated amplification), RCA (rolling circle amplification), HDA (helicase-dependent amplification), SPIA (single primer isothermal amplification), NEAR (nickase amplification reaction), SMAP (smart amplification method) , SMAP2 (smart amplification method version 2), CPA (cross primer amplification), MDA (multiple displacement amplification), RAM (Ramification), cHDA (helicase-dependent circular amplification), SMART (signal-mediated amplification of RNA), 3SR (self-directed sequence replication system), GEAR (genomic exponential amplification reaction), IMDA (isothermal multiple displacement amplification), ERA (enzymatic recombinase isothermal amplification), TAS (transcription-dependent amplification system), RIDA (rapid isothermal detection amplification technology), NEMA (nicking endonuclease nucleic acid isothermal amplification), EXPAR (exponential isothermal amplification), ICAN (chimeric primer-induced nucleic acid isothermal amplification), SEA (strand exchange amplification), SHARP (SSB-helicase-mediated rapid PCR) or a combination thereof.

[0200] Furthermore, the detection method of the present invention further comprises a step of amplifying the target nucleic acid molecule; the detection system further comprises a component for amplifying the target nucleic acid molecule. The amplified component comprises one or more of the following groups: DNA polymerase, reverse transcriptase, strand displacement enzyme, nicking endonuclease, helicase, recombinase, single-strand binding protein, recombinant regulatory protein, T7 RNA polymerase, RNase H, dNTPs for amplification reaction and / or reverse transcription reaction, NTPs for transcription reaction, buffer, etc.

[0201] Detection system

[0202] This specific embodiment provides a system for amplifying and detecting target nucleic acid molecules in one tube without opening the cover, including:

[0203] (a) a Cas protein, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity;

[0204] (b) a guide RNA, wherein the guide RNA comprises a direct repeat (DR) sequence capable of binding to the Cas protein and a guide sequence capable of targeting a target sequence;

[0205] (c) a Cas protein trans-cleavage reporter molecule, wherein the Cas protein trans-cleavage reporter molecule comprises a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA in the system; and

[0206] (d) an oligonucleotide or an oligonucleotide analog, wherein the oligonucleotide or the oligonucleotide analog is complementary to the guide RNA to form a closed guide RNA.

[0207] In a preferred embodiment, the system further comprises: an isothermal amplification component (or a reagent for isothermal amplification).

[0208] The detection method in this specific embodiment includes subjecting the sample to be detected to the following reaction:

[0209] i) contacting the sample to be detected with the system as described in the third aspect of the present invention, and performing an amplification reaction of the target nucleic acid molecule at the first system temperature;

[0210] ii) performing trans-cleavage at the temperature of system II, detecting the detectable signal generated by the trans-cleavage of the reporter molecule by the Cas protein in the system, thereby detecting the target nucleic acid molecule.

[0211] In the present invention, the system of the present invention is a one-tube system for amplification and detection, and detection can be completed after amplification without adding reagents in the middle.

[0212] A method in which amplification and detection are performed in stages in one tube without opening the lid (i.e., one-tube two-stage method)

[0213] This specific embodiment discloses a method for detecting a target nucleic acid molecule in a tube that is amplified and detected in stages but not opened, and in particular, a method for detecting a target nucleic acid molecule using the system for amplifying and detecting a target nucleic acid molecule described herein.

[0214] This specific embodiment provides a method for detecting target nucleic acid molecules, especially using Cas proteins to detect target DNA or target RNA molecules. At the temperature of the first system, the oligonucleotide or oligonucleotide analog is complementary to the guide RNA, and the target nucleic acid molecule undergoes an amplification reaction. At the temperature of the second system, the oligonucleotide or oligonucleotide analog is unzipped with the guide RNA, and the cis-cutting substrate (single-stranded or double-stranded), the guide RNA and the Cas protein form a ternary complex, which will non-specifically cut the trans-cutting reporter molecule in the system (trans-cutting reporter molecule, such as a nucleic acid probe, the nucleic acid probe includes a single-stranded DNA molecule or a single-stranded RNA molecule (can be a linear structure or a hairpin structure), depending on the corresponding Cas protein), and the target nucleic acid molecule, such as a target DNA, is determined by the detection signal. Whether the target RNA molecule exists.

[0215] In the present invention, the length of the oligonucleotide or oligonucleotide analog is 5-50 nt, more preferably, 15-30 nt, more preferably, 10-20 nt.

[0216] A representative nucleic acid probe is a single-stranded DNA or single-stranded RNA with a luminescent group and a quenching group connected to both ends (the single-stranded DNA or single-stranded RNA can be a linear structure or a hairpin structure), so once the probe is cut, the luminescent group can emit light.

[0217] In this specific embodiment, by detecting fluorescence, it can be known whether the system to be detected contains target nucleic acid molecules such as target DNA and target RNA molecules.

[0218] In this specific embodiment, suitable Cas proteins are type V Cas proteins and type VI Cas proteins with trans-cleavage activity, preferably Cas12a, Cas12b, Cas13, and preferably the Cas12a is preferably FnCas12a, LbCas12a, ErCas12a, Evcas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, CeCas12a, PrC as12a, CsbCas12a, BhCas12a, SsCas12a, Lb3Cas12a, BpCas12a, PdCas12a, BfCas12a, PcCas12a, cMtCas12a, PeCas12a, LiCas12a, Lb2Cas12a, PmCas12a, MbCas12a, EeCas12a, CsbCas12a, ArCas12a, BsCas12a, AbCas12a, AsCas12a, or a combination thereof. Preferably, the Cas12b is AacCas12b, AaCas12b, BthCas12b, AapCas12b, AkCas12b, AmCas12b, Bs3Cas12b, LsCas12b, BrCas12b (from Brevibacillus sp.SYP-B805, from the article PMID: 31926228 DOI: 10.1016 / j.ijbiomac.2020.01.079), and preferably Cas13 is Cas13a, Cas13b, Cas13c, Cas13d, Cas13e, Cas13f, Cas13x, Cas13y or a combination thereof.

[0219] The detection method of this embodiment can detect nucleic acid molecules, such as nucleic acid molecules of mammals, plants, or microorganisms, viruses. The method of this embodiment is particularly suitable for detecting pathogenic microorganisms, gene mutations or specific target DNA, or target DNA and RNA.

[0220] The method of this specific embodiment can be used to quickly detect whether the sample contains the target nucleic acid molecule. In addition, by combining with isothermal amplification technology (such as: any one of LAMP, RPA, RAA, LCR, bDNA, NASBA, SDA, TMA, RCA, HDA, SPIA, NEAR, SMAP, SMAP2, CPA, MDA, RAM, cHDA, SMART, 3SR, GEAR, IMDA, ERA, TAS, RIDA, NEMA, EXPAR, ICAN, SEA, SHARP), the sensitivity of the detection method can be greatly improved. Various isothermal amplification technologies in the prior art can theoretically be used in the present invention, and this specific embodiment only lists preferred embodiments. The components used in various amplification technologies in this application, such as:

[0221] NTP, buffer, and Mg required for RNA amplification 2+ etc., as well as RNase H required when reverse transcriptase has no function in digesting single-stranded RNA;

[0222] dNTPs, buffer, and Mg required for DNA amplification 2+ wait;

[0223] These contents are common knowledge in the art, so this application does not describe them in detail.

[0224] See also Figure 1 , Figure 2 (a, b), the present invention blocks the activity of guide RNA by introducing an oligo complementary to the guide RNA sequence, thereby enabling isothermal amplification to proceed without interference, and subsequently allowing the oligo to unwind from the guide RNA by increasing the temperature, thereby restoring the activity of the guide RNA. The guide RNA and the oligonucleotide or oligonucleotide analog form a double-stranded molecule or a hairpin molecule. The present invention divides isothermal amplification and Cas enzyme cleavage into two stages by design, similar to the CRISPR two-step detection, but does not require opening the lid to add reagents in the middle. Therefore, as long as there is a Cas protein that is compatible with the isothermal amplification reaction system and still has trans-cleavage activity after subsequent heating, it can be used in the present invention for CRISPR one-tube two-stage detection.

[0225] In the present invention, oligo blocks the guide RNA, and may block all or part of the spacer (i.e., the oligo is fully or partially paired with the spacer, such as 20%-100%), or may block all or part of the rest of the spacer, as long as it can ensure that the trans-cleavage activity is stimulated after the guide RNA and the Cas protein are blocked from binding, and the trans-cleavage activity of the Cas protein can be restored after heating.

[0226] In the present invention, the relationship between the system temperature (system I temperature) in stage I (amplification reaction stage), the Cas protein activity temperature, and the system temperature (system II temperature) in stage II (detection stage) is as follows: the system temperature I is lower than the maximum activity temperature of the selected Cas protein activity temperature, and the system temperature II is not higher than the maximum activity temperature of the selected Cas protein activity temperature.

[0227] The main advantages of this embodiment include:

[0228] (1) This specific embodiment is the first to shield the guide RNA by introducing a segment of oligo under the system temperature conditions matching the isothermal amplification reaction temperature, so that the isothermal amplification reaction can be carried out preferentially, and the selected Cas protein participates in the reaction, and then the oligo and guide RNA are unzipped by heating, so that the Cas protein begins to play a role in cutting the reporter probe and performing the detection function. Since the present invention separates the isothermal amplification and Cas protease cleavage into two stages (stage I, i.e., the amplification reaction stage; stage II, i.e., the detection stage) by design, the Cas protein will not be the first to cut the cis-cutting substrate, thereby not affecting the sensitivity of the detection. Another advantage is that the system does not require large-scale screening and testing, and the guide RNA and the ion concentration in the system can be used without large-scale screening, which greatly facilitates the establishment of a CRISPR one-tube two-stage method system. In addition, the present invention only uses oligo and two-stage variable temperature conditions, which is relatively easy to implement and can be directly adapted to the existing fluorescence detection platform.

[0229] (2) No need to open the cover, prevent aerosol pollution, simpler operation, and more conducive to automation. The two-step method in the prior art (such as Example 4-10 of Chinese patent application CN 107488710 A, amplification first, then adding detection reagent for detection, called the two-step method) also performs amplification first and then detection, but the cover needs to be opened in the middle to add the detection reagent, which is not simple to operate, does not utilize automation, and is subject to aerosol pollution.

[0230] (3) Because the guide RNA is blocked, the Cas protein will not cut the cis-cutting substrate or the primer during the amplification stage, which will not affect the amplification efficiency. Therefore, the amplification time can be shortened compared to the ordinary one-tube method.

[0231] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0232] Unless otherwise specified, the materials and reagents used in the examples of this specific embodiment are all commercially available products.

[0233] Example 1: One-tube two-stage system based on CRISPR-Cas for detection of Group B Streptococcus (GBS)

[0234] See also Figure 1 , the detection principle of the CRISPR one-tube two-stage system of this embodiment is as follows: under the condition of the optimum amplification temperature of the isothermal amplification reaction (i.e., the system temperature selects the optimum amplification temperature of the isothermal amplification reaction), the activity of the guide RNA is blocked by adding a segment of oligo complementary to the guide RNA. At this time, only the isothermal amplification reaction is performed in the CRISPR one-tube two-stage system, and the CRISPR-Cas system is blocked by the oligo and has no activity. Since the highest activity temperature of the Cas protein is higher than the system temperature during isothermal amplification, after the isothermal amplification reaction is completed, the oligo and the guide RNA can be unzipped by heating, thereby releasing the blocking effect of the oligo on the guide RNA. At this time, the CRISPR-Cas system begins to play a role, and its trans-cleavage activity is used to quickly detect the target nucleic acid. Since the present invention divides the isothermal amplification reaction and the Cas enzyme cleavage into two stages by design, the Cas enzyme will not first cut the cis-cleavage substrate (target nucleic acid molecule), thereby not affecting the sensitivity of the detection. Another advantage is that the system does not require large-scale screening and testing, and the guide RNA and the ion concentration in the system can be used without large-scale screening, which greatly facilitates the establishment of the CRISPR one-tube two-stage system. In addition, the present invention only uses oligo and two-stage variable temperature conditions, which is relatively easy to implement and can be directly adapted to the existing fluorescence detection platform.

[0235] 1.1. Design of oligonucleotides to block guide RNA

[0236] First, according to the CRISPR two-step method (such as Chinese patent application CN 107488710 A Example 4-

[0237] 10, amplification first, then adding detection reagent for detection, known as the two-step method) results, screen out the guide RNA with the best performance, and then design the oligo to block the guide RNA.

[0238] The oligo of the guide RNA is preferentially selected to block the spacer region of the guide RNA, and the oligo type is preferentially selected as RNA oligo, and the Tm value of the sequence is selected near the optimal reaction temperature of the isothermal amplification reaction. The specific optimal sequence can be simply screened and tested (see Example 3). According to the oligo optimization design principle provided above, the GBS sgRNA and blocking oligo sequence information in the GBS RAA / Cas12b one-tube two-stage method system are as described in Table 1.

[0239] Table 1 Oligo sequences of GBS sgRNA and blocking guide RNA

[0240]

[0241] Note: The underlined part of the GBS sgRNA sequence is the GBS spacer sequence.

[0242] 1.2. GBS RAA / Cas12b one-tube two-stage detection system

[0243] The isothermal amplification reagent used in the GBS RAA / Cas12b one-tube two-stage detection system is

[0244] The RAA nucleic acid amplification kit is similar to the RPA reagent. The RAA nucleic acid amplification kit is provided by Jiangsu Qitian Gene Biotechnology Co., Ltd., with the catalog number B00000. AapCas12b is provided by Anhui Tolo Biotechnology Co., Ltd., with the catalog number 32118-03. GBS RAA primers and Cas12b

[0245] The sequence information of Reporter (trans-cleavage reporter molecule) is described in Table 2 below.

[0246] Table 2 GBS RAA primers and Cas12b Reporter

[0247] name Sequence (5'-3') GBS-F TTTATGATTTGAATTCTATTGGTAGTCGTGTA GBS-R ATATTTGCTTGACTAACCTTATTTGCTAAATG Cas12b Reporter 5'- / 6-FAM / TTTTTTT / BHQ1 / -3'

[0248] 1) Prepare the reaction system

[0249] Buffer A: used to resuspend RAA lyophilized powder

[0250] Table 3: Buffer A preparation table

[0251] Components Dosage (μL) Buffer V 25 GBS-F (10 μM) 2 GBS-R (10μM) 2 AapCas12b (10 μM) 1 Cas12b Reporter (10μM) 2.5 Purified water 2.5

[0252] Buffer B: Mixture of GBS sgRNA and blocked guide RNA oligo

[0253] Table 4: Buffer B preparation table

[0254] Components Dosage (μL) GBS-sgRNA-rRC (10 μM) 4 GBS-sgRNA (10 μM) 1

[0255] 2) Add 35 μL of Buffer A to the basic reaction unit of the RAA Nucleic Acid Amplification Kit, gently flick the lyophilized powder to fully dissolve it, and centrifuge briefly to collect the liquid at the bottom of the tube.

[0256] 3) Open the basic reaction unit, add 5 μL of magnesium acetate to the inner side of the tube cover of each basic reaction unit, then add 5 μL of Buffer B to the reaction unit tube cover, and finally add 5 μL of negative control or template nucleic acid (cis-cleavage substrate, i.e., a sequence in group B streptococcus) to the reaction unit tube.

[0257] The template nucleic acid sequence of this example is as follows:

[0258] TAGCATTCAGTTGAGAAATATCAAAGATAATGTTCAGGGAACAGATTATGAAAAACCGGTTAATGAGGCTATTACTAGTGTTGAAAAATTAAAGACTTCATTGCGTGCCAACCCTGAGACAGTTTATGATTTGAATTCTATTGGTAGTCGTGTAGAAGCCTTAACAGATGTGATTGAAGCAATCACTTTTTCAACTCA ACATTTAGCAAATAAGGTTAGTCAAGCAAATATTGATATGGGATTTGGGATAACTAAGCTAGTTATTCGCATTTTAGATCCATTTGCTTCAGTTGATTCAATTAAAGCTCAAGTTAACGATGTAAAGGCATTAGAACAAAAGGTTTTAACTTATCCTGATTTAAAACCAACTGATAGAGCTACCATCTATACAA(SEQ ID NO.3)

[0259] 4) Place the reaction tube with the negative control or template nucleic acid in a handheld centrifuge for brief centrifugation. After flicking the reaction tube to mix thoroughly, place it in a handheld centrifuge for brief centrifugation.

[0260] 5) Place the reaction tube in a constant temperature device at 37°C for 20 min, then at 60°C for 10 min, and select the FAM fluorescence channel to detect the signal.

[0261] 1.3. GBS RAA / Cas12b one-tube two-stage system detection results

[0262] Figure 3 This is the detection result of GBS RAA / Cas12b one-tube two-stage method. In the first stage (37°C, 20 min), AapCas12bsgRNA is blocked by oligo, and the AapCas12b system is inactive. The RAA amplification reaction is mainly carried out in the one-tube two-stage method system. In the second stage (60°C, 10 min), the one-tube two-stage method system raises the temperature to 60°C, so that the sgRNA and oligo are unzipped, thereby activating the AapCas12b system. When the target nucleic acid to be tested exists in the system, the trans-cleavage activity of AapCas12b will be activated, and a fluorescence curve will appear.

[0263] Example 2: One-tube two-stage system based on CRISPR-Cas for detecting monkeypox virus (MPX)

[0264] 2.1. Design of oligonucleotides to block guide RNA

[0265] According to the oligo design suggestions for blocking guide RNA in Example 1, the CRISPR one-tube two-stage method system was used to detect the oligo design of monkeypox virus blocking guide RNA, and its sequence information is shown in Table 5.

[0266] Table 5 Oligo sequences of MPX sgRNA and blocking guide RNA

[0267]

[0268] Note: The underlined part of the MPX sgRNA sequence is the MPX spacer sequence.

[0269] 2.2. MPX RAA / Cas12b one-tube two-stage detection system

[0270] The isothermal amplification reagent used in the MPX RAA / Cas12b one-tube two-stage detection system is a RAA nucleic acid amplification kit similar to the RPA reagent principle. The RAA nucleic acid amplification kit is provided by Jiangsu Qitian Gene Biotechnology Co., Ltd., with a catalog number of B00000. AapCas12b is provided by Anhui Tolo Port Biotechnology Co., Ltd., with a catalog number of 32118-03. The sequence information of MPX RAA primers and Cas12b Reporter (trans-cleavage reporter molecule) is described in Table 6 below.

[0271] Table 6 MPX RAA primers and Cas12b Reporter

[0272] name Sequence (5'-3') MPX-F AGAAGCCGTAATCTATGTTGTCTATCGTGT MPX-R GACAAGCCTGTAAATGATTATTGTGAGATGTA Cas12b Reporter 5'- / 6-FAM / TTTTTTT / BHQ1 / -3'

[0273] 1) Prepare the reaction system

[0274] Buffer A: used to resuspend RAA lyophilized powder

[0275] Table 7: Buffer A preparation table

[0276] Components Dosage (μL) Buffer V 25 MPX-F (10 μM) 2 MPX-R (10μM) 2 AapCas12b (10 μM) 1 Cas12b Reporter (10μM) 2.5 Purified water 2.5

[0277] Buffer B: MPX sgRNA and oligo mixture of blocked guide RNA

[0278] Table 8: Buffer B preparation table

[0279] Components Dosage (μL) MPX-sgRNA-rRC (10 μM) 4 MPX-sgRNA (10 μM) 1

[0280] 2) Add 35 μL of Buffer A to the basic reaction unit of the RAA Nucleic Acid Amplification Kit, gently flick the lyophilized powder to fully dissolve it, and centrifuge briefly to collect the liquid at the bottom of the tube.

[0281] 3) Open the basic reaction unit, add 5 μL of magnesium acetate to the inside of the tube cover of each reaction unit, then add 5 μL of Buffer B to the reaction unit tube cover, and finally add 5 μL of negative quality control or template nucleic acid (cis-cleavage substrate, i.e., a sequence in monkeypox virus) to the reaction unit tube.

[0282] The template nucleic acid sequence of this example is as follows:

[0283] AGAAGCCGTAATCTATGTTGTCTATCGTGTCCTCCGGGAACTTACGCTTCCAGATTATGTGATAGCAAGACTAATACACAATGTACGCCGTGTGGTTCGGATACCTTTACATCTCACAATAATCATTTACAGGCTTGTC(SEQID NO.6)

[0284] 4) Place the reaction tube with the negative control or template nucleic acid in a handheld centrifuge for brief centrifugation. After flicking the reaction tube to mix thoroughly, place it in a handheld centrifuge for brief centrifugation.

[0285] 5) Place the reaction tube in a constant temperature device at 37°C for 20 min, then at 60°C for 10 min, and select the FAM fluorescence channel to detect the signal.

[0286] 2.3. MPX RAA / Cas12b one-tube two-stage system detection results

[0287] Figure 4 This is the detection result of the MPX RAA / Cas12b one-tube two-stage method. In the first stage (37°C, 20 min), AapCas12bsgRNA is blocked by oligo, and the AapCas12b system is inactive. The RAA amplification reaction is mainly carried out in the one-tube two-stage method system. In the second stage (60°C, 10 min), the one-tube two-stage method system raises the temperature to 60°C, so that the sgRNA and oligo are unzipped, thereby activating the AapCas12b system. When the target nucleic acid to be tested exists in the system, the trans-cleavage activity of AapCas12b will be activated, and a fluorescence curve will appear.

[0288] Example 3: One-tube two-stage system based on CRISPR-Cas to detect oligo screening test of blocking guide RNA in monkeypox virus (MPX)

[0289] According to the MPX-sgRNA sequence in Example 2, three blocking oligos were designed. These three oligos can achieve blocking guide RNA and are used to screen the oligo with the best blocking effect of MPX-sgRNA. The specific sequences are shown in Table 9.

[0290] Table 9 MPX-sgRNA blocking oligo

[0291] Oligo name for blocking MPX-sgRNA Sequence (5'-3') MPX-sgRNA-oligo1 GCAAGACUAAUACA MPX-sgRNA-oligo2 UAGCAAGACUAAUACA MPX-sgRNA-oligo3 GUGAUAGCAAGACU

[0292] The subsequent experimental steps were carried out in full accordance with Example 2. Figure 5The test results showed that all oligos had very good effects, among which MPX-sgRNA-oligo1 had the best effect in blocking MPX-sgRNA, and the fluorescence value of the reaction system was the highest.

[0293] Example 4: One-tube two-stage system for detecting group B streptococci based on guide RNA fusion oligo (i.e., the closed guide RNA is a hairpin type) CRISPR-Cas

[0294] 5.1. Design of oligonucleotides fused to guide RNA

[0295] when The oligo and guide RNA are fused together, and the oligo that blocks the guide RNA preferentially blocks the guide For the spacer region of RNA, RNA oligo is preferred as the oligo type, since guide RNA and oligo are fused structures. The optimal oligo sequence can be screened by adjusting the length of the sequence that complements the oligo with the guide RNA.

[0296] According to the oligo optimization design principle of fusion guide RNA, the sequence information of fusion guide RNA and screening blocking oligo in the GBS RAA / Cas12b one-tube two-stage method system is described in Table 10.

[0297] Table 10 GBS fusion sgRNA and blocking oligo sequences

[0298]

[0299] Note: The underlined sequence is the oligo sequence.

[0300] 5.2. GBS RAA / Cas12b one-tube two-stage detection system based on guide RNA fusion oligo The isothermal amplification reagent used in the GBS RAA / Cas12b one-tube two-stage detection system is a RAA nucleic acid amplification kit similar to the RPA reagent principle. The RAA nucleic acid amplification kit is provided by Jiangsu Qitian Gene Biotechnology Co., Ltd., with a catalog number of B00000. AapCas12b is provided by Anhui Tolo Port Biotechnology Co., Ltd., with a catalog number of 32118-03. The sequence information of GBS RAA primers and Cas12bReporter (trans-cleavage reporter molecule) is as described in Table 11 below.

[0301] Table 11 GBS RAA primers and Cas12b Reporter

[0302] name Sequence (5'-3') GBS-F TTTATGATTTGAATTCTATTGGTAGTCGTGTA GBS-R ATATTTGCTTGACTAACCTTATTTGCTAAATG Cas12b Reporter 5'- / 6-FAM / TTTTTTT / BHQ1 / -3'

[0303] 1) Prepare the reaction system

[0304] Buffer A: used to resuspend RAA lyophilized powder

[0305] Table 12: Buffer A preparation table

[0306] Components Dosage (μL) Buffer V 25 GBS-F (10 μM) 2 GBS-R (10μM) 2 AapCas12b (10 μM) 2 GBS-sgRNA&oligo (10μM) 2 Cas12b Reporter (10μM) 2.5 Purified water 4.5

[0307] Note: GBS-sgRNA-oligo is a separate test for GBS-sgRNA&oligo1 / 2 / 3 / 4 / 5.

[0308] 2) Add 40 μL of Buffer A to the RAA basic reaction unit, gently flick the tube to fully dissolve the lyophilized powder, and centrifuge briefly to collect the liquid at the bottom of the tube.

[0309] 3) Open the reaction unit, add 5 μL of magnesium acetate to the inner side of the tube cover of each reaction unit, and then add 5 μL of negative control or template nucleic acid (cis-cleavage substrate, i.e., a sequence of group B streptococcus, as in Example 1) to the reaction unit tube.

[0310] 4) Place the reaction tube with the negative control or template nucleic acid in a handheld centrifuge for brief centrifugation. After flicking the reaction tube to mix thoroughly, place it in a handheld centrifuge for brief centrifugation.

[0311] 5) Place the reaction tube in a constant temperature device at 37°C for 20 min (1 cycle per minute), then at 60°C for 10 min (2 cycles per minute), and select the FAM fluorescence channel to detect the signal.

[0312] 5.3. Results of the GBS RAA / Cas12b one-tube two-stage detection system based on guide RNA fusion oligo

[0313] Figure 6 This is the result of the GBS RAA / Cas12b one-tube two-stage detection system based on guide RNA fusion oligo. The test results show that the screened fusion oligos can block the activity of their guide RNAs, and GBS-sgRNA&oligo1 / 2 / 3 / 4 / 5 can function normally, among which GBS-sgRNA&oligo4 has the best effect and the highest fluorescence value of the reaction system.

[0314] Comparative Example 1: Testing the effect of constant temperature conditions on the one-tube two-stage system of CRISPR-Cas

[0315] The test method is the same as that of Example 1, except that there is no temperature increase process in Comparative Example 1, and the temperature is kept constant at 37°C under the isothermal amplification reaction condition, and the other conditions are the same as those of Example 1. Figure 7The test results show that when the one-tube two-stage method of CRISPR-Cas is performed under constant temperature conditions, the positive control and the negative control cannot be distinguished, and the positive control cannot detect the peak signal of the fluorescence curve. The comparison test results of Example 1 and Comparative Example 1 show that the one-tube method detection effect of the present invention cannot be obtained without changing the temperature, and the peak of the fluorescence curve will only appear after the temperature is raised (Cas enzyme activity begins to recover).

[0316] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. Use of an oligonucleotide or an oligonucleotide analog, characterized in that: Used to block guide RNA.

2. The use according to claim 1, characterized in that The oligonucleotide or oligonucleotide analog does not have a photocleavable sequence.

3. A closed guide RNA, characterized in that include: A guide RNA, wherein the guide RNA comprises a direct repeat (DR) sequence capable of binding to a Cas protein and a guide sequence capable of targeting a target sequence; and An oligonucleotide or oligonucleotide analogue, wherein the oligonucleotide or oligonucleotide analogue is complementary to the guide RNA to form a closed guide RNA.

4. A one-tube nucleic acid detection system based on CRISPR-Cas, characterized in that: The system comprises: (a) a Cas protein, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity; (b) a guide RNA, wherein the guide RNA comprises a direct repeat (DR) sequence capable of binding to the Cas protein and a guide sequence capable of targeting a target sequence; (c) a Cas protein trans-cleavage reporter molecule, wherein the Cas protein trans-cleavage reporter molecule comprises a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA in the system; and (d) an oligonucleotide or an oligonucleotide analog, wherein the oligonucleotide or the oligonucleotide analog is complementary to the guide RNA to form a closed guide RNA.

5. The detection system according to claim 4, characterized in that The Cas protein is selected from the group consisting of a type V Cas protein, a type VI Cas protein, or a combination thereof.

6. The detection system according to claim 4, characterized in that The oligonucleotide or oligonucleotide analog has a length of 5-50 nt, preferably 15-30 nt, more preferably 10-20 nt.

7. The detection system according to claim 4, characterized in that When the target nucleic acid molecule is present in the system and the temperature of the system matches the reaction temperature of the amplification reaction (meaning that the temperature of the system is within the reaction temperature range of the amplification reaction, including the boundary of the reaction temperature range), the oligonucleotide or oligonucleotide analog is complementary to the guide RNA to form a closed guide RNA, and an amplification reaction of the target nucleic acid molecule is carried out in the system.

8. The detection system according to claim 4, characterized in that When the target nucleic acid molecule is present in the system and the system temperature matches the active temperature of the Cas protein (the system temperature is within the active temperature range of the Cas protein, including the range boundary of the reaction temperature, and the system temperature is higher than the system temperature during the amplification reaction by heating), the oligonucleotide or oligonucleotide analog is unzipped from the guide RNA, and the target nucleic acid molecule is detected in the system.

9. A one-tube nucleic acid detection kit based on CRISPR-Cas, characterized in that: The kit comprises: (i) a first container and a Cas protein located in the first container, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity; (ii) a second container and a guide RNA located in the second container, wherein the guide RNA comprises a direct repeat (DR) sequence capable of binding to the Cas protein and a guide sequence capable of targeting a target sequence; (iii) a third container and a Cas protein trans-cleavage reporter molecule located in the third container, wherein the Cas protein trans-cleavage reporter molecule comprises a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA in the system; and (iv) a fourth container and an oligonucleotide or oligonucleotide analog located in the fourth container, wherein the oligonucleotide or oligonucleotide analog is complementary to the guide RNA to form a closed guide RNA; and labels or instructions.

10. A one-tube nucleic acid detection method based on CRISPR-Cas, characterized in that: The following steps are involved: i) contacting the sample to be detected with the system as claimed in claim 4, and performing an amplification reaction of the target nucleic acid molecule at a first system temperature; ii) performing trans-cleavage at the temperature of system II, detecting the detectable signal generated by the trans-cleavage of the reporter molecule by the Cas protein in the system, thereby detecting the target nucleic acid molecule.

Images