Recombinant vector expressing chromatin domain Y-like protein CDYL and its use

Abstract

The present invention belongs to the technical field of biomedicine, and particularly relates to a recombinant vector expressing chromatin domain Y-like protein CDYL and its use. In order to screen key crotonyl-CoA metabolic enzymes in heart failure and provide a drug for treating heart failure, the present invention provides a recombinant vector expressing chromatin domain Y-like protein CDYL, which contains a gene encoding chromatin domain Y-like protein CDYL. The present invention also provides the use of the above recombinant vector in the preparation of a drug for preventing or treating heart failure. By overexpressing CDYL, it can improve the impaired cardiac systolic function caused by aortic arch constriction for 4 weeks, improve myocardial hypertrophy, myocardial fibrosis and heart failure, and can also reduce pathological myocardial cell hypertrophy. It can be used to prepare drugs for treating heart failure and has important practical significance.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a recombinant vector expressing a chromatin domain Y-like protein CDYL and uses thereof. Background Art

[0002] Heart failure is a leading cause of morbidity and mortality worldwide. Heart failure is a complex, multisystem clinical syndrome, with common risk factors including hypertension, coronary artery disease, diabetes, obesity, and aging. With increasing life expectancy and the accelerated aging of the Chinese population, heart failure will continue to pose a growing economic burden. The pathogenesis of heart failure is complex, accompanied by pathological remodeling of cardiac structure, metabolic remodeling, deterioration of cardiac function, and abnormal expression of multiple genes. Clinical diagnosis is typically based on a combination of multiple test results, including a detailed medical history, physical examination, electrocardiogram, echocardiogram, and blood tests for heart failure markers. Most clinical treatment strategies target the neurohormonal system, such as angiotensin II receptor blockers and beta-blockers, but specific interventions are currently lacking. Therefore, further exploration of precise intervention targets for heart failure, combined with gene therapy, will facilitate timely, targeted intervention to prevent the onset of heart failure and hold significant clinical significance.

[0003] Post-translational modifications are closely associated with remodeling processes induced by various cardiac diseases and may serve as potential intervention targets for heart failure. Lysine crotonylation (Kcr) is a novel, evolutionarily conserved histone post-translational modification (PTM). It is ubiquitous in all core histones (H2A, H2B, H3, and H4), the linker histone H1, and markers of active promoters and potential enhancers. It is crucial for chromatin activity and transcriptional events. Kcr catalyzes the addition of a crotonyl residue from the donor crotonyl-CoA to target proteins. Therefore, crotonyl-CoA is a key determinant of crotonylation levels. Cellular crotonyl-CoA is produced by mitochondrial or peroxisomal fatty acid oxidation, as well as metabolic processes such as lysine and tryptophan. Genetic or environmental factors can alter cellular crotonyl-CoA concentrations, thereby altering histone crotonylation levels and contributing to physiological and pathological processes. Previous studies have reported key roles for Kcr in reproductive development, tumorigenesis, and tissue fibrosis. Recent studies have also found that cardiac Kcr plays an important pathophysiological role in myocardial injury and maintaining cardiac homeostasis. However, the regulatory role and mechanism of histone Kcr and crotonyl-CoA metabolism in heart failure remain largely unclear and need to be elucidated.

[0004] The Chromodomain Y-like (CDYL) protein, as a crotonyl-CoA hydratase, can convert crotonyl-CoA into β-hydroxybutyryl-CoA and negatively regulate histone Kcr. It has been reported that CDYL is involved in pathological processes such as tumor pathology and neurodevelopment, but whether it has relevant effects in cardiovascular diseases remains to be studied. Summary of the Invention

[0005] The technical problem to be solved by the present invention is: to screen therapeutic targets and drugs related to heart failure and provide a new way for the treatment of heart failure.

[0006] The technical solution of the present invention to solve the above technical problem is: to provide a recombinant vector expressing the Chromodomain Y-like protein CDYL, and the recombinant vector contains a gene encoding the Chromodomain Y-like protein CDYL.

[0007] Among them, in the above recombinant vector, the nucleotide sequence of the gene encoding the Chromodomain Y-like protein CDYL is as shown in SEQ ID NO:1.

[0008]

[0009] Among them, in the above-mentioned recombinant vector, the recombinant vector is a viral vector; preferably an adenovirus vector or an adeno-associated virus vector.

[0010] Preferably, the construction sequence of the adenovirus vector is pAdEasy-EF1-MCS-3flag-CMV-EGFP.

[0011] The target nucleotide sequence inserted into the adenovirus vector is as shown in SEQ ID NO:1.

[0012] Preferably, the construction sequence of the adeno-associated virus vector is pHBAAV-TNT-3flag-P2A-EGFP.

[0013] The target nucleotide sequence inserted into the adeno-associated virus vector is as shown in SEQ ID NO:1.

[0014] The present invention also provides a host cell comprising the above-mentioned recombinant vector.

[0015] Furthermore, the host cell is a cardiomyocyte.

[0016] The present invention also provides the use of the above-mentioned recombinant vector and host cell in the preparation of a drug for preventing or treating heart failure.

[0017] Among them, in the above-mentioned use, the heart failure is heart failure caused by pressure overload.

[0018] Among them, in the above-mentioned use, the heart failure includes left ventricular systolic dysfunction, myocardial hypertrophy or myocardial fibrosis.

[0019] The beneficial effects of the present invention are as follows:

[0020] By screening crotonyl-CoA hydratase related to heart failure, the present invention discovers that chromatin domain Y-like protein CDYL is closely related to heart failure. Therefore, the present invention constructs a recombinant vector overexpressing CDYL, and it is found that this recombinant vector can overexpress CDYL, thereby preventing or treating heart failure. In particular, it has a good effect on heart failure caused by pressure overload. It can not only improve the impaired left ventricular systolic function caused by TAC for 4 weeks, relieve myocardial hypertrophy, and reduce myocardial fibrosis. In cell experiments, overexpressing CDYL can also reduce the increased cardiomyocyte area stimulated by crotonate and decrease the expression of cardiomyocyte hypertrophy genes such as Nppa and Nppb. The present invention provides a new drug and method for the treatment of heart failure. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1To screen for key crotonyl-CoA-related metabolic enzymes in heart failure. Among them, A is to analyze the gene expression of enzymes directly regulating crotonyl-CoA metabolism in human heart failure using a public database; B is to analyze the role of several crotonyl-CoA metabolic enzymes in predicting heart failure patients using a receiver operating characteristic curve; C is that CDYL protein expression is significantly downregulated in a heart failure model induced by pressure overload; D is that CDYL protein expression is significantly downregulated in a heart failure model induced by angiotensin II. *, p < 0.05, ***, p < 0.001, n = 4.

[0022] Figure 2 Is the adenovirus vector map.

[0023] Figure 3 Overexpression of CDYL in cardiomyocytes by adenovirus can reduce the cardiomyocyte area. Among them, A is to detect the overexpression efficiency of CDYL in cardiomyocytes by western blot; B is that overexpression of CDYL significantly reduces Crotonate-induced cardiomyocyte hypertrophy; C is that overexpression of CDYL downregulates the gene expression of cardiomyocyte hypertrophy markers. ***, p < 0.001, n = 3 - 5.

[0024] Figure 4 Adeno-associated virus vector map.

[0025] Figure 5 Overexpression of CDYL in mice significantly improves heart failure caused by TAC. Among them, A is the timeline of the animal experiment design and the overexpression efficiency of CDYL in animals mediated by adeno-associated virus; B is that overexpression of CDYL significantly reduces the ejection fraction (EF) and fractional shortening (FS); C is that overexpression of CDYL significantly reduces the cross-sectional area of the myocardium; D is that overexpression of CDYL significantly alleviates myocardial fibrosis; E is that overexpression of CDYL significantly reduces the gene expression of myocardial hypertrophy and myocardial fibrosis markers. ***, p < 0.001, n = 5 - 12.

[0026] Figure 6 Overexpression of CDYL in mice significantly improves the established myocardial injury caused by TAC. Among them, A is the timeline of the animal experiment design; B is that overexpression of CDYL significantly improves the cardiac systolic function of mice; C is that overexpression of CDYL significantly reduces the cross-sectional area of the myocardium; E is that overexpression of CDYL significantly alleviates myocardial fibrosis; D is that overexpression of CDYL significantly reduces the gene expression of myocardial hypertrophy and myocardial fibrosis markers. *, p < 0.05, ***, p < 0.001, n = 5 - 12. Detailed implementation methods

[0027] The present invention provides a recombinant vector expressing chromatin domain Y-like protein CDYL, and the recombinant vector contains a gene encoding chromatin domain Y-like protein CDYL, which can overexpress CDYL in vivo, thereby preventing or treating heart failure.

[0028] First, the present invention analyzed the gene expression of the enzymes directly regulating crotonyl-CoA metabolism in human heart failure and found that CDYL had significant changes in heart failure. Then, by plotting the Receiver Operating Characteristic (ROC) curve, it was found that CDYL showed the highest efficiency in predicting heart failure, suggesting that CDYL may be closely related to heart failure.

[0029] After that, the present invention established a heart failure model by transverse aortic constriction (TAC) surgery and detected the expression of CDYL protein in the myocardial tissues of normal mice and mice with heart failure induced by TAC. It was found that compared with the normal heart, the expression of CDYL in the heart with heart failure induced by TAC was significantly down-regulated, which was the same trend as that in human heart failure. At the same time, the present invention also constructed a heart failure model by angiotensin II and detected the expression of CDYL protein in the myocardial tissues of normal mice and mice with heart failure induced by angiotensin II (Ang II). It was found that compared with the normal heart, the expression of CDYL in the heart with heart failure induced by angiotensin II was significantly down-regulated, which was also the same trend as that in human heart failure.

[0030] Therefore, the present invention conducted cell experiments. By constructing an adenovirus (Adv) that synthetically overexpresses CDYL, the effect of Ad-CDYL infection on cardiomyocyte hypertrophy was detected in cardiomyocytes. The results showed that the adenovirus significantly up-regulated the protein expression of CDYL in cardiomyocytes. And overexpression of CDYL significantly reduced the cardiomyocyte area and the gene expression of cardiomyocyte hypertrophy markers Nppa, Nppb, and Myh7, suggesting that CDYL may be related to cardiomyocyte hypertrophy and heart failure.

[0031] Subsequently, animal experiments were conducted on the present invention. An adeno-associated virus (AAV) carrying the cardiac troponin T (cTnT) promoter (targeting cardiomyocytes) overexpressing CDYL was constructed and injected and delivered 2 weeks before TAC surgery and 1 week after surgery (after injury occurred). Echocardiography, pathological staining, biomarker detection, etc. were used to evaluate the effect of CDYL on heart failure 4 weeks after TAC surgery. The present invention found that overexpressing CDYL with adeno-associated virus significantly improved cardiac systolic function, reduced myocardial hypertrophy, myocardial fibrosis and heart failure caused by pressure overload whether the virus was injected before or after model construction (after injury occurred). The above research further confirmed that CDYL can be used as a target for the preparation of heart failure drugs.

[0032] The following will further explain the specific implementation manners of the present invention through examples, but it does not mean that the protection scope of the present invention is limited to the scope described in the examples.

[0033] Example 1 Screening of important crotonyl-CoA metabolic enzymes related to heart failure

[0034] The gene expression of crotonyl-CoA metabolic enzymes directly regulated in human heart failure was analyzed using a public database (GSE116250), mainly including acyl-CoA synthetase short-chain family member 2 (ACSS2), short-chain acyl-CoA dehydrogenase (ACADS), acyl-CoA oxidase 1 (ACOX1, ACOX3), glutaryl-CoA dehydrogenase (GCDH) and crotonyl-CoA hydratase CDYL. The results are as Figure 1 shown in A. The results showed that CDYL and ACADS changed significantly in heart failure. To observe the potential effects of these enzymes on heart failure, we analyzed the predictive ability of these enzymes in differentiating the control group and heart failure patients using the receiver operating characteristic (ROC) curve. The results are as Figure 1 shown in B. The results showed that CDYL showed the highest efficiency in predicting heart failure. Therefore, in subsequent experiments, we focused on the role of CDYL in heart failure.

[0035] Next, the present invention constructed a heart failure mouse model through TAC surgery and Ang II respectively, and detected the protein expression of CDYL in both models.

[0036] The specific steps are as follows:

[0037] (1) The specific implementation method of aortic arch constriction in mice is as follows: SPF-grade healthy C57BL / 6 mice (male, 6-8 weeks, 20-22g) were included and randomly divided into sham operation (Sham) group and TAC group. Before the operation, the mice were anesthetized by inhalation of isoflurane. The mice were fixed in a supine position, the chest hair of the mice was removed to expose the chest cage, the mice were intubated, and the small animal ventilator was connected to maintain the mouse's breathing. The muscles were bluntly separated and the chest cavity was opened, the thymus was separated, and the aortic arch and the first, second and third branches were exposed. A 5-0 silk thread was passed through the blood vessels between the first and second branches, and a 27G needle was used to tie the silk thread close to the aortic arch, and then the needle was removed. After the thoracotomy of the Sham group mice, only the blood vessels were exposed and the thread was passed through but not tied. The chest cavity was closed and the muscle layer and skin were sutured, and the surgical wound was disinfected with iodine. The vital signs of the mice were closely observed after the operation, and they were fed normally until the end of the experiment.

[0038] (2) Construction of an Ang II-induced heart failure mouse model: SPF-grade healthy C57BL / 6 mice (male, 8 weeks, 20-22 g) were randomly divided into a control group and an Ang II group. Angiotensin II (1.3 mg / kg / day) was subcutaneously injected into the mice using an Alzet 2004 osmotic pump. The mice were housed in a conventional manner for four weeks before the end of the experiment.

[0039] (3) Western blot detection of CDYL protein expression in a mouse heart failure model: Cells were collected to extract protein, and the protein was quantified according to the instructions of the Biyuntian BCA protein concentration kit (P0012). The loading buffer was added to the extracted protein and heated at 95°C for 10 minutes to denature the protein. Then, SDS-PAGE electrophoresis, transfer, blocking, and primary and secondary antibody incubation were performed. Finally, the PVDF membrane was developed and images were acquired, and the images were analyzed using Image J. The results are shown in Figure 2. Figure 1 C and Figure 1 As shown in D, the results showed that the protein expression of CDYL was significantly downregulated in the myocardium of mice with heart failure induced by TAC and AngⅡ.

[0040] Example 2 In vitro experiments to verify the function of CDYL

[0041] Construct an adenovirus (Adv) overexpressing CDYL. The effect of CDYL on cardiomyocyte hypertrophy was studied by infecting neonatal rat cardiomyocytes (NRCMs) with Adv. The recombinant adenovirus overexpressing CDYL used in this invention was commissioned to Hanheng Biotechnology (Shanghai) Co., Ltd. for synthesis. The vector map of pAdEasy-EF1-MCS-3flag-CMV-EGFP is as Figure 2 shown. The overexpressed target sequence is as shown in SEQ ID NO: 1.

[0042] The specific operation steps are as follows:

[0043] (1) Isolation and culture of cardiomyocytes: Isolate cardiomyocytes from neonatal SD rats (0-1d) using the differential adhesion method. First, take out the heart and place it in a Petri dish containing ice-cold PBS, squeeze out the residual blood in the heart, wash it twice with PBS, then add 0.25% trypsin and cut the heart into tissue pieces about 1 mm 3 in size. Place the tissue fragments in a 50 mL centrifuge tube, add 0.25% trypsin, and digest them on a shaker at 4°C for 3 hours. Then, terminate the digestion of the upper enzyme digestion solution with complete medium, and continue to digest the tissue mass in the tube with type II collagenase digestion solution (1.5 mg / mL) prepared with L15 medium at 37°C, 30 min each time, until no tissue fragments can be seen. Collect the supernatant containing cell digestion solution to terminate the digestion. Filter all cell suspensions through a 70 μm filter, centrifuge at low speed (400 g) for 5 min, discard the supernatant, collect and resuspend the cells. Place the cells in an incubator at 37°C and 5% CO2 for culture. After 1 h, the non-adherent cells are cardiomyocytes, and the cardiomyocytes are seeded on culture plates for further culture.

[0044] (2)Adv transfection of cardiomyocytes: On the first day, passage the cells, and the seeding density should ensure that the cell confluence reaches about 50% when virus infection is carried out on the second day. On the second day, use the 1 / 2 small-volume infection method, that is, when virus infection, first add 1 / 2 of the usual volume of fresh medium, and then supplement it to the culture volume after adenovirus infection for 4 h. Starve the cardiomyocytes 24 h after Adv infection, and then add crotonate stimulation. Randomly divide the cells into the following groups: ① Ad-Control (Ad-Ctrl) group: transfected with negative control virus; ② Ad-Control+Crotonate (Ad-Ctrl+Crotonate) group: transfected with negative control virus for 24 h and then stimulated with crotonate for 24 h to observe the effect of crotonate on the cardiomyocyte phenotype; ③ Ad-CDYL (Ad-CDYL) group: transfected with adenovirus carrying the overexpressed CDYL sequence to illustrate whether the transfected target sequence affects the physiological condition of the cells; ④ Ad-CDYL+Crotonate (Ad-CDYL+Crotonate) group: transfected with adenovirus carrying the overexpressed CDYL sequence for 24 h and then stimulated with crotonate for 24 h to illustrate the effect of the target sequence on the pathological phenotype induced by crotonate.

[0045] (3) Detection of CDYL overexpression efficiency: The specific operation steps of Western blot are carried out according to the method mentioned in Example 1. The results are as Figure 3 shown in Figure A. The results show that the recombinant adenovirus significantly overexpresses the protein expression of CDYL. It can be seen that the recombinant adenovirus constructed in the present invention can achieve the overexpression of CDYL in cardiomyocytes.

[0046] (3) Immunofluorescence staining: After corresponding treatment of neonatal rat cardiomyocytes (NRCMs), α-actinin immunofluorescence staining was performed on them according to the following steps to evaluate the effect of overexpressing CDYL on cardiomyocyte area. The specific operations are as follows: Discard the cell culture medium, gently rinse the cells with PBS buffer twice, add 4% paraformaldehyde to fix the cells, and fix at room temperature for 15 min. Rinse the cells gently on a shaker with PBS three times, 5 min each time. Use 0.5% Triton X-100 cell permeabilization solution to permeabilize the cells at room temperature for 10 min. Rinse the cells gently on a shaker with PBS three times, 5 min each time. Block the cells with 0.1% BSA blocking solution at room temperature for 30 min. After blocking, start incubating with the primary antibody. Add the primary antibody diluted with antibody diluent (α-actinin ratio is 1:200), and incubate overnight at 4°C. The next day, after rinsing three times with PBS buffer, incubate with the secondary antibody and incubate at room temperature for 2 h. Add PBS buffer and rinse three times, 5 min each time. Add DAPI staining solution to counterstain the cell nuclei and incubate at room temperature for 10 min. Image acquisition: Observe and acquire images with a confocal microscope, and then analyze them with Image J. The results are as Figure 3 shown in B. The results showed that compared with the Ad-Ctrl group, the cardiomyocyte area in the Ad-Ctrl+Crotonate group was significantly increased, while the Ad-CDYL+Crotonate group significantly reduced the Crotonate-induced increase in cell area. It indicates that overexpressing CDYL can significantly reduce Crotonate-induced cardiomyocyte hypertrophy.

[0047] (4) Detection of the expression of myocardial cell hypertrophy marker genes: After extracting RNA according to the instructions of the kit (Accurate Biotechnology, AG21024), reverse transcription reaction and RT-qPCR were performed to detect the expression of related genes. The reverse transcription reaction system is as follows: 5×Reverse Transcripition buffer (4 μL), Primer Mix (1 μL), RT Enzyme Mix (1 μL), RNA and RNAase free Water (14 μL). The PCR amplification reaction system consists of the following components: SYBR Green Real time PCR Master Mix (10 μL), upstream primer (10 μM, 1 μL); downstream primer (10 μM, 1 μL), cDNA and RNAase free Water (8 μL); The PCR reaction procedure is: pre-denaturation (95 °C, 2 min); amplification reaction (95 °C, 10 s; 59 °C, 10 s; 72 °C, 15 s), 40 cycles; melting curve analysis (65 - 95 °C). The results showed that compared with the control group, the expression of genes such as Nppa and Nppb in the CDYL overexpression group was significantly decreased ( Figure 3 C). It indicates that overexpression of CDYL significantly reduces the expression of heart failure marker genes. The upstream primer sequence of rat Nppa: GAAGATGCCGGTAGAAGATGAG (SEQ ID NO: 2), the downstream primer sequence of rat Nppa: AGAGCCCTCAGTTTGCTTTTC (SEQ ID NO: 3); the upstream primer sequence of rat Nppb: GGTGCTGCCCCAGATGATT (SEQ ID NO: 4), the downstream primer sequence of rat Nppb: CTGGAGACTGGCTAGGACTTC (SEQ ID NO: 5); the upstream primer sequence of rat Gapdh: TGACAACTCCCTCAAGATTGTCA (SEQ ID NO: 6); the downstream primer sequence of rat Gapdh: GGCATGGACTGTGGTCATGA (SEQ ID NO: 7).

[0048] Example 3 In vivo experiment in mice to verify the function of CDYL

[0049] Construct an adeno-associated virus carrying a cTnT promoter-targeted myocardial cell overexpressing CDYL, and entrust Hanheng Biotechnology (Shanghai) Co., Ltd. for synthesis. The vector map of pHBAAV-TNT-3flag-P2A-EGFP is as follows Figure 4 shown. The overexpressed target sequence is as shown in SEQ: NO: 1.

[0050] A mouse heart failure model induced by pressure overload was constructed. The virus was injected 2 weeks before TAC and 1 week after TAC, respectively. At 4 weeks after TAC, echocardiography, pathological staining, detection of gene markers, etc. were used to evaluate the effect of CDYL on heart failure.( Figure 5 A and 6A).

[0051] (1) The specific operation of the mouse aortic arch constriction was carried out according to the method mentioned in Example 1.

[0052] (2) Detection of the in vivo overexpression efficiency of CDYL: The mouse heart was taken, and the overexpression efficiency of CDYL in the myocardial tissue was detected according to the western blot operation in Example 2. The results are shown as Figure 5 shown in A.

[0053] (3) Evaluation of mouse cardiac function: Before echocardiography, the mice were anesthetized by inhaling isoflurane. The anesthetized mice were fixed on the monitoring table in the supine position, and the hair on the chest of the mice was removed. During the echocardiography examination, the heart rate of the mice needed to be maintained at 400 - 500 beats / min. Using the 3100 small animal high-frequency ultrasound imaging system, the MX400 probe (30 MHz) was selected. After continuously observing several cardiac cycles in the long-axis section and short-axis section, echocardiogram images were collected. The Vevo LAB 5.5.1 software was used to analyze the images and calculate EF and FS to evaluate the cardiac function of the mice. The results are shown as Figure 5 shown in B. The results showed that overexpression of CDYL in animals significantly up-regulated the EF and FS values, indicating that CDYL could significantly improve the left ventricular systolic function induced by TAC. In addition, as Figure 6 shown in B, in the established myocardial injury model, overexpression of CDYL also significantly up-regulated the EF and FS values. The above results indicate that CDYL can also play a role in improving the left ventricular systolic function in the established myocardial injury model.

[0054] (4) Histopathological staining of diseased tissues: ① After fixing the heart tissues for 24 h, perform routine dehydration, clearing, paraffin embedding, sectioning, and hematoxylin-eosin (H&E) staining. After staining, cover the slides and scan the sections. ② Dewax the tissue sections at room temperature, then rinse with distilled water, perform antigen retrieval with an antigen retrieval solution, add FITC-labeled wheat germ agglutinin (FITC-WGA), incubate in a wet box at room temperature for 1 h, stain the nuclei with DAPI, and then cover the slides. Observe and scan under a microscope. Then analyze the cross-sectional area of the myocardium using Image pro plus software. ③ Dewax the tissue sections routinely to water, stain with the prepared Weigert iron hematoxylin staining solution, differentiate with acidic ethanol differentiating solution, blue with Masson blueing solution, stain with ponceau fuchsin staining solution, wash with water between each staining. After staining with ponceau fuchsin, wash with a weak acid working solution (the ratio of the weak acid working solution is distilled water: weak acid solution = 2:1), then wash with phosphomolybdic acid solution, and then directly place it in aniline blue staining solution for staining. After washing with the prepared weak acid working solution, dehydrate quickly with 95% ethanol, continue to dehydrate with absolute ethanol 3 times, and finally clear with xylene 3 times and cover the slides with neutral gum. After staining, scan the sections. After obtaining the scanned images, analyze the myocardial collagen deposition using Image J software. The results are as Figure 5 shown in Figure 5 Figures C and Figure 6 shown in Figure 6 Figures D. It can be seen from the results that overexpression of CDYL in animals significantly reduced the cross-sectional area of the myocardium and the myocardial fibrosis area. In addition, in the established myocardial injury model shown in

[0055] Figures C and Figure 6 D, overexpression of CDYL also had the same effect. These results indicate that CDYL can significantly improve myocardial hypertrophy, myocardial fibrosis, and heart failure caused by TAC.

[0055] (5) Detection of heart failure marker genes: Collect myocardial tissues to extract total RNA, and perform reverse transcription reaction and RT-qPCR according to the operations mentioned in Example 2 to detect the gene expression of heart failure markers. The primers for mouse marker genes used are as follows: Nppa forward primer sequence: TCTTCCTCGTCTTGGCCTTT (SEQ ID NO: 8), Nppa reverse primer sequence: CCAGGTGGTCTAGCAGGTTC (SEQ ID NO: 9); Nppb forward primer sequence: TGGGAGGTCACTCCTATCCT (SEQ ID NO: 10), Nppb reverse primer sequence: GGCCATTTCCTCCGACTTT (SEQ ID NO: 11); Myh7 forward primer sequence: CGGACCTTGGAAGACCAGAT (SEQ ID NO: 12); Myh7 reverse primer sequence: GACAGCTCCCCATTCTCTGT (SEQ ID NO: 13); Fn forward primer sequence: TAGGATTGGAGACACGTGGA (SEQ ID NO: 14), Fn reverse primer sequence: TGCGGTTGGTAAATAGCTGT (SEQ ID NO: 15); Ctgf forward primer sequence: GGACACCTAAAATCGCCAAGC (SEQ ID NO: 16), Ctgf reverse primer sequence: ACTTAGCCCTGTATGTCTTCACA (SEQ ID NO: 17); Gapdh forward primer sequence: AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 18); Gapdh reverse primer sequence: TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO: 19). The results are as Figure 5 shown in Figure E. It can be seen from the results that overexpression of CDYL in animals significantly reduced the gene expression of myocardial hypertrophy markers Nppa, Nppb, and Myh7, and also significantly reduced the gene expression of myocardial fibrosis markers Col1a1, Fn1, and Ctgf. In the results shown in Figure 6 Figure E, in the established TAC model, overexpression of CDYL also significantly reduced the gene expression of myocardial hypertrophy markers Nppa, Nppb, and Myh7, and myocardial fibrosis markers Col1a1, Fn1, and Ctgf. This result indicates that overexpression of CDYL can significantly reduce the gene expression related to heart failure.

[0056] From the above experimental results, it can be seen that CDYL is an important target for developing drugs for the treatment of heart failure. Overexpression of CDYL can significantly improve ventricular systolic function, significantly improve myocardial hypertrophy, myocardial fibrosis and heart failure caused by TAC, and can also significantly reduce the gene expression related to heart failure, thereby exerting the effects of preventing and treating heart failure, which has important significance.

Claims

1. Use of a recombinant vector expressing chromatin domain Y-like protein CDYL or its host cell in the preparation of a drug for preventing or treating heart failure, wherein the recombinant vector contains a gene encoding chromatin domain Y-like protein CDYL; the nucleotide sequence of the gene encoding chromatin domain Y-like protein CDYL is as shown in SEQ ID NO:

1.

2. The use according to claim 1, wherein: The heart failure is caused by pressure overload.

3. The use according to claim 1, wherein: The heart failure includes left ventricular systolic dysfunction, myocardial hypertrophy or myocardial fibrosis.

Images