Oligonucleotide compositions and methods thereof

Abstract

The present disclosure provides, among other things, oligonucleotides targeting calpain-2 modified at the 2 '-position of a sugar residue and compositions thereof. In some embodiments, the disclosure provides methods for the prevention and treatment of various conditions, disorders, or diseases, including neurodegenerative conditions.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application Serial No. 63 / 340,365, filed May 10, 2022, and U.S. Provisional Application Serial No. 63 / 397,707, filed August 12, 2022, the entire contents of each of which are incorporated herein by reference. Background Art

[0003] Oligonucleotides can be used in various applications, such as therapeutic applications, diagnostic applications and / or research applications. For example, oligonucleotides targeting various genes can be used to treat conditions, disorders or diseases associated with such target genes.

[0004] Overview

[0005] Among other things, the present disclosure provides techniques (e.g., oligonucleotides, compositions, methods, etc.) for treating various conditions, disorders, or diseases associated with calpain-2. In some embodiments, the present disclosure provides oligonucleotides comprising various modifications (e.g., nucleobase modifications, sugar modifications, internucleotide linkage modifications, etc.) and that can hybridize to calpain-2 transcripts. In some embodiments, the present disclosure provides oligonucleotides and compositions thereof that can reduce the level of calpain-2 transcripts when administered or delivered to a system comprising or expressing calpain-2 transcripts. In some embodiments, the technology provided reduces the level of calpain-2 transcripts and / or polypeptides in the system. In some embodiments, the present disclosure provides techniques for preventing and / or treating various conditions, disorders, or diseases associated with calpain-2.

[0006] In some embodiments, the present disclosure encompasses the recognition that oligonucleotides of certain base sequences may be more effective in reducing the level of calpain-2 transcripts (e.g., calpain-2 mRNA) and / or their products (e.g., calpain-2 polypeptides). In some embodiments, the base sequence of the oligonucleotide comprises about 5 or more (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) consecutive nucleobases of ATCAGTTTCTGTAGGCTTCC, GGCATACTGGTTCAGTTGAT, GCTCAGGTCAGGCAGTGGTT, GAGAGCCTTTTTGCAGAGCT, TCCAGCTCTGTGCCTCTAGT, GTTCCAGCTTGGGCAGTTGT, or GGAAGCTTAGTCCTTGGCTG, wherein each T is optionally and independently replaced by U. In some embodiments, the base sequence of the oligonucleotide is ATCAGTTTCTGTAGGCTTCC, GGCATACTGGTTCAGTTGAT, GCTCAGGTCAGGCAGTGGTT, GAGAGCCTTTTTGCAGAGCT, TCCAGCTCTGTGCCTCTAGT, GTTCCAGCTTGGGCAGTTGT or GGAAGCTTAGTCCTTGGCTG. In some embodiments, the oligonucleotide provided comprises various modifications, such as core base modifications, sugar modifications, internucleotide linkage modifications, etc. Various useful modifications are available in the art and can be utilized according to the disclosure. In some embodiments, modification provides various benefits, such as improved stability, binding affinity, pharmacokinetic profile, pharmacodynamic profile, etc.

[0007] For example, in some embodiments, oligonucleotides are provided that include various sugar modifications. In some embodiments, the modified sugar is a 2'-OR s Modified natural RNA sugars, where R s is optionally substituted C 1-6 Aliphatic, and -OR s Replacement of 2'-OH group ("2'-OR s In some embodiments, R s is optionally substituted C 1-6 In some embodiments, R s In some embodiments, R s It is -CH2CH2OCH3.

[0008] In some embodiments, provided oligonucleotides comprise or consist of a wing-core-wing structure, wherein about 1-10 (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleosides are independently present in each wing, about 5 or more (e.g., about 5-20, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc.) nucleosides are present in the core, and each wing independently comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified sugars. In some embodiments, each sugar in a wing is independently a modified sugar. In some embodiments, each sugar in a wing is independently 2'-OR s In some embodiments, the modified sugar is a 2'-MOE modified sugar (2'-OR s Modified sugars, where R s In some embodiments, each wing independently comprises one or more (e.g., about 1, 2, 3, 4, 5, or more) 2'-MOE modified sugars. In some embodiments, each sugar in a wing is independently a 2'-MOE modified sugar. In some embodiments, the core region comprises fewer modified sugars and / or lower levels of modified sugars compared to one or both wings. In some embodiments, no modified sugars are present in the core region. In some embodiments, each sugar in the core region is independently a natural DNA sugar.

[0009] Additionally or alternatively, in some embodiments, the oligonucleotide provided comprises the internucleotide bond of modification.In some embodiments, compared with natural phosphate bond, the internucleotide bond of modification provides improved properties and / or activity.Various internucleotide bond is available in this area, and can be utilized according to the disclosure.In some embodiments, the internucleotide bond of modification is a thiophosphate internucleotide bond (-OP (O) (SH) -O-, which can exist with various salt forms).In some embodiments, each bond in the oligonucleotide provided is a thiophosphate internucleotide bond.

[0010] In some embodiments, the invention provides the technology of preparing oligonucleotide and composition thereof.In some embodiments, the oligonucleotide provided and composition thereof have high purity.In some embodiments, oligonucleotide is provided as a diastereoisomer mixture relative to the phosphorus of chiral link, for example, in phosphorothioate internucleotide link.In some embodiments, one or more diastereoisomers relative to the phosphorus of chiral link are enriched in the composition provided.

[0011] As described herein, the oligonucleotides and compositions of the present disclosure can be provided / utilized in various forms. In some embodiments, the present disclosure provides compositions comprising one or more forms of oligonucleotides, such as an acid form (e.g., in an acid form, the natural phosphate linkage is present as –O(P(O)(OH)-O- and the phosphorothioate internucleotide linkage is present as –O(P(O)(SH)-O-), a salt form (e.g., in a salt form, one or more or all of the natural phosphate linkages are in salt form (e.g., a sodium salt (–O(P(O)(O - Na + )-O-)) independently exist, one or more or all of the phosphorothioate internucleotide linkages are in salt form (e.g., sodium salt (-O(P(O)(S - Na + )-O-), hydrates, etc. As will be appreciated by those skilled in the art, oligonucleotides may exist in various salt forms (including pharmaceutically acceptable salts), and in solutions (e.g., various aqueous buffer systems), cations may dissociate from anions. In some embodiments, the present disclosure provides pharmaceutical compositions comprising provided oligonucleotides and / or one or more pharmaceutically acceptable salts thereof, and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is or comprises a buffer. In some embodiments, the pharmaceutically acceptable carrier is buffered saline. In some embodiments, the pharmaceutically acceptable carrier is artificial cerebrospinal fluid (aCSF). In some embodiments, the pharmaceutically acceptable carrier is cerebrospinal fluid.

[0012] In some embodiments, this disclosure describes useful techniques for evaluating oligonucleotides and compositions thereof. Certain useful techniques are described in the Examples.

[0013] The technology provided can be used for various purposes. For example, in some embodiments, the technology provided can be used to prevent and / or treat various conditions, disorders or diseases associated with calpain-2. In some embodiments, the present disclosure provides methods for preventing conditions, disorders or diseases, comprising administering or delivering an effective amount of the provided oligonucleotide to a subject susceptible thereto. In some embodiments, the present disclosure provides methods for treating conditions, disorders or diseases, comprising administering or delivering an effective amount of the provided oligonucleotide to a subject suffering from the conditions, disorders or diseases. In some embodiments, the oligonucleotide is administered or delivered in a pharmaceutical composition. In some embodiments, the oligonucleotide is administered or delivered in one or more forms, for example, in some embodiments, in one or more pharmaceutically acceptable salt forms. In some embodiments, the oligonucleotide is administered or delivered in a solution, for example, in an aCSF solution. Various technologies are available in the art and can be used to administer or deliver the provided oligonucleotides and compositions thereof. For example, in some embodiments, the oligonucleotides and compositions are administered or delivered intrathecally.

[0014] In some embodiments, the condition, disorder or disease is a neurodegenerative condition, disorder or disease. In some embodiments, the condition, disorder or disease is or includes Wallerian degeneration. In some embodiments, the condition, disorder or disease is associated with Wallerian degeneration. In some embodiments, the condition, disorder or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder or disease is neuropathy. In some embodiments, the condition, disorder or disease is peripheral neuropathy. In some embodiments, the condition, disorder or disease is chemotherapy-induced peripheral neuropathy. In some embodiments, the condition, disorder or disease is Parkinson's disease. In some embodiments, the condition, disorder or disease is Huntington's disease. In some embodiments, the condition, disorder or disease is Alzheimer's disease. In some embodiments, the condition, disorder or disease is frontotemporal dementia. In some embodiments, the condition, disorder or disease is brain injury. In some embodiments, the condition, disorder or disease is traumatic brain injury. In some embodiments, the condition, disorder, or disease is progressive supranuclear palsy. In some embodiments, the condition, disorder, or disease is corticobasal degeneration. In some embodiments, the condition, disorder, or disease is Wolfram syndrome. In some embodiments, the condition, disorder, or disease is Friedreich's Ataxia. In some embodiments, the condition, disorder, or disease is multiple system atrophy. In some embodiments, the condition, disorder, or disease is spinocerebellar ataxia. In some embodiments, the condition, disorder, or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder, or disease is Pick's disease. In some embodiments, the condition, disorder, or disease is progressive motor atrophy. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1. The provided oligonucleotides can reduce the level of calpain-2 (CAPN2) mRNA. (A) and (B): It is demonstrated that various oligonucleotides can knock down CAPN2. Glutamatergic neurons derived from human iPSCs were treated by gymnotic uptake for 48 hours using various oligonucleotides targeting CAPN2. The cells were lysed and RNA was collected. RNA was used for real-time RT-qPCR to quantify the fold change of CAPN2 expression. The average fold change of CAPN2 expression of biological replicates (black dots) is shown in the upper graph, the average CAPN2 Cp value of technical replicates (black dots) is shown in the middle graph, and the average RPLP0 Cp value of technical replicates (black dots) is shown in the lower graph. The X-axis represents the oligonucleotide; the Y-axis depicts the fold change of CAPN2 expression (upper graph), CAPN2 Cp value (middle graph) or RPLP0 Cp value (lower graph). The dotted horizontal line represents the corresponding fold change or Cp value from the negative control treated with only the vehicle. Error bars represent standard deviation.

[0016] Figure 2 . Various oligonucleotides provided provide knockdown of calpain-2 (CAPN2). Various oligonucleotides were evaluated to knock down CAPN2. Glutamatergic neurons derived from human iPSCs were treated by naked uptake for 48 hours using various oligonucleotides targeting CAPN2 or NEAT1 (positive and negative controls). Cells were lysed and RNA was collected. RNA was used for real-time RT-qPCR to quantify the fold change of CAPN2 or NEAT1 expression. The average fold change of CAPN2 or NEAT1 expression of biological replicates (black dots) is shown in the upper figure, the average CAPN2 or NEAT1 Cp value of technical replicates (black dots) is shown in the middle figure, and the average RPLP0 Cp value of technical replicates (black dots) is shown in the lower figure. The X-axis represents oligonucleotides; the Y-axis depicts the fold change of CAPN2 or NEAT1 expression (upper figure), CAPN2 or NEAT1 Cp value (middle figure) or RPLP0 Cp value (lower figure). The dotted horizontal line represents the corresponding fold change or Cp value from the negative control treated with only the vehicle. Error bars represent standard deviation. For NEAT1, from left to right, vehicle, positive control, and negative control. For calpain-2 (CAPN2), from left to right, vehicle, positive control for NEAT1, negative control, and various evaluated oligonucleotides.

[0017] Figure 3. Compared with vehicle treatment, the various oligonucleotides provided did not show obvious cytotoxicity. It was confirmed that the various oligonucleotides did not significantly change the percentage of viable cells. Glutamatergic neurons derived from human iPSC were treated for 48 hours by naked uptake using various oligonucleotides. After this incubation period, cells were harvested and Hoechst stained (5 μg / mL). The number of living cells, dead cells and total (live + dead) cells was counted, and the percentage of viable cells was calculated. The average viable cell percentage of biological replicates is shown in the upper figure, and the average viable cell count of biological replicates is shown in the lower figure. The X-axis represents oligonucleotides; the Y-axis depicts the percentage of viable cells in the total cells (upper figure) or the total viable cell count (lower figure). The dotted horizontal line represents the corresponding viable cell percentage or total viable cell count when treated with only the vehicle. Error bars represent standard deviations.

[0018] Figure 4 . The oligonucleotides provided can reduce the level of calpain-2 (CAPN2) mRNA. It was demonstrated that the oligonucleotides provided knock down CAPN2 in a dose-dependent manner. Spinal motor neurons derived from human iPSCs were treated with different concentrations (e.g., 20, 6.329, 2.003, 0.634, 0.201, 0.063, 0.020, 0.006 μM) of the indicated oligonucleotides targeting CAPN2 or a negative control (targeting TUG1) for 72 hours. The cells were lysed and RNA was collected. RNA was used for real-time RT-qPCR to quantify CAPN2 knockdown. The X-axis represents the concentration of the oligonucleotide; the Y-axis represents the percentage of knockdown of calpain-2 (CAPN2). Each data point represents the mean of repeated treatments, except that the data points for oligonucleotide 39 at 6.329 μM and oligonucleotides 14 and 39 at 0.201 μM represent single replicates. Error bars represent standard deviations. Figure 5. The oligonucleotides provided can provide neuroprotection. It was demonstrated that the oligonucleotides provided reduce NF-L secretion after exposure to toxic triggers (e.g., vincristine, rotenone, or colchicine). Spinal motor neurons derived from human iPSCs were treated for 48 hours using 20 μM of indicated oligonucleotides targeting CAPN2 or oligonucleotides targeting TUG1 by naked uptake. 48 hours after the initial treatment with the oligonucleotides, neurons were treated for 24 hours again with 20 μM of indicated oligonucleotides by naked uptake and various toxic triggers (e.g., vincristine (1.5 nM, 3 nM, or 6 nM), rotenone (5 μM, 10 μM, or 15 μM), colchicine (10 nM, 100 nM, or 1000 nM). 24 hours after exposure to toxic triggers, supernatants were collected and NF-L was measured using a commercially available kit. The X-axis represents the treatment (e.g., vehicle (TE buffer), negative control oligonucleotide targeting TUG1, oligonucleotide composition 14); the Y-axis depicts the relative concentration of NF-L levels normalized to vehicle control after exposure to toxic triggers (e.g., vincristine (A), rotenone (B), colchicine (C)). Means are represented by bars with technical replicates (N=4) represented by black dots. Error bars represent standard deviations. Statistical analysis was performed using one-way ANOVA with Dunnett's t-test (vehicle vs. TUG1 / ASO14) and unpaired t-test (TUG1 vs. ASO14); * =p<0.05, ** =p<0.005, *** =p<0.0005, ns=not significant.

[0019] Figure 6 . The oligonucleotides provided can provide knockdown of calpain-2 (CAPN2) mRNA. Motor neurons derived from human iPSCs were treated by naked uptake for 48 hours using various oligonucleotide compositions targeting CAPN2 or TUG1. After 48 hours, the culture medium was replaced to remove the oligonucleotides. After removal of the oligonucleotides, the cells were lysed and RNA was collected at different time points (0, 3, 7, 10, 14, 21 days). RNA was used for RT-qPCR to quantify CAPN2 expression. The knockdown percentage of CAPN2 was determined compared to the knockdown percentage of the average negative control CAPN2 at the corresponding time points. The average value is represented by a bar, and replicates (N=3) are indicated by dots or triangles. The X-axis represents the number of days after oligonucleotide removal (D0, D3, D7, D10, D14, D21); the Y-axis depicts the knockdown percentage of CAPN2. Error bars represent standard deviations. Figure 7. The oligonucleotides provided can provide knockdown of calpain-2 protein. Motor neurons derived from human iPSCs were treated by naked uptake for 48 hours using an oligonucleotide composition targeting calpain-2 (CAPN2) or TUG1 (negative control). After 48 hours, the culture medium was changed to remove the oligonucleotides. After removing the oligonucleotides, the cells were lysed at different time points (0, 3, 7, 10, 14, 21 days). The lysates were used in Western blots to quantify calpain-2 protein levels. Data for oligonucleotide 14 (A) and oligonucleotide 39 (B) are shown. The mean value is represented by a bar, and replicates (N=2) are indicated by dots or triangles. The X-axis represents the number of days after oligonucleotide removal (D0, D3, D7, D10, D14, D21); the Y-axis depicts the relative knockdown of calpain-2 protein (relative to the % of the average negative control calpain-2 protein level at the corresponding time point). Error bars represent standard deviations.

[0020] Figure 8 . Compared with vehicle treatment, the oligonucleotides provided had no significant effect on cell morphology. Motor neurons derived from human iPSC were treated for 48 hours by naked uptake using an oligonucleotide composition targeting calpain-2 (CAPN2) or TUG1 (negative control). After 48 hours, the culture medium was replaced to remove the oligonucleotides. After removing the oligonucleotides, cell morphology was assessed by bright field imaging at different time points (0, 3, 21 days). Representative images are shown. The time points (D0, D3, D21) of each row of images are represented by the labels on the left; the treatments of each column of images (carrier (TE buffer), negative control oligonucleotide targeting TUG1, oligonucleotide composition 14, oligonucleotide composition 39) are represented by the labels at the top.

[0021] Detailed Description of Certain Embodiments

[0022] The technology of the present disclosure may be understood more readily by reference to the following detailed description of certain embodiments.

[0023] definition

[0024] As used herein, unless otherwise indicated, the following definitions apply. For the purposes of this disclosure, the chemical elements are defined according to the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th edition. In addition, the general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999 and "March's Advanced Organic Chemistry", 5th edition, Ed.: Smith, MB and March, J., John Wiley & Sons, New York: 2001.

[0025] As used herein in this disclosure, unless the context clearly indicates otherwise, (i) the term "a" or "an" may be understood to mean "at least one"; (ii) the term "or" may be understood to mean "and / or"; (iii) the terms "comprising," "comprise," "including" (whether or not used with "not limited to") and "include" (whether or not used with "not limited to") may be understood to mean including the itemized components or steps, whether presented by themselves or with one or more additional components or steps; (iv) the term "another" may be understood to mean at least one additional / second one or more; (v) the terms "about" and "approximately" may be understood to allow for standard variations that would be understood by one of ordinary skill in the art; and (vi) where a range is provided, the endpoints are included.

[0026] Unless otherwise indicated, oligonucleotides and their elements (e.g., base sequence, sugar modifications, internucleotide linkages, phosphorus stereochemistry of linkages, patterns thereof, etc.) are described as being from 5' to 3'. As will be appreciated by those skilled in the art, in some embodiments, oligonucleotides may be provided and / or utilized in various forms, such as salt form, particularly pharmaceutically acceptable salt form, such as sodium salt. As will also be appreciated by those skilled in the art, in some embodiments, individual oligonucleotides in a composition may be considered to have the same composition and / or structure even though, in such composition (e.g., a liquid composition), a particular such oligonucleotide may be in different forms, such as one or more salt forms, at a particular time (and may be soluble, and the oligonucleotide chain may be present in anionic form when, for example, in a liquid composition). For example, it will be appreciated by those skilled in the art that, at a given pH, individual internucleotide linkages along an oligonucleotide chain may be in acid (H) form, or in one of a variety of possible salt forms (e.g., sodium salts or salts of different cations, depending on the ions that may be present in the formulation or composition), and it will be appreciated that as long as their acid form (e.g., with H + If all cations (if any) are substituted) have the same composition and / or structure, then these separate oligonucleotides can appropriately be considered to have the same composition and / or structure.

[0027] Aliphatic: As used herein, "aliphatic" refers to a linear (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more unsaturated units (but is not aromatic), or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is fully saturated or contains one or more unsaturated units (but is not aromatic), or a combination thereof. In some embodiments, aliphatic groups contain 1-50 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-20 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-10 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-9 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-8 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-7 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In yet other embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof, such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0028] Alkyl: As used herein, the term "alkyl" is given its ordinary meaning in the art and may include saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups. In some embodiments, the alkyl group has 1-100 carbon atoms. In certain embodiments, the straight-chain or branched alkyl group has 1-100 carbon atoms in its main chain (e.g., for a straight chain of C1-C 20 , for the branched chain C2-C 20 ) have about 1-20 carbon atoms, or about 1-10 carbon atoms. In some embodiments, the cycloalkyl ring has about 3-10 carbon atoms in its ring structure, wherein these rings are monocyclic, bicyclic or polycyclic, or have about 5, 6 or 7 carbons in the ring structure. In some embodiments, the alkyl group can be a lower alkyl group, wherein the lower alkyl group contains 1-4 carbon atoms (e.g., C1-C4 for straight chain lower alkyl).

[0029] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, animals can be transgenic animals, genetically engineered animals, and / or clones.

[0030] Characteristic portion: As used herein, the term "characteristic portion" refers in the broadest sense to a portion of a substance whose presence (or absence) is associated with the presence (or absence) of a particular characteristic, property, or activity of the substance. In some embodiments, a characteristic portion of a substance is a portion that is found in the substance and in related substances that share the particular characteristic, property, or activity, but is absent from substances that do not share the particular characteristic, property, or activity. In certain embodiments, a characteristic portion shares at least one functional characteristic with the intact substance. For example, in some embodiments, a "characteristic portion" of a nucleic acid is a portion that comprises a plurality (in some embodiments, a continuous stretch) of nucleobases that are unique to the nucleic acid.

[0031] Comparable: The term "comparable" is used herein to describe two groups (or groups) of situations or circumstances that are sufficiently similar to each other to allow comparison of the results obtained or the observed phenomena. In some embodiments, the group of comparable situations or circumstances is characterized by a plurality of substantially identical features and one or a small number of different features. One of ordinary skill in the art will recognize that groups of situations are comparable to each other when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in the results obtained or the observed phenomena under different groups of situations or circumstances are caused or indicated by variations in those features.

[0032] Heteroatom: The term "heteroatom," as used herein, refers to an atom that is not carbon or hydrogen. In some embodiments, the heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (including oxidized forms of nitrogen, sulfur, phosphorus, or silicon; charged forms of nitrogen (e.g., quaternized forms, forms in iminium groups, etc.), phosphorus, sulfur, oxygen; etc.). In some embodiments, the heteroatom is silicon, phosphorus, oxygen, sulfur, or nitrogen. In some embodiments, the heteroatom is silicon, oxygen, sulfur, or nitrogen. In some embodiments, the heteroatom is oxygen, sulfur, or nitrogen.

[0033] Identity: As used herein, the term "identity" refers to the overall relatedness between polymer molecules (e.g., between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or between polypeptide molecules). In some embodiments, polymer molecules are considered to be "substantially identical" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identical. For optimal alignment purposes (e.g., gaps can be introduced into one or both of the first and second sequences for optimal alignment, and non-identical sequences can be ignored for comparison purposes), for example, the percent identity of two nucleic acid or polypeptide sequences can be calculated by comparing the two sequences. In certain embodiments, the length of the sequence compared for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or substantially 100% of the length of the reference sequence. The nucleotides at the corresponding positions are then compared. When the position in the first sequence is occupied by the residue (such as nucleotide or amino acid) identical with the corresponding position in the second sequence, the molecule is identical at this position. Considering the number of rooms and the length of each room, the identity percentage between the two sequences is the number of the same positions shared by the sequences, and for the best comparison of the two sequences, it is necessary to introduce a room. The determination of the identity percentage between the comparison of the sequence and the two sequences can be completed using a mathematical algorithm. For example, the algorithm (CABIOS, 1989, 4:11-17) of Meyers and Miller can be used to determine the identity percentage between the two nucleotide sequences, and the algorithm has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, the nucleic acid sequence comparison using the ALIGN program has used the PAM120 weight residue table, and the gap length penalty is 12, and the gap penalty is 4. Alternatively, the NWSgapdna.CMP matrix can be used to determine the identity percentage between the two nucleotide sequences in the GCG software package using the GAP program.

[0034] Internucleotide linkage: As used herein, the phrase "internucleotide linkage" generally refers to the linkage that links the nucleoside units of an oligonucleotide or nucleic acid. In some embodiments, the internucleotide linkage is a phosphodiester linkage, such as is widely found in naturally occurring DNA and RNA molecules (natural phosphate linkage (-OP(=O)(OH)O-), which, as will be appreciated by those skilled in the art, may exist in salt form). In some embodiments, the internucleotide linkage is a modified internucleotide linkage (not a natural phosphate linkage). In some embodiments, the internucleotide linkage is a "modified internucleotide linkage" in which at least one oxygen atom or -OH of the phosphodiester linkage is replaced by a different organic or inorganic moiety. In some embodiments, such an organic or inorganic moiety is selected from =S, =Se, =NR', -SR', -SeR', -N(R')2, B(R')3, -S-, -Se-, and -N(R')-, wherein each R' is independently -H or an optionally substituted group selected from C 1-10 Aliphatic, C 6-14 Aryl, C with 1-5 heteroatoms 1-10 In some embodiments, the internucleotide linking bond is a thiophosphate linking bond. In some embodiments, the internucleotide linking bond is one of a PNA (peptide nucleic acid) or a PMO (phosphorodiamidate morpholino oligomer, phosphorodiamidate Morpholinooligomer) linking bond. Those of ordinary skill in the art will appreciate that, due to the presence of an acid or base moiety in the linking bond, at a given pH, the internucleotide linking bond can exist as an anion or cation.

[0035] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment (eg, in a test tube or reaction vessel, in cell culture, etc.), rather than within an organism (eg, an animal, plant, and / or microorganism).

[0036] In vivo: As used herein, the term "in vivo" refers to events that occur within an organism (eg, an animal, a plant, and / or a microorganism).

[0037] Phosphorus of the linkage: As defined herein, the phrase "phosphorus of the linkage" is used to indicate that the specific phosphorus atom referred to is a phosphorus atom present in an internucleotide linkage, which corresponds to the phosphorus atom of a phosphodiester internucleotide linkage as occurring in naturally occurring DNA and RNA. In some embodiments, the phosphorus atom of the linkage is in a modified internucleotide linkage, wherein each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, the phosphorus atom of the linkage is chiral (e.g., as in a thiophosphate internucleotide linkage). In some embodiments, the phosphorus atom of the linkage is achiral (e.g., as in a natural phosphate linkage).

[0038] Modified nucleobase: The terms "modified nucleobase," "modified base," and the like refer to a chemical moiety that is chemically distinct from a nucleobase but capable of performing at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase comprising a modification. In some embodiments, a modified nucleobase is capable of having at least one function of a nucleobase, for example, forming part of a polymer capable of base pairing with a nucleic acid comprising at least a complementary base sequence. In some embodiments, the modified base is a substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobase in the context of an oligonucleotide refers to a nucleobase that is not A, T, C, G, or U.

[0039] Modified nucleosides: The term "modified nucleosides" refers to moieties derived from or chemically similar to natural nucleosides, but which comprise chemical modifications that differ from natural nucleosides. Non-limiting examples of modified nucleosides include those comprising modifications on bases and / or sugars. Non-limiting examples of modified nucleosides include those having 2' modifications on sugars. Non-limiting examples of modified nucleosides also include abasic nucleosides (lacking a core base). In some embodiments, the modified nucleosides can have at least one function of a nucleoside, for example, forming a portion in a polymer that can base pair with a nucleic acid comprising at least a complementary base sequence.

[0040] Modified nucleotides: The term "modified nucleotides" includes any chemical moiety that is structurally different from a natural nucleotide but is capable of performing at least one function of a natural nucleotide. In some embodiments, the modified nucleotides include modifications at the sugar, base, and / or internucleotide linkage. In some embodiments, the modified nucleotides comprise a modified sugar, a modified nucleobase, and / or a modified internucleotide linkage. In some embodiments, the modified nucleotides are capable of having at least one function of a nucleotide, for example, forming a subunit in a polymer capable of base pairing with a nucleic acid comprising at least a complementary base sequence.

[0041] Modified sugar: The term "modified sugar" refers to a moiety that can replace a sugar. The modified sugar mimics the spatial arrangement, electronic properties, or certain other physicochemical properties of the sugar. In some embodiments, the modified sugar is a substituted ribose or deoxyribose, as described in the present disclosure. In some embodiments, the modified sugar comprises a 2'-modification. Examples of useful 2'-modifications are widely used in the art and described herein. In some embodiments, the 2'-modification is 2'-F. In some embodiments, the 2'-modification is 2'-OR, wherein R is an optionally substituted C 1-10 In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the modified sugar is a bicyclic sugar (e.g., a sugar used in LNA, BNA, etc.). In some embodiments, in the context of an oligonucleotide, the modified sugar is a sugar that is not a ribose or deoxyribose sugar commonly found in natural RNA or DNA.

[0042] Nucleic acid: The term "nucleic acid", as used herein, includes any nucleotide and polymers thereof. The term "polynucleotide", as used herein, refers to a polymeric form of nucleotides of any length (ribonucleotides (RNA) or deoxyribonucleotides (DNA) or a combination thereof). These terms refer to the primary structure of the molecule and, therefore, include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. These terms include analogs of RNA or DNA as equivalents, analogs of which contain modified nucleotides and / or modified polynucleotides (for example, but not limited to methylated, protected and / or capped nucleotides or polynucleotides). These terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N- or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified internucleotide linkages. The term encompasses nucleic acids containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified internucleotide linkages. Examples include, but are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxyribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties. Unless otherwise indicated, the prefix poly- refers to nucleic acids containing 2 to about 10,000 nucleotide monomer units, and the prefix oligo- refers to nucleic acids containing 2 to about 200 nucleotide monomer units.

[0043] Nucleobase: The term "nucleobase" refers to the portion of a nucleic acid that participates in hydrogen bonds that bind a nucleic acid strand to another complementary strand in a sequence-specific manner. The most common naturally occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the naturally occurring nucleobase is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the naturally occurring nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleobase comprises a heteroaryl ring, wherein the ring atoms are nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some embodiments, the nucleobase comprises a heterocyclic ring, wherein the ring atoms are nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some embodiments, the nucleobase is a "modified nucleobase" which is a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobase is a substituted A, T, C, G, or U. In some embodiments, the modified base is a substituted tautomer of A, T, C, G, or U. In some embodiments, the modified nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the spatial arrangement, electronic properties, or certain other physicochemical properties of the nucleobase and retains the properties of hydrogen bonds that bind one nucleic acid chain to another nucleic acid chain in a sequence-specific manner. In some embodiments, the modified nucleobase can pair with all five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without significantly affecting the unwinding behavior of the oligonucleotide duplex, recognition by intracellular enzymes, or activity. As used herein, the term "nucleobase" also encompasses structural analogs used to replace natural or naturally occurring nucleotides, such as modified nucleobases and nucleobase analogs. In some embodiments, a nucleobase is an optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U. In some embodiments, a "nucleobase" refers to a nucleobase unit in an oligonucleotide or nucleic acid (e.g., A, T, C, G, or U in an oligonucleotide or nucleic acid).

[0044] Nucleoside: The term "nucleoside" refers to a moiety in which a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar. In some embodiments, a nucleoside is a natural nucleoside, such as adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, such as a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, such as a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, a "nucleoside" refers to a nucleoside unit in an oligonucleotide or nucleic acid.

[0045] Nucleotide: The term "nucleotide" as used herein refers to the monomeric unit of a polynucleotide consisting of a nucleobase, a sugar, and one or more internucleotide linkages (e.g., phosphate linkages in natural DNA and RNA). Naturally occurring bases [guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)] are derivatives of purines or pyrimidines, although it is understood that naturally occurring and non-naturally occurring base analogs are also included. Naturally occurring sugars are the pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), although it is understood that naturally occurring and non-naturally occurring sugar analogs are also included. Nucleotides are linked by internucleotide linkages to form nucleic acids or polynucleotides. Many internucleotide linkages are known in the art (e.g., although not limited to, phosphates, phosphorothioates, boranophosphates, etc.). Artificial nucleic acids include PNA (peptide nucleic acid), phosphotriester, phosphorothioate, H-phosphonate, phosphoramidate, borophosphate (boranophosphate), methylphosphonate, phosphonoacetate, thiophosphonoacetate and other variants of the phosphate backbone of natural nucleic acids, such as those described herein. In some embodiments, natural nucleotides include naturally occurring bases, sugars and internucleotide linkages. As used herein, the term "nucleotide" also encompasses structural analogs for replacing natural or naturally occurring nucleotides, such as modified nucleotides and nucleotide analogs. In some embodiments, "nucleotide" refers to a nucleotide unit in an oligonucleotide or nucleic acid.

[0046] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotides and may comprise any combination of natural and unnatural nucleobases, sugars, and internucleotide linkages.

[0047] Oligonucleotide can be single-stranded or double-stranded.Single-stranded oligonucleotide can have double-stranded region (being formed by two parts of single-stranded oligonucleotide), and the double-stranded oligonucleotide comprising two oligonucleotide chains can have single-stranded region, for example, in the region that two oligonucleotide chains are not complementary to each other.Example oligonucleotide includes but is not limited to structural gene, the gene including control region and terminator, self-replication system such as virus or plasmid DNA, single-stranded and double-stranded RNAi reagent and other RNA interference reagents (RNAi reagent or iRNA reagent), shRNA, antisense oligonucleotide, ribozyme, microRNA, microRNA mimics, supermicroRNA (supermir), fit, antimir, antagomir, Ul adapter (adaptor), the oligonucleotide that triplex forms, G-quadruplex oligonucleotide, RNA activator, immunostimulatory oligonucleotide and decoy oligonucleotide.

[0048] Oligonucleotides of the present disclosure can have various lengths. In specific embodiments, the length of the oligonucleotide can be between about 2 to about 200 nucleotides. In various related embodiments, the length of the oligonucleotide, strand, double strand or triple strand can be from about 4 to about 10 nucleosides, from about 10 to about 50 nucleosides, from about 20 to about 50 nucleosides, from about 15 to about 30 nucleosides, from about 20 to about 30 nucleosides. In some embodiments, the length of the oligonucleotide is from about 9 to about 39 nucleosides. In some embodiments, the length of the oligonucleotide is from about 25 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 26 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 27 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 28 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 29 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 30 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 31 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 32 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 25 to about 60 nucleosides. In some embodiments, the length of the oligonucleotide is from about 25 to about 50 nucleosides. In some embodiments, the length of the oligonucleotide is from about 25 to about 40 nucleosides. In some embodiments, the length of the oligonucleotide is from about 30 to about 40 nucleosides. In some embodiments, the length of the oligonucleotide is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleosides. In some embodiments, the length of the oligonucleotide is at least 4 nucleosides. In some embodiments, the length of the oligonucleotide is at least 5 nucleosides. In some embodiments, the length of the oligonucleotide is at least 6 nucleosides. In some embodiments, the length of the oligonucleotide is at least 7 nucleosides. In some embodiments, the oligonucleotide is at least 8 nucleosides in length. In some embodiments, the oligonucleotide is at least 9 nucleosides in length. In some embodiments, the oligonucleotide is at least 10 nucleosides in length. In some embodiments, the oligonucleotide is at least 11 nucleosides in length. In some embodiments, the oligonucleotide is at least 12 nucleosides in length. In some embodiments, the oligonucleotide is at least 15 nucleosides in length. In some embodiments, the oligonucleotide is at least 15 nucleosides in length. In some embodiments, the oligonucleotide is at least 16 nucleosides in length. In some embodiments, the oligonucleotide is at least 17 nucleosides in length. In some embodiments, the oligonucleotide is at least 18 nucleosides in length. In some embodiments, the oligonucleotide is at least 19 nucleosides in length. In some embodiments, the oligonucleotide is at least 20 nucleosides in length.In some embodiments, the oligonucleotide is at least 25 nucleosides in length. In some embodiments, the oligonucleotide is at least 26 nucleosides in length. In some embodiments, the oligonucleotide is at least 27 nucleosides in length. In some embodiments, the oligonucleotide is at least 28 nucleosides in length. In some embodiments, the oligonucleotide is at least 29 nucleosides in length. In some embodiments, the oligonucleotide is at least 30 nucleosides in length. In some embodiments, the oligonucleotide is at least 31 nucleosides in length. In some embodiments, the oligonucleotide is at least 32 nucleosides in length. In some embodiments, the oligonucleotide is at least 33 nucleosides in length. In some embodiments, the oligonucleotide is at least 34 nucleosides in length. In some embodiments, the oligonucleotide is at least 35 nucleosides in length. In some embodiments, the oligonucleotide is at least 36 nucleosides in length. In some embodiments, the oligonucleotide is at least 37 nucleosides in length. In some embodiments, the oligonucleotide is at least 38 nucleosides in length. In some embodiments, the oligonucleotide is at least 39 nucleosides in length. In some embodiments, the oligonucleotide is at least 40 nucleosides in length. In some embodiments, the oligonucleotide is 25 nucleosides in length. In some embodiments, the oligonucleotide is 26 nucleosides in length. In some embodiments, the oligonucleotide is 27 nucleosides in length. In some embodiments, the oligonucleotide is 28 nucleosides in length. In some embodiments, the oligonucleotide is 29 nucleosides in length. In some embodiments, the oligonucleotide is 30 nucleosides in length. In some embodiments, the oligonucleotide is 31 nucleosides in length. In some embodiments, the oligonucleotide is 32 nucleosides in length. In some embodiments, the oligonucleotide is 33 nucleosides in length. In some embodiments, the oligonucleotide is 34 nucleosides in length. In some embodiments, the oligonucleotide is 35 nucleosides in length. In some embodiments, the oligonucleotide is 36 nucleosides in length. In some embodiments, the oligonucleotide is 37 nucleosides in length. In some embodiments, the oligonucleotide is 38 nucleosides in length. In some embodiments, the oligonucleotide is 39 nucleosides in length. In some embodiments, the oligonucleotide is 40 nucleosides in length. In some embodiments, each nucleoside counted in the oligonucleotide length independently comprises a core base comprising a ring having at least one nitrogen ring atom. In some embodiments, each nucleoside counted in the oligonucleotide length independently comprises A, T, C, G, or U, or an optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U.

[0049] Optionally substituted: As described herein, the compounds of the present disclosure (e.g., oligonucleotides) may contain optionally substituted moieties and / or substituted moieties. Generally, the term "substituted", whether or not preceded by the term "optionally", means that one or more hydrogens of the designated moiety are replaced by suitable substituents. Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted by more than one substituent selected from a designated group, the substituent may be the same or different at each position. In some embodiments, the optionally substituted group is unsubstituted. The substituent combinations envisioned by the present disclosure are preferably combinations of substituents that result in the formation of stable or chemically feasible compounds. The term "stable", as used herein, refers to a compound that does not substantially change when subjected to conditions that allow its production, detection, and in certain embodiments, its recovery, purification, and use for one or more purposes disclosed herein. Certain substituents are described below.

[0050] Suitable monovalent substituents on a substitutable atom (e.g., a suitable carbon atom) are independently halogen; -(CH2) 0–4 R o ; –(CH2) 0–4 OR o ;-O(CH2) 0-4 R o , –O–(CH2) 0–4 C(O)OR o ; –(CH2) 0–4 CH(OR o )2;–(CH2) 0–4 Ph, which can be used with R o Substitution; -(CH2) 0–4 O(CH2) 0–1 Ph, which can be used with R o Substitution; –CH=CHPh, which can be replaced by R o Substitution; –(CH2) 0–4 O(CH2) 0–1 -pyridyl, which can be used with R o Substitution; –NO2; –CN; –N3; (CH2) 0–4 N(R o )2;–(CH2) 0–4 N(R o )C(O)R o ;–N(R o )C(S)R o ; -(CH2) 0–4 N(R o )C(O)NR o 2;-N(Ro )C(S)NR o 2;–(CH2) 0–4 N(R o )C(O)OR o ;–N(R o )N(R o )C(O)R o ;-N(R o )N(R o )C(O)NR o 2;-N(R o )N(R o )C(O)OR o ;–(CH2) 0–4 C(O)R o ;–C(S)R o ;–(CH2) 0–4 C(O)OR o ;-(CH2) 0–4 C(O)SR o ;–(CH2) 0–4 C(O)OSiR o 3;–(CH2) 0–4 OC(O)R o ;–OC(O)(CH2) 0– 4SR o ,-SC(S)SR o ;-(CH2) 0–4 SC(O)R o ;–(CH2) 0–4 C(O)NR o 2;–C(S)NR o 2;–C(S)SR o ;–(CH2) 0–4 OC(O)NR o 2;–C(O)N(OR o )R o ;–C(O)C(O)R o ;–C(O)CH2C(O)R o ;-C(NOR o )R o ;(CH2) 0–4 SSR o ;–(CH2) 0–4 S(O)2R o ;–(CH2) 0–4 S(O)2OR o ;–(CH2) 0–4 OS(O)2R o ;-S(O)2NR o2;–(CH2) 0–4 S(O)R o ;–N(R o )S(O)2NR o 2;–N(R o )S(O)2R o ;–N(OR o )R o ;-C(NH)NR o 2;–Si(R o )3;–OSi(R o )3;-B(R o )2;-OB(R o )2;-OB(OR o )2;-P(R o )2;-P(OR o )2;-P(R o )(OR o );-OP(R o )2;-OP(OR o )2;-OP(R o )(OR o );-P(O)(R o )2;-P(O)(OR o )2;-OP(O)(R o )2;-OP(O)(OR o )2;-OP(O)(OR o )(SR o );-SP(O)(R o )2;-SP(O)(OR o )2;-N(R o )P(O)(R o )2;-N(R o )P(O)(OR o )2;-P(R o )2[B(R o )3];-P(OR o )2[B(R o )3];-OP(R o )2[B(R o )3];-OP(OR o )2[B(R o )3];–(C 1–4 linear or branched alkylene)O–N(R o )2; or –(C 1–4 linear or branched alkylene) C(O)O–N(R o )2, where each R omay be substituted as defined herein and are independently hydrogen, C 1–20 aliphatic, C having 1-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus 1–20 Heteroaliphatic, -CH2-(C 6-14 Aryl), -O(CH2) 0–1 (C 6-14 aryl), -CH2-(5-14 membered heteroaryl ring), a 5-20 membered monocyclic, bicyclic or polycyclic, saturated, partially unsaturated or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, or, notwithstanding the above definitions, two independent occurrences of R o , together with their intervening atoms or atoms, form a 5-20 membered monocyclic, bicyclic or polycyclic, saturated, partially unsaturated or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, which may be substituted as defined below.

[0051] R o Suitable monovalent substituents (or two independent occurrences of R o and the ring formed by the intermediate atoms thereof) are independently halogen, –(CH2) 0–2 R●、–(halogen R●、–(CH2) 0–2 OH, –(CH2) 0–2 OR●、–(CH2) 0–2 CH(OR●)2; -O(halogen R●), –CN, –N3, –(CH2) 0–2 C(O)R●、–(CH2) 0–2 C(O)OH, –(CH2) 0–2 C(O)OR●、–(CH2) 0–2 SR●,–(CH2) 0– 2SH, –(CH2) 0–2 NH2, –(CH2) 0–2 NHR●, –(CH2) 0–2 NR●2, –NO2, –SiR●3, -OSiR●3, -C(O)SR●, –(C 1–4 linear or branched alkylene) C(O)OR● or -SSR●, wherein each R● is unsubstituted or preceded by "halogen" substituted only with one or more halogens, and is independently selected from C 1–4 Aliphatic, –CH2Ph, –O(CH2) 0–1 Ph and a 5-6 membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur. o Suitable divalent substituents on a saturated carbon atom of include =0 and =S.

[0052] Suitable divalent substituents, for example, on suitable carbon atoms, are independently as follows: =O, =S, =NNR * 2. =NNHC(O)R * 、=NNHC(O)OR * 、=NNHS(O)2R * 、=NR * 、=NOR * 、–O(C(R * 2)) 2–3 O–or–S(C(R * 2)) 2–3 S–, where each independent occurrence of R * is selected from hydrogen, C which may be substituted as defined below 1–6 aliphatic, and unsubstituted 5-6 membered saturated, partially unsaturated or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur. Suitable divalent substituents attached to the ortho substitutable carbon of the "optionally substituted" group include: -O(CR * 2) 2– 3O–, where each independent occurrence of R * is selected from hydrogen, C which may be substituted as defined below 1–6 aliphatic, and unsubstituted 5-6 membered saturated, partially unsaturated, and aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0053] R * Suitable substituents on the aliphatic group are independently halogen, -R●, (haloR●), -OH, -OR●, -O(haloR●), -CN, -C(O)OH, -C(O)OR●, -NH2, -NHR●, -NR●2 or -NO2, wherein each R● is unsubstituted or preceded by "halo" substituted only with one or more halogens, and is independently C 1–4 Aliphatic, –CH2Ph, –O(CH2) 0–1 Ph or a 5-6 membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur.

[0054] In some embodiments, suitable substituents on the substitutable nitrogen are independently or Among them, each are independently hydrogen, C which may be substituted as defined below 1–6 aliphatic, unsubstituted -OPh, or an unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the above definition, two independent occurrences of Together with their one or more intervening atoms, they form a 3-12 membered saturated ring, partially unsaturated ring, or aryl monocyclic or aryl bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0055] Suitable substituents on the aliphatic group are independently halogen, -R●, (haloR●), -OH, -OR●, -O(haloR●), -CN, -C(O)OH, -C(O)OR●, -NH2, -NHR●, -NR●2 or -NO2, wherein each R● is unsubstituted or preceded by "halo" substituted only with one or more halogens, and is independently C 1–4 Aliphatic, –CH2Ph, –O(CH2) 0–1 Ph or a 5-6 membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur.

[0056] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety that includes at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties as defined herein.

[0057] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in an amount suitable for administration in a unit dose in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical compositions can be specially formulated for administration in solid or liquid form, including those suitable for: oral administration, such as a drench (aqueous or non-aqueous solution or suspension), tablet, such as tablet for buccal, sublingual and systemic absorption, bolus, powder, granules, paste for application to the tongue; parenteral administration, such as by subcutaneous, intramuscular, intravenous or epidural injection, such as in a sterile solution or suspension or sustained-release formulation; topical application, such as in a cream, ointment or controlled-release patch or spray to the skin, lungs, or oral cavity; intravaginally or rectally, such as in a pessary, cream or foam; sublingually; ophthalmically; transdermally; or nasally, to the lungs and to other mucosal surfaces.

[0058] Pharmaceutically acceptable: As used herein, the phrase "pharmaceutically acceptable" refers to those compounds, materials, compositions and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0059] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, that is involved in delivering or transporting the subject compound from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials that can be used as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; pH buffered solutions; polyesters, polycarbonates, and / or polyanhydrides; and other nontoxic, compatible substances used in pharmaceutical formulations.

[0060] Pharmaceutically acceptable salts: The term "pharmaceutically acceptable salts", as used herein, refers to salts of such compounds suitable for use in a pharmaceutical setting, i.e., salts suitable for use in contact with the tissues of humans and lower animals without excessive toxicity, irritation, allergic reaction, etc., within the scope of sound medical judgment, and commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, SM Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts, which are salts of amino groups formed by inorganic acids (e.g., hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid) or organic acids (e.g., acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid) or by using other methods used in the art (e.g., ion exchange). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, gluconate heptanoate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, iodine, thiazolinone, thiazolinone, iodine ... sulfate), malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. In some embodiments, provided compounds contain one or more acidic groups, such as oligonucleotides, and the pharmaceutically acceptable salt is an alkali, alkaline earth metal or ammonium (e.g., an ammonium salt of N(R)3, wherein each R is independently defined and described in this disclosure) salt. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed, where appropriate, using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, aryl groups having from 1 to 6 carbon atoms, sulfonates, and arylsulfonic acids.In some embodiments, provided compounds contain more than one acidic group, for example, an oligonucleotide can contain two or more acidic groups (e.g., in a natural phosphate linkage and / or a modified internucleotide linkage). In some embodiments, the pharmaceutically acceptable salt of such a compound, or generally speaking, a salt, contains two or more cations, which may be the same or different. In some embodiments, in a pharmaceutically acceptable salt (or generally speaking, a salt), all ionizable hydrogens in the acidic group (e.g., in an aqueous solution with a pKa no more than about 11, 10, 9, 8, 7, 6, 5, 4, 3, 2; in some embodiments, a pKa no more than about 7; in some embodiments, a pKa no more than about 6; in some embodiments, a pKa no more than about 5; in some embodiments, a pKa no more than about 4; in some embodiments, a pKa no more than about 3) are replaced by cations. In some embodiments, each phosphorothioate and phosphate group is independently present in its salt form (e.g., if it is a sodium salt, -OP(O)(SNa)-O- and -OP(O)(ONa)-O-, respectively). In some embodiments, each phosphorothioate and phosphate internucleotide linkage is independently present in its salt form (e.g., if a sodium salt, -OP(O)(SNa)-O- and -OP(O)(ONa)-O-, respectively). In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide. In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide, wherein each acidic phosphate and modified phosphate group (e.g., phosphorothioate, phosphate, etc.), if any, is present in salt form (all sodium salts).

[0061] Protecting group: As used herein, the term "protecting group" is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, TW Greene and PGM Wuts, 3rd edition, John Wiley & Sons, 1999, which is incorporated herein by reference in its entirety. Also included are those protecting groups specifically for nucleoside and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al., June 2012, the entire contents of Chapter 2 of which are cited herein. Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethylcarbamate (Fmoc), 9-(2-sulfo)fluorenylmethylcarbamate, 9-(2,7-dibromo)fluorenylmethylcarbamate, 2,7-di-tert-butyl-[9-(10,10-dioxo-10,10,10-tetrahydrothioxanthenyl)]carbamate (DBD-Tmoc), 4-methoxybenzamidocarbamate (Phenoc), 2,2,2-trichloroethylcarbamate (Troc), 2-trimethylsilylcarbamate, Ethyl carbamate (Teoc), 2-phenylcarbamate (hZ), 1-(1-adamantyl)-1-methylcarbamate (Adpoc), 1,1-dimethyl-2-halogenated ethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-1-(4-biphenyl)carbamate (Bpoc), 1-(3,5-di-tert-butylphenyl)-1-methylethyl carbamate ( t-Bumeoc), ethyl 2-(2'- and 4'-pyridyl)carbamate (Pyoc), ethyl 2-(N,N-dicyclohexylcarbamate)carbamate, tert-butyl carbamate (BOC), 1-adamantylcarbamate (Adoc), vinylcarbamate (Voc), allylcarbamate (Alloc), 1-isopropylallylcarbamate (Ipaoc), cinnamylcarbamate (Coc), 4-nitrocinnamylcarbamate (Noc), 8-quinolinylcarbamate, N-hydroxy piperidinylcarbamate, alkyldithiocarbamate, benzylcarbamate (Cbz), p-methoxybenzylcarbamate (Moz), p-nitrobenzylcarbamate, p-bromobenzylcarbamate, p-chlorobenzylcarbamate, 2,4-dichlorobenzylcarbamate, 4-methylsulfinylbenzylcarbamate (Msz), 9-anthrylmethylcarbamate, methyl diphenylcarbamate, ethyl 2-methylthiocarbamate, ethyl 2-methylsulfonylcarbamate, ethyl 2-(p-toluenesulfonyl)carbamate, [2-(1,3-dithienyl)]carbamic acid methyl ester (Dmoc), 4-methylthiophenylcarbamate (Mtpc), 2,4-dimethylphenylthiocarbamate (Bmpc), 2-phosphonium ethyl carbamate (Peoc), 2-triphenylphosphonium isopropyl carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acyloxybenzylcarbamate, p-(dihydroxymethylboryl)benzylcarbamate, 5-benzisoxazolylcarbamic acid methyl ester, 2-(trifluoromethyl)-6-chromonylcarbamic acid methyl ester (Tcroc), m-nitrophenylcarbamate, 3,5-dimethoxybenzylcarbamate, o-nitrobenzylcarbamate, 3,4-dimethoxy-6-nitrobenzylcarbamate, phenyl (o-nitrophenyl) carbamate, phenothiazinyl-(10) -carbonyl derivatives, N'-toluenesulfonylaminocarbonyl derivatives, N'-phenylaminothiocarbonyl derivatives, tert-amyl carbamate, S-benzylthiocarbamate, p-cyanobenzylcarbamate, cyclobutylcarbamate, cyclohexylcarbamate, cyclopentylcarbamate, cyclopropylcarbamate, p-decyloxybenzylcarbamate, 2,2-dimethoxycarbonylvinylcarbamate, o-(N,N-dimethylformamido)benzylcarbamate, 1,1-dimethyl-3-(N,N-dimethylformamido)propylcarbamate, 1,1-dimethylpropynylcarbamate, methyl di(2-pyridyl)carbamate, methyl 2-furylcarbamate, 2-iodoethylcarbamate, isobornylcarbamate, isobutylcarbamate, isonicotinoylcarbamate carbamate), p-(p'-methoxyphenylazo)benzylcarbamate, 1-methylcyclobutylcarbamate, 1-methylcyclohexylcarbamate, 1-methyl-1-cyclopropylmethylcarbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethylcarbamate, 1-methyl-1-(p-phenylphenylazo)carbamate, 1-methyl-1-phenylethylcarbamate, 1-methyl-1-(4-pyridyl)ethylcarbamate, phenyl carbamate, p-phenylazobenzylcarbamate, 2,4,6-tri-tert-butylphenylcarbamate, 4-(trimethylammonium)benzylcarbamate, 2,4,6-Trimethylbenzylcarbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropionamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivatives, benzamide, p-phenylbenzamide, o-nitrobenzylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl) Propionamide, 3-(o-nitrophenyl)propionamide, 2-methyl-2-(o-nitrophenoxy)propionamide, 2-methyl-2-(o-phenylazophenoxy)propionamide, 4-chlorobutyramide, 3-methyl 3-nitrobutyramide, o-nitrocinnamamide, N-acetylmethionine derivatives, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N- N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-tetramethyldisilazane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexane-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexane Cyclohexane-2-one, 1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrrolin-3-yl)amine (N–(1–isopropyl–4–nitro–2–oxo–3–pyroolin–3–,

[0062] yl)amine), quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzocycloheptylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMtr), N-9-phenylfluorenylamine (Phf), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamine (Fcm), N-2-pyridylamino N'-oxide (N-2-picolylamino N'-oxide), N-1,1-dimethylthiomethyleneamine, N-benzylideneamine, N-p-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine, N-p-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylamine, N -(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-diphenylboronic acid derivatives, N-[phenyl(pentacarbonylchromium or tungsten)carbonyl]amine, N-copper chelates, N-zinc chelates, N-nitramines, N-nitrosamines, N-oxides, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkylphosphoramidates, dibenzylphosphoramidates, diphenylphosphoramidates, benzenesulfenamide, o-nitrobenzenesulfenamide ( Nps), 2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethanesulfenamide, 3-nitropyridinesulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6,-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide amine (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide, 9-anthracenesulfonamide, 4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (Dnmbs), phenylsulfonamide, trifluoromethylsulfonamide, and phenacylmethylsulfonamide.

[0063] Suitable protected carboxylic acids further include but are not limited to silyl-, alkyl-, alkenyl-, aryl- and aralkyl-protected carboxylic acids. The example of suitable silyl groups includes trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triisopropylsilyl etc. The example of suitable alkyl groups includes methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, tert-butyl, tetrahydropyran-2-yl etc. The example of suitable alkenyl groups includes allyl. The example of suitable aryl groups includes optionally substituted phenyl, biphenyl or naphthyl. The example of suitable arylalkyl groups includes optionally substituted benzyl (e.g., p-methoxybenzyl (MPM)), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl) and 2- and 4-picolyl (picolyl).

[0064] Suitable hydroxy protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), tert-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), tert-butoxymethyl, 4-pentenyloxymethyl (POM), silyloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxy cyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethoxy, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2 , 2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylhydrogenseleno)ethyl, tert-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxide, benzhydryl, p,p'-dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tris(p-methoxyphenyl)methyl, 4-(4'-bromophenacylmethoxy) benzhydryl, 4,4',4"-tris(4,5-dichlorophthalimidephenyl)methyl, 4,4',4"-tris(levulinoyloxyphenyl)methyl, 4,4',4"-tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4"-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxideS–dioxido), trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylthiazolylsilyl, tert-butyldimethylsilyl (TBDMS), tert-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), tert-butylmethoxyphenylsilyl (TBMPS), formates, benzoylformates, acetates, chloroacetates, dichloroacetates, trichloroacetates, trifluoroacetates, methoxy Acetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate (levulinic acid), 4,4-(dithioethylene)pentanoate (4,4-(ethylenedithio)pentanoate) (levulinic acid dithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylbenzoate), methylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-(triphenylphosphonium)ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate, alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, p-nitrobenzyl carbonate, alkyl S-benzylthiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2-formyl Benzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate, alkyl N,N,N,N',N',N'-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioate, alkyl 2,4-dinitrophenylsulfonate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and toluenesulfonate (Ts). For 1,2- or 1,3-diols, protecting groups include methylene acetal, ethylene acetal, 1-tert-butylethylene ketal, 1-phenylethylene ketal, (4-methoxyphenyl)ethylene acetal, 2,2,2-trichloroethylene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzyl acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzyl acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methylbenzylidene acetal ... Oxyethylene orthoester, 1-ethoxyethylene orthoester, 1,2-dimethoxyethylene orthoester, α-methoxybenzylidene orthoester, 1-(N,N-dimethylamino)ethylene derivatives, α-(N,N'-dimethylamino)benzylidene derivatives, 2-oxopentanyl orthoester, di-tert-butylsilylene group (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanylidene) derivative (1,3–(1,1,3,3–tetraisopropyldisiloxanylidene) derivative),

[0065] (TIPDS), tetra-tert-butoxydisiloxane-1,3-diylidene derivative (TBDS), cyclic carbonates, cyclic boronates, ethyl boronates, and phenyl boronates.

[0066] In some embodiments, the hydroxy protecting group is acetyl, tert-butyl, tert-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4'-dimethoxy trityl, trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformic acid, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, methanesulfonate, tosylate, trifluoromethanesulfonate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl (DMTr), and 4,4',4"-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-xylyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylsilyl In some embodiments, the hydroxy protecting group is selected from the group consisting of trityl, monomethoxytrityl, and 4,4'-dimethoxytrityl groups. In some embodiments, the phosphorus-containing linker protecting group is a group that is attached to a phosphorus-containing linker (e.g., an internucleotide linker) during oligonucleotide synthesis. In some embodiments, the blocking group is attached to the sulfur atom of the phosphorothioate group. In some embodiments, the blocking group is attached to the oxygen atom of the internucleotide phosphorothioate linkage. In some embodiments, the blocking group is attached to the oxygen atom of the internucleotide phosphate linkage.In some embodiments, the protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylformamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl or 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0067] Subject: As used herein, "subject" or "test subject" refers to any organism to which a compound (e.g., oligonucleotide) or composition according to the present disclosure is administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals, such as mice, rats, rabbits, non-human primates, and humans; insects; worms, etc.) and plants. In some embodiments, the subject is a human. In some embodiments, the subject may be suffering from and / or susceptible to a disease, disorder, and / or condition.

[0068] Sugar: The term "sugar" refers to a monosaccharide or polysaccharide in closed and / or open form. In some embodiments, the sugar is a monosaccharide. In some embodiments, the sugar is a polysaccharide. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term "sugar" also encompasses structural analogs used to replace conventional sugar molecules, such as ethylene glycol (whose polymers form the backbone of nucleic acid analogs), ethylene glycol nucleic acids ("GNA"), etc. As used herein, the term "sugar" also encompasses structural analogs used to replace natural or naturally occurring nucleotides, such as modified sugars and nucleotide sugars. In some embodiments, the sugar is an RNA or DNA sugar (ribose or deoxyribose). In some embodiments, the sugar is a modified ribose or deoxyribose, such as 2'-modified, 5'-modified, etc. As described herein, in some embodiments, when used in oligonucleotides and / or nucleic acids, the modified sugar can provide one or more desired properties, activities, etc. In some embodiments, the sugar is optionally substituted ribose or deoxyribose.In some embodiments, "sugar" refers to a sugar unit in an oligonucleotide or nucleic acid.

[0069] Susceptible: An individual who is "susceptible" to a disease, disorder, and / or condition is an individual who has a higher risk of developing the disease, disorder, and / or condition than the general public. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition is prone to developing the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.

[0070] Therapeutic agent: As used herein, the term "therapeutic agent" generally refers to any agent that, when administered to a subject, causes a desired effect (e.g., a desired biological, clinical, or pharmacological effect). In some embodiments, an agent is considered a therapeutic agent if it exhibits a statistically significant effect in a suitable population. In some embodiments, a suitable population is a population of subjects suffering from and / or susceptible to a disease, disorder, and / or condition. In some embodiments, a suitable population is a population of model organisms. In some embodiments, a suitable population can be defined by one or more criteria (e.g., age group, sex, genetic background, pre-existing clinical condition, treatment received before exposure). In some embodiments, a therapeutic agent is a substance that, when administered to a subject in an effective amount, alleviates one or more symptoms or features of a disease, disorder, and / or condition in a subject, improves one or more symptoms or features of a disease, disorder, and / or condition in a subject, alleviates one or more symptoms or features of a disease, disorder, and / or condition in a subject, inhibits one or more symptoms or features of a disease, disorder, and / or condition in a subject, prevents one or more symptoms or features of a disease, disorder, and / or condition in a subject, delays the onset of one or more symptoms or features of a disease, disorder, and / or condition in a subject, reduces the severity of one or more symptoms or features of a disease, disorder, and / or condition in a subject, and / or reduces the incidence of one or more symptoms or features of a disease, disorder, and / or condition in a subject. In some embodiments, a "therapeutic agent" is an agent that has been or needs to be approved by a government agency before it can be sold for administration to a human. In some embodiments, a "therapeutic agent" is an agent that requires a pharmaceutical prescription for administration to a human. In some embodiments, a therapeutic agent is a provided compound, such as a provided oligonucleotide.

[0071] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that elicits a desired biological response when administered as part of a treatment regimen. In some embodiments, a therapeutically effective amount of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to the disease, disorder, and / or condition. As will be appreciated by one of ordinary skill in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance to be delivered, the target cell, or the target tissue. For example, an effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that alleviates one or more symptoms or features of the disease, disorder, and / or condition, ameliorates one or more symptoms or features of the disease, disorder, and / or condition, relieves one or more symptoms or features of the disease, disorder, and / or condition, inhibits one or more symptoms or features of the disease, disorder, and / or condition, prevents one or more symptoms or features of the disease, disorder, and / or condition, delays the onset of one or more symptoms or features of the disease, disorder, and / or condition, reduces the severity of one or more symptoms or features of the disease, disorder, and / or condition, and / or reduces the incidence of one or more symptoms or features of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0072] Treatment: As used herein, the terms "treat," "treatment," or "treating" refer to any method for partially or completely alleviating one or more symptoms or features of a disease, disorder, and / or condition, ameliorating one or more symptoms or features of a disease, disorder, and / or condition, relieving one or more symptoms or features of a disease, disorder, and / or condition, inhibiting one or more symptoms or features of a disease, disorder, and / or condition, preventing one or more symptoms or features of a disease, disorder, and / or condition, delaying the onset of one or more symptoms or features of a disease, disorder, and / or condition, reducing the severity of one or more symptoms or features of a disease, disorder, and / or condition, and / or reducing the incidence of one or more symptoms or features of a disease, disorder, and / or condition. Treatment can be administered to a subject who does not show signs of a disease, disorder, and / or condition. In some embodiments, treatment can be administered to a subject who only shows early signs of a disease, disorder, and / or condition, for example, for the purpose of reducing the risk of developing pathology associated with the disease, disorder, and / or condition.

[0073] Wild-type: As used herein, the term "wild-type" has its art-understood meaning, which refers to an entity having structure and / or activity as found in nature in a "normal" (as opposed to mutated, diseased, altered, etc.) state or context. One of ordinary skill in the art will understand that wild-type genes and polypeptides typically exist in a variety of different forms (e.g., alleles).

[0074] As will be appreciated by those skilled in the art, the methods and compositions described herein with respect to provided compounds (eg, oligonucleotides) are generally also applicable to the pharmaceutically acceptable salts of these compounds.

[0075] As used in this disclosure, in some embodiments, "one or more" is 1-200, 1-150, 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 In some embodiments, “one or more” is 1. In some embodiments, “one or more” is 2. In some embodiments, “one or more” is 3. In some embodiments, “one or more” is 4. In some embodiments, “one or more” is 5. In some embodiments, “one or more” is 6. In some embodiments, “one or more” is 7. In some embodiments, “one or more” is 8. In some embodiments, “one or more” is 9. In some embodiments, “one or more” is 10. In some embodiments, “one or more” is at least 1. In some embodiments, “one or more” is at least 2. In some embodiments, “one or more” is at least 3. In some embodiments, “one or more” is at least 4. In some embodiments, “one or more” is at least 5. In some embodiments, “one or more” is at least 6. In some embodiments, “one or more” is at least 7. In some embodiments, “one or more” is at least 8. In some embodiments, “one or more” is at least 9. In some embodiments, “one or more” is at least 10.

[0076] As used in this disclosure, in some embodiments, "at least one" is "one or more" as described herein.

[0077] Description of Certain Embodiments

[0078] Among other things, the present disclosure provides various oligonucleotides and compositions thereof. In some embodiments, the oligonucleotides of the present disclosure target calpain-2 and can hybridize with calpain-2 transcripts (e.g., calpain-2 mRNA). In some embodiments, the technology provided (e.g., oligonucleotides, compositions, methods, etc.) reduces the level of calpain-2 transcripts and / or its products. The use of naturally occurring nucleic acids is, for example, limited by their sensitivity to endonucleases and exonucleases. Therefore, various synthetic counterparts have been developed to circumvent these shortcomings and / or further improve various properties and activities. In some embodiments, the oligonucleotides provided include various chemical modifications, such as core base modifications, sugar modifications, internucleotide linkage modifications, etc., which, among other things, make these molecules less susceptible to degradation and improve other properties and / or activities. In some embodiments, the oligonucleotides include one or more features as described herein, such as core base sequence, length, wing, core, activity, etc. In some embodiments, the oligonucleotides have base sequences as described herein and / or wing-core-wing structures as described herein.

[0079] base sequence

[0080] In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the oligonucleotide base sequence is a sequence that is complementary to the target nucleic acid or to a portion thereof. In some embodiments, the characteristic portion of a transcript defines the transcript relative to other transcripts in related organisms; for example, in some embodiments, the characteristic portion is not in transcripts transcribed from different nucleic acid sequences (e.g., different genes). In some embodiments, transcript variants from a nucleic acid sequence (e.g., mRNA variants of a gene) can share a common characteristic portion that defines them from transcripts of other nucleic acids (e.g., transcripts of other genes). In some embodiments, the characteristic portion in a transcript defines transcripts of other one or more transcripts and / or other alleles of a nucleic acid sequence from the same nucleic acid sequence (e.g., gene). In some embodiments, the characteristic portion defines a specific allele (and / or its transcript) relative to one or more other alleles (and / or its transcripts). In some embodiments, the characteristic portion is included in a sequence separated in a nucleic acid. In some embodiments, the characteristic portion is a core base ("signature sequence") of a continuous stretch in a nucleic acid. The characteristic portion or sequence can have different numbers of core bases.In some embodiments, there are about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleobases in a characteristic portion or sequence; in some embodiments, there are about 10; in some embodiments, there are about 11; in some embodiments, there are about 12; in some embodiments, there are about 13; in some embodiments, there are about 14; in some embodiments, there are about 15; in some embodiments, there are about 16; in some embodiments, there are about 17; in some embodiments, there are about 18; in some embodiments, there are about 19; in some embodiments, there are about 20; in some embodiments, there are about 21; in some embodiments, there are about 22; in some embodiments, there are about 23; in some embodiments, there are about 24; in some embodiments, there are about 25; in some embodiments, there are about 25 or more.

[0081] In some embodiments, the oligonucleotide comprises a sequence that is identical or complementary to a characteristic portion of a nucleic acid. In some embodiments, the oligonucleotide comprises a sequence that is identical or complementary to a characteristic portion of a calpain-2 transcript. In some embodiments, the oligonucleotide comprises a sequence that is complementary to a characteristic portion of a calpain-2 transcript. In some embodiments, the base sequence of the oligonucleotide is identical or complementary to a characteristic portion of a nucleic acid. In some embodiments, the base sequence of the oligonucleotide is identical or complementary to a characteristic portion of a calpain-2 transcript. In some embodiments, the base sequence of the oligonucleotide is complementary to a characteristic portion of a calpain-2 transcript. In some embodiments, the characteristic portion is a signature sequence.

[0082] In some embodiments, the signature sequence of the calpain-2 transcript is or comprises the complement of the oligonucleotide sequence in Table 1. In some embodiments, the signature sequence is or comprises GGAAGCCUACAGAAACUGAU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AUCAACUGAACCAGUAUGCC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AACCACUGCCUGACCUGAGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AGCUCUGCAAAAAGGCUCUC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises ACUAGAGGCACAGAGCUGGA, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises ACAACUGCCCAAGCUGGAAC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CAGCCAAGGACUAAGCUUCC, wherein each U can be independently replaced by T.

[0083] In some embodiments, oligonucleotide can be with the regional hybridization of nucleic acid.In some embodiments, can with the oligonucleotide of one or more certain region specific hybridizations of nucleic acid (for example, by sequence complementarity) can be than the oligonucleotide of one or more reference region specific hybridizations (for example, by sequence complementarity) of nucleic acid more effectively reduce the level of nucleic acid.In some embodiments, zone has the length of about 20-200 (for example, about 20-150,20-100,30-200,30-150,40-200,40-150,50-100 or about 20,25,30,35,40,50,60,70,80,90,100,110,120,130,140,150,160,170,180,190 or 200) individual core base.In some embodiments, the length in zone is about 30 core bases.In some embodiments, the length in zone is about 40 core bases. In some embodiments, the length of the region is about 50 nucleobases. In some embodiments, the length of the region is about 60 nucleobases. In some embodiments, the length of the region is about 70 nucleobases. In some embodiments, the length of the region is about 80 nucleobases. In some embodiments, the length of the region is about 90 nucleobases. In some embodiments, the length of the region is about 100 nucleobases. In some embodiments, the length of the region is about 120 nucleobases. In some embodiments, the length of the region is about 150 nucleobases. In some embodiments, the length of the region is about 200 nucleobases. In some embodiments, the region includes the base sequence of the oligonucleotide in Table 1, which, in some embodiments, is located in the middle of the region. For example, in some embodiments, the region is or includes GGAAGCCUACAGAAACUGAU. In some embodiments, the region is or includes AUCAACUGAACCAGUAUGCC. In some embodiments, the region is or includes AACCACUGCCUGACCUGAGC. In some embodiments, the region is or includes AGCUCUGCAAAAAGGCUCUC. In some embodiments, the region is or comprises ACUAGAGGCACAGAGCUGGA. In some embodiments, the region is or comprises ACAACUGCCCAAGCUGGAAC. In some embodiments, the region is or comprises CAGCCAAGGACUAAGCUUCC. In some embodiments, the reference region is or comprises UCCCUCACCUUGAAUGAAGA.

[0084] In some embodiments, the base sequence of the oligonucleotide comprises or consists of about 10-50 (15-50, 16-50, 17-50, 18-50, 19-50, 20-50, 15-30, 20-30, 15-25, or 20-25 or at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45; in some embodiments, at least about 15; in some embodiments, at least about 1 In some embodiments, the calpain-2 gene or its transcript (such as mRNA) is identical or complementary to a base sequence of the same length in the calpain-2 gene or its transcript (such as mRNA). In some embodiments, they are complementary to a base sequence of equal length in the calpain-2 transcript.

[0085] In certain embodiments, the base sequence of the oligonucleotide is at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100% complementary to the target sequence in the calpain-2 transcript. In some embodiments, the base sequence of the oligonucleotide is completely complementary to the target sequence in the calpain-2 transcript.

[0086] In some embodiments, the base sequence of the oligonucleotide has about 80% or more identity with the base sequence of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide has about 85% or more identity with the base sequence of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide has about 90% or more identity with the base sequence of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide has about 95% or more identity with the base sequence of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa.

[0087] In some embodiments, the base sequence of the oligonucleotide comprises a continuous span of about 15 or more bases of the oligonucleotides disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide comprises a continuous span of about 16 or more bases of the oligonucleotides disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide comprises a continuous span of about 17 or more bases of the oligonucleotides disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide comprises a continuous span of about 18 or more bases of the oligonucleotides disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide comprises a continuous span of about 19 or more bases of the oligonucleotides disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide comprises a contiguous stretch of about 20 or more bases of the oligonucleotides disclosed in Table 1, wherein each T can be independently replaced by a U, and vice versa.

[0088] In some embodiments, the base sequence of the oligonucleotide comprises the base sequence of the oligonucleotide in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide is the base sequence of the oligonucleotide in Table 1, wherein each T can be independently replaced by U, and vice versa. For example, in some embodiments, the base sequence of the oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GGCATACTGGTTCAGTTGAT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCTCAGGTCAGGCAGTGGTT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GAGAGCCTTTTTGCAGAGCT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises TCCAGCTCTGTGCCTCTAGT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GTTCCAGCTTGGGCAGTTGT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GGAAGCTTAGTCCTTGGCTG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide is ATCAGTTTCTGTAGGCTTCC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide is GGCATACTGGTTCAGTTGAT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide is GCTCAGGTCAGGCAGTGGTT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide is GAGAGCCTTTTTGCAGAGCT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide is TCCAGCTCTGTGCCTCTAGT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide is GTTCCAGCTTGGGCAGTTGT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide is GGAAGCTTAGTCCTTGGCTG, wherein each T can be independently replaced by U.

[0089] In some embodiments, the base sequence of the oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC. In some embodiments, the base sequence of the oligonucleotide comprises GGCATACTGGTTCAGTTGAT. In some embodiments, the base sequence of the oligonucleotide comprises GCTCAGGTCAGGCAGTGGTT. In some embodiments, the base sequence of the oligonucleotide comprises GAGAGCCTTTTTGCAGAGCT. In some embodiments, the base sequence of the oligonucleotide comprises TCCAGCTCTGTGCCTCTAGT. In some embodiments, the base sequence of the oligonucleotide comprises GTTCCAGCTTGGGCAGTTGT. In some embodiments, the base sequence of the oligonucleotide comprises GGAAGCTTAGTCCTTGGCTG. In some embodiments, the base sequence of the oligonucleotide is ATCAGTTTCTGTAGGCTTCC. In some embodiments, the base sequence of the oligonucleotide is GGCATACTGGTTCAGTTGAT. In some embodiments, the base sequence of the oligonucleotide is GCTCAGGTCAGGCAGTGGTT. In some embodiments, the base sequence of the oligonucleotide is GAGAGCCTTTTTGCAGAGCT. In some embodiments, the base sequence of the oligonucleotide is TCCAGCTCTGTGCCTCTAGT. In some embodiments, the base sequence of the oligonucleotide is GTTCCAGCTTGGGCAGTTGT. In some embodiments, the base sequence of the oligonucleotide is GGAAGCTTAGTCCTTGGCTG.

[0090] length

[0091] As will be appreciated by those skilled in the art, oligonucleotide can have various lengths, to provide characteristic and / or activity required for various purposes.There are many technologies for evaluating, selecting and / or optimizing oligonucleotide length in this area, and can utilize according to the disclosure.As demonstrated herein, in many embodiments, the oligonucleotide provided has suitable length, to hybridize with their target and reduce the level of the product of their target and / or target.In some embodiments, oligonucleotide is long enough to identify target nucleic acid (for example, calpain-2mRNA).In some embodiments, oligonucleotide is long enough to distinguish target nucleic acid and other nucleic acid (for example, nucleic acid has the base sequence that is not calpain-2 sequence) to reduce the effect of missing the target.In some embodiments, oligonucleotide is short enough to reduce the complexity of manufacturing or production and reduce the cost of product.

[0092] In some embodiments, the length of the base sequence of the oligonucleotide is about 10-100 nucleobases. In some embodiments, the length of the base sequence is about 10-50 nucleobases. In some embodiments, the length of the base sequence is about 15-50 nucleobases. In some embodiments, the length of the base sequence is about 15-30 nucleobases. In some embodiments, the length of the base sequence is about 15-25 nucleobases. In some embodiments, the length of the base sequence is about 15-22 nucleobases. In some embodiments, the length of the base sequence is about 18-22 nucleobases. In some embodiments, the length of the base sequence is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases. In some embodiments, the length of the base sequence is at least about 12 nucleobases. In some embodiments, the length of the base sequence is at least about 13 nucleobases. In some embodiments, the length of the base sequence is at least about 14 nucleobases. In some embodiments, the length of the base sequence is at least about 15 nucleobases. In some embodiments, the length of the base sequence is at least about 16 nucleobases. In some embodiments, the length of the base sequence is at least about 17 nucleobases. In some embodiments, the length of the base sequence is at least about 18 nucleobases. In some embodiments, the length of the base sequence is at least about 19 nucleobases. In some embodiments, the length of the base sequence is at least about 20 nucleobases. In some embodiments, the length of the base sequence is at least about 21 nucleobases. In some embodiments, the length of the base sequence is at least about 22 nucleobases. In some embodiments, the length of the base sequence is at least about 23 nucleobases. In some embodiments, the length of the base sequence is at least about 24 nucleobases. In some embodiments, the length of the base sequence is at least about 25 nucleobases. In some embodiments, the length of the base sequence is about 15 nucleobases. In some embodiments, the length of the base sequence is about 16 nucleobases. In some embodiments, the length of the base sequence is about 17 nucleobases. In some embodiments, the length of the base sequence is about 18 nucleobases. In some embodiments, the length of the base sequence is about 19 nucleobases. In some embodiments, the length of the base sequence is about 20 nucleobases. In some embodiments, the length of the base sequence is about 21 nucleobases. In some embodiments, the length of the base sequence is about 22 nucleobases. In some embodiments, the length of the base sequence is about 23 nucleobases. In some embodiments, the length of the base sequence is about 24 nucleobases. In some embodiments, the length of the base sequence is about 25 nucleobases. In some embodiments, the length of the base sequence is at least about 30 nucleobases. In some embodiments, each nucleobase independently comprises an optionally substituted monocyclic, bicyclic, or polycyclic ring, wherein at least one ring atom is nitrogen.In some embodiments, each nucleobase is independently optionally substituted adenine, cytosine, guanosine, thymine, or uracil, or an optionally substituted tautomer of adenine, cytosine, guanosine, thymine, or uracil.

[0093] Nucleobases

[0094] According to the present disclosure, various bases can be used in the oligonucleotides provided. In some embodiments, the nucleobase is a natural nucleobase, and the most commonly occurring nucleobases are A, T, C, G, and U. In some embodiments, the nucleobase is a modified nucleobase, because it is not A, T, C, G, and U. In some embodiments, the nucleobase is an optionally substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, the nucleobase is an optionally substituted A, T, C, G, or U, such as 5mC, 5-hydroxymethyl C, etc. In some embodiments, the nucleobase is an alkyl substituted A, T, C, G, or U. In some embodiments, the nucleobase is A. In some embodiments, the nucleobase is T. In some embodiments, the nucleobase is C. In some embodiments, the nucleobase is G. In some embodiments, the nucleobase is U. In some embodiments, the nucleobase is 5mC. In some embodiments, the nucleobase is a substituted A, T, C, G, or U. In some embodiments, the core base is the tautomer of the substitution of A, T, C, G or U. In some embodiments, certain functional groups in the core base are substituted to minimize undesirable reactions in the oligonucleotide synthesis process. Suitable techniques for protecting the core base in oligonucleotide synthesis are well known in the art and can be utilized according to the disclosure. In some embodiments, the core base of modification improves the property and / or activity of the oligonucleotide. For example, in many cases, 5mC can be utilized to replace C to regulate some undesirable biological effects, such as immune response. In some embodiments, when determining sequence identity, the core base with the substitution of identical hydrogen bond pattern is considered to be identical with the unsubstituted core base, for example, 5mC can be considered to be C [for example, the oligonucleotide (for example AT5mCG) with 5mC replacing C is considered to have identical base sequence with the oligonucleotide (for example ATCG) with C in one or more corresponding positions].

[0095] In some embodiments, the oligonucleotide comprises one or more A, T, C, G, or U. In some embodiments, the oligonucleotide comprises one or more optionally substituted A, T, C, G, or U. In some embodiments, the oligonucleotide comprises one or more 5-methylcytosine (5mC), 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine. In some embodiments, the oligonucleotide comprises one or more 5mC. In some embodiments, each core base in the oligonucleotide is independently selected from optionally substituted A, T, C, G, and U, and optionally substituted tautomers of A, T, C, G, and U. In some embodiments, each core base in the oligonucleotide is independently optionally protected A, T, C, 5mC, G, and U. In some embodiments, each core base in the oligonucleotide is optionally substituted A, T, C, G, or U. In some embodiments, each core base in the oligonucleotide is selected from the group consisting of A, T, C, G, U, and 5mC.

[0096] In some embodiments, the nucleobase is optionally substituted 2AP or DAP. In some embodiments, the nucleobase is optionally substituted 2AP. In some embodiments, the nucleobase is optionally substituted DAP. In some embodiments, the nucleobase is 2AP. In some embodiments, the nucleobase is DAP.

[0097] In some embodiments, the nucleobase is a natural nucleobase or a modified nucleobase derived from a natural nucleobase. Examples include uracil, thymine, adenine, cytosine, and guanine (which optionally have their respective amino groups protected by acyl protecting groups), 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pyrimidine analogs (e.g., pseudoisocytosine and pseudouracil), and other modified nucleobases (e.g., 8-substituted purines, xanthines, or hypoxanthines (the latter two being natural degradation products)). Some examples of modified nucleobases are disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048, Limbach et al. Nucleic Acids Research, 1994, 22, 2183-2196, and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313.

[0098] In some embodiments, the oligonucleotide provided comprises one or more 5-methylcytosine. In some embodiments, the disclosure provides oligonucleotides, whose base sequences are disclosed herein, for example, in Table 1, wherein each T can be independently replaced by U, and vice versa, and each cytosine is optionally and independently replaced by 5-methylcytosine, and vice versa. As will be appreciated by those skilled in the art, in some embodiments, relative to the base sequence of the oligonucleotide, 5mC can be regarded as C, and such oligonucleotides comprise core base modifications at the C position (for example, referring to the various oligonucleotides in Table 1 or A2). In the description of the oligonucleotide, unless otherwise indicated, core bases, sugars, and internucleotide linkages are unmodified.

[0099] In some embodiments, the modified nucleobase is a modified nucleobase known in the art (e.g., WO2017 / 210647). In some embodiments, the modified nucleobase is a nucleobase of expanded size to which one or more aryl and / or heteroaryl rings, such as a phenyl ring, have been added.

[0100] During oligonucleotide synthesis, the nucleobases can be protected. Various protection techniques are available and can be utilized in accordance with the present disclosure.

[0101] In some embodiments, the modified nucleobase is a 5-substituted pyrimidine, a 6-azapyrimidine, an alkyl or alkynyl substituted pyrimidine, an alkyl substituted purine, or an N-2, N-6, and O-6 substituted purine. In certain embodiments, the modified nucleobase is selected from 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy, 8-aza and other 8-substituted Purines, 5-halogenated (especially 5-bromo), 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, mixed bases, size-extended bases and fluorinated bases. In some embodiments, the modified nucleobase is a tricyclic pyrimidine, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenthiazine-2-one, or 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). In some embodiments, the modified nucleobase is a nucleobase in which the purine or pyrimidine base is replaced by another heterocycle, such as 7-deaza-adenine, 7-deazaguanine, 2-aminopyridine, or 2-pyridone.

[0102] In some embodiments, the modified nucleobase is substituted. In some embodiments, the modified nucleobase is substituted such that it contains, for example, a heteroatom, an alkyl group, or a linking moiety that is attached to a fluorescent moiety, a biotin or avidin moiety, or other protein or peptide. In some embodiments, the modified nucleobase is a "universal base," which is not a nucleobase in the most classical sense, but functions similarly to a nucleobase. An example of a universal base is 3-nitropyrrole.

[0103] In some embodiments, nucleosides that can be utilized in the provided technology include modified nucleobases and / or modified sugars, such as 4-acetylcytidine; 5-(carboxyhydroxymethyl)uridine; 2'-O-methylcytidine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethylcytidine; dihydrouridine; 2'-O-methylpseudouridine; beta, D-galactosylqueosine; 2'-O-methylguanosine; N 6 -Isopentenyl adenosine; 1-methyladenosine; 1-methylpseudouridine; 1-methylguanosine; 1-methylinosine; 2,2-dimethylguanosine; 2-methyladenosine; 2-methylguanosine; N 7 -methylguanosine; 3-methylcytidine; 5-methylcytidine; 5-hydroxymethylcytidine; 5-formylcytosine; 5-carboxycytosine; N 6 -methyladenosine; 7-methylguanosine; 5-methylaminoethyluridine; 5-methoxyaminomethyl-2-thiouridine; β,D-mannosylqueosine; 5-methoxycarbonylmethyluridine; 5-methoxycarbonyluridine; 2-methylthio-N 6 -isopentenyl adenosine; N-((9-β,D-ribofuranosyl-2-methylthiopurin-6-yl)carbamoyl)threonine; N-((9-β,D-ribofuranosylpurin-6-yl)-N-methylcarbamoyl)threonine; methyl uridine-5-oxoacetate; uridine-5-oxoacetic acid (v); pseudouridine; queosine; 2-thiacytidine; 5-methyl-2-thiouridine; 2-thiouridine; 4-thiouridine; 5-methyluridine; 2'-O-methyl-5-methyluridine; and 2'-O-methyluridine.

[0104] In some embodiments, the nucleobase (e.g., a modified nucleobase) comprises one or more biomolecule binding moieties, such as an antibody, antibody fragment, biotin, avidin, streptavidin, a receptor ligand, or a chelating moiety. In other embodiments, the nucleobase is 5-bromouracil, 5-iodouracil, or 2,6-diaminopurine. In some embodiments, the nucleobase comprises a substitution with a fluorescent or biomolecule binding moiety. In some embodiments, the substituent is a fluorescent moiety. In some embodiments, the substituent is biotin or avidin.

[0105] In some embodiments, the nucleobase is described in US 9394333, US 9744183, US 9605019, US9598458, US 9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 and / or WO 2019 / 032612, the nucleobases of each of which are incorporated herein by reference.

[0106] sugar

[0107] Various sugars (including modified sugars) can be utilized in accordance with the present disclosure. In some embodiments, the present disclosure provides sugar modifications and patterns thereof, optionally in combination with other structural elements (e.g., base modifications and patterns thereof, internucleotide linkage modifications and patterns thereof, etc.), that can provide improved properties and / or activity when incorporated into oligonucleotides.

[0108] The most common naturally occurring nucleosides include ribose sugars (e.g., in RNA) or deoxyribose sugars (e.g., in DNA) attached to the nucleobases adenosine (A), cytosine (C), guanine (G), thymine (T), or uracil (U). In some embodiments, sugars, such as the various sugars in many of the oligonucleotides in Table 1 (unless otherwise indicated), are natural DNA sugars (in DNA nucleic acids or oligonucleotides, which have the structure wherein the nucleobase is attached to the 1' position and the 3' and 5' positions are linked to an internucleotide linkage (as will be appreciated by those skilled in the art, the 5' position may be linked to a 5' terminal group (e.g., -OH) if at the 5' end of the oligonucleotide and the 3' position may be linked to a 3' terminal group (e.g., -OH) if at the 3' end of the oligonucleotide). In some embodiments, the sugar is a natural RNA sugar (in an RNA nucleic acid or oligonucleotide, it has the structure Wherein the nucleobase is attached to the 1' position, and the 3' and 5' positions are connected to the internucleotide linkage (as will be appreciated by those skilled in the art, if at the 5' end of the oligonucleotide, the 5' position can be connected to the 5' terminal group (e.g., -OH), and if at the 3' end of the oligonucleotide, the 3' position can be connected to the 3' terminal group (e.g., -OH)). In some embodiments, the sugar is a modified sugar in that it is not a natural DNA sugar or a natural RNA sugar. Among other things, the modified sugar can provide improved stability and / or affinity. In some embodiments, the modified sugar can be used to alter and / or optimize one or more hybridization properties. In some embodiments, the modified sugar can be used to alter and / or optimize target recognition. In some embodiments, the modified sugar can be used to optimize Tm. In some embodiments, the modified sugar can be used to improve oligonucleotide activity.

[0109] Sugars can be attached to the internucleotide linkage at different positions. As non-limiting examples, the internucleotide linkage can be bonded to the 2', 3', 4', or 5' position of the sugar. As is common in natural nucleic acids, unless otherwise indicated, the internucleotide linkage is typically attached to one sugar at the 5' position and to another sugar at the 3' position.

[0110] In some embodiments, the sugar is an optionally substituted natural DNA or RNA sugar. In some embodiments, the sugar is optionally substituted In some embodiments, the 2' position is optionally substituted. In some embodiments, the sugar is In some embodiments, the sugar has the structure where R 1s 、R 2s 、R 3s 、R 4s and R 5sEach of the alkyl groups is independently -H, a suitable substituent or a suitable sugar modification (e.g., as described in US 9394333, US9744183, US 9605019, US 9982257, US20170037399, US20180216108, US20180216107, US9598458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 032612, WO 2019 / 055951 and / or WO 2019 / 075357, the substituents in each of the above, sugar modifications, R 1s 、R 2s 、R 3s 、R 4s and R 5s The description of and modified sugars are independently incorporated herein by reference). In some embodiments, R 1s 、R 2s 、R 3s 、R 4s and R 5s Each of -F, -Cl, -Br, -I, -CN, -N3, -NO, -NO2, -L s -R', -L s -OR', -L s -SR', -L s -N(R')2、-OL s -OR'、-OL s -SR' or -OL s -N(R')2, wherein each R' is independently H or an optionally substituted group selected from the group consisting of: C 1-10 Aliphatic, C 6-14 Aryl, C with 1-5 heteroatoms 1-10 heteroaliphatic, 5-10 membered heteroaryl having 1-5 heteroatoms, and 3-10 membered heterocyclyl having 1-4 heteroatoms, or two or more R' groups together with their intervening atoms form a 3-10 membered ring having 0-5 heteroatoms in addition to the intervening atoms. s is a covalent bond with 1 to 4 heteroatoms or an optionally substituted divalent C 1-6 In some embodiments, the sugar has In some embodiments, R 4s is -H. In some embodiments, the sugar has The structure of R 2s is -H, halogen or -OR, wherein R is optionally substituted C 1-6 In some embodiments, R 2s is -H. In some embodiments, R 2s In some embodiments, R 2s In some embodiments, R2 s In some embodiments, the sugar has The structure of R 2s and R 4s Together they form -L s -, where L s is a covalent bond or an optionally substituted divalent C 1-6 In some embodiments, each heteroatom is independently selected from nitrogen, oxygen, or sulfur. s is optionally substituted C2-O-CH2-C4. In some embodiments, L s In some embodiments, R s In some embodiments, R s It is C2-O-(S)-CH(CH2CH3)-C4.

[0111] In some embodiments, the modified sugar contains one or more substituents at the 2' position (usually one substituent, and typically at an axial position or R 2s ), independently selected from -F; -CF3, -CN, -N3, -NO, -NO2, -OR', -SR' or -N(R')2, wherein each R' is independently described in this disclosure, and in some embodiments, optionally substituted C 1-10 Aliphatic; –O–(C1–C 10 alkyl), –S–(C1–C 10 alkyl), –NH–(C1–C 10 alkyl), or –N(C1–C 10 alkyl)2;–O–(C2–C 10 alkenyl), –S–(C2–C 10 alkenyl), –NH–(C2–C 10 alkenyl), or –N(C2–C 10 alkenyl)2;–O–(C2–C10 Alkynyl), –S–(C2–C 10 Alkynyl), –NH–(C2–C 10 Alkynyl), or –N(C2–C 10 Alkynyl)2; or –O–(C1–C 10 Alkylene)–O–(C1–C 10 alkyl), –O–(C1–C 10 Alkylene)–NH–(C1–C 10 alkyl) or –O–(C1–C 10 Alkylene)–NH(C1–C 10 Alkyl)2, –NH–(C1–C 10 Alkylene)–O–(C1–C 10 alkyl), or –N(C1–C 10 alkyl)–(C1–C 10 Alkylene)–O–(C1–C 10 In some embodiments, the substituent is -O(CH2) n OCH3, –O(CH2) n NH2, MOE, DMAOE or DMAEOE, wherein n is from 1 to about 10.

[0112] In some embodiments, the modified sugar is a natural RNA sugar whose 2'-OH is replaced by a group selected from -F, -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2, wherein each R' is independently described in this disclosure; -O-(C1-C 10 alkyl), –S–(C1–C 10 alkyl), –NH–(C1–C 10 alkyl), or –N(C1–C 10 alkyl)2;–O–(C2–C 10 alkenyl), –S–(C2–C 10 alkenyl), –NH–(C2–C 10 alkenyl), or –N(C2–C 10 alkenyl)2;–O–(C2–C 10 Alkynyl), –S–(C2–C 10 Alkynyl), –NH–(C2–C 10 Alkynyl), or –N(C2–C 10 Alkynyl)2; or –O––(C1–C 10 Alkylene)–O––(C1–C 10 alkyl), –O–(C1–C 10Alkylene)–NH–(C1–C 10 alkyl) or –O–(C1–C 10 Alkylene)–NH(C1–C 10 Alkyl)2, –NH–(C1–C 10 Alkylene)–O–(C1–C 10 alkyl), or –N(C1–C 10 alkyl)–(C1–C 10 Alkylene)–O–(C1–C 10 alkyl), wherein each of the alkyl, alkylene, alkenyl, and alkynyl groups is independently and optionally substituted. In some embodiments, 2'-OH is replaced by -H (deoxyribose). In some embodiments, 2'-OH is replaced by -F. In some embodiments, 2'-OH is replaced by -OR'. In some embodiments, 2'-OH is replaced by -OMe. In some embodiments, 2'-OH is replaced by -OCH2CH2OMe.

[0113] In some embodiments, the sugar modification is a 2'-modification. In some embodiments, the 2'-modification is a 2'-OR s In some embodiments, R s is optionally substituted C 1-4 In some embodiments, R s is optionally substituted C 1-6 In some embodiments, the modification is 2'-OMe. In some embodiments, the modification is 2'-MOE. In some embodiments, the 2'-modification is S-cEt. In some embodiments, the modified sugar is an LNA sugar. In some embodiments, the 2'-modification is -F.

[0114] In some embodiments, the sugar modification replaces the sugar moiety with another cyclic or acyclic moiety. Examples of such moieties are well known in the art, such as those in morpholinos, glycol nucleic acids, PNAs, etc., and can be utilized in accordance with the present disclosure.

[0115] In some embodiments, one or more sugars of an oligonucleotide are independently modified. In some embodiments, each sugar of an oligonucleotide or a portion thereof (e.g., a wing) is independently modified. In some embodiments, the modified sugar comprises a 2'-modification. In some embodiments, each modified sugar independently comprises a 2'-modification. In some embodiments, the 2'-modification is a 2'-OR s , where R s is optionally substituted C 1-6In some embodiments, the 2'-modification is a 2'-OMe modification. In some embodiments, the 2'-modification is a 2'-MOE modification. In some embodiments, the 2'-modification is an LNA sugar modification. In some embodiments, the 2'-modification is a 2'-F. In some embodiments, each sugar modification is independently a 2'-modification. In some embodiments, each sugar modification is independently a 2'-OR s In some embodiments, each sugar modification is independently 2'-OR s , where R s is optionally substituted C 1-6 In some embodiments, each sugar modification is 2'-OMe. In some embodiments, each sugar modification is 2'-MOE. In some embodiments, each sugar modification is independently 2'-OMe or 2'-MOE. In some embodiments, each sugar modification is independently 2'-OMe, 2'-MOE, or an LNA sugar. As will be appreciated by those skilled in the art, modifications of sugars, nucleobases, internucleotide linkages, etc. can be and often are utilized in combination in oligonucleotides, for example, see the various oligonucleotides in Table 1.

[0116] In some embodiments, the sugar is described in US 9394333, US 9744183, US 9605019, US9598458, US 9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 and / or WO 2019 / 032612, the sugars of each of which are incorporated herein by reference.

[0117] Various additional sugars are known in the art for preparing oligonucleotides or analogs thereof and can be utilized in accordance with the present disclosure.

[0118] Internucleotide linkage

[0119] In some embodiments, oligonucleotides comprise base modifications, sugar modifications, and / or internucleotide linkage modifications. According to the present disclosure, various internucleotide linkages can be utilized to link units comprising nucleobases, such as nucleosides. In some embodiments, oligonucleotides comprise both one or more modified internucleotide linkages and one or more natural phosphate linkages. As is well known to those skilled in the art, natural phosphate linkages are widely present in natural DNA and RNA molecules; they have the structure -OP(O)(OH)O-, linking sugars in nucleosides in DNA and RNA, and may exist in various salt forms, for example, at physiological pH (about 7.4), natural phosphate linkages are primarily present as -OP(O)(OH)O- with anions. - )O- in salt form. A modified internucleotide linkage or non-natural phosphate linkage refers to an internucleotide linkage that is not a natural phosphate linkage or a salt form thereof. Based on their structure, modified internucleotide linkages may also be in salt form. For example, as will be appreciated by those skilled in the art, a phosphorothioate internucleotide linkage having the structure -OP(O)(SH)O- may be in various salt forms, such as, at physiological pH (about 7.4), a phosphorothioate internucleotide linkage with an anion -OP(O)(SH)O- may be in various salt forms. - )O-.

[0120] In some embodiments, the oligonucleotide comprises an internucleotide linkage that is a modified internucleotide linkage, such as phosphorothioate, phosphorodithioate, methylphosphonate, phosphoroamidate, thiophosphate, 3'-phosphorothioate, or 5'-phosphorothioate.

[0121] In some embodiments, the internucleotide linkage is as described in US 9394333, US 9744183, US 9605019, US9598458, US 9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 and / or WO 2019 / 032612, the internucleotide linkages in each of which are incorporated herein by reference.

[0122] In some embodiments, the internucleotide linkage is as described in U.S. Patent Nos. 3,687,808, 4,469,863, 4,476,301, 5,177,195, 5,023,243, 5,034,506, 5,166,315, 5,185,444, 5,188,897, 5,214,134, 5,216,141, 5,235,033, 5,264,423, 5,264,564, 5,276,019, 5,278,302, 5,286,7 17, 5321131, 5399676, 5405938, 5405939, 5434257, 5453496, 5455233, 5466677, 5466677, 5470967, 5476925, 5489677, 5519126, 5536821, 5541307, 5541316, 5550111, 5561225, 5563253, 5 571799, 5587361, 5596086, 5602240, 5608046, 5610289, 5618704, 5623070, 5625050, 5633360, 564562, 5663312, 5677437, 5677439, 6160109, 6239265, 6028188, 6124445, 6169170, 617220 9, 6277603, 6326199, 6346614, 6444423, 6531590, 6534639, 6608035, 6683167, 6858715, 6867294, 6878805, 7015315, 7041816, 7273933, 7321029, or RE39464, the internucleotide linkages in each of which are incorporated herein by reference.

[0123] In some embodiments, the oligonucleotide comprises one or more modified internucleotide linkages. In some embodiments, the internucleotide linkages of each modification are independently phosphorothioate internucleotide linkages. In some embodiments, one or more of all internucleotide linkages in the oligonucleotide, for example, about 1-20, 1-15, 1-10 or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or about 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more, are independently phosphorothioate internucleotide linkages. In some embodiments, about 10% or more of all internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 25% or more of all internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 50% or more of all internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 60% or more of all internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 70% or more of all internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 75% or more of all internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 80% or more of all internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 85% or more of all internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 90% or more of all internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 95% or more of all internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, each internucleotide bond to a natural DNA sugar is independently a phosphorothioate internucleotide bond. In some embodiments, each bond in the provided oligonucleotide is a phosphorothioate internucleotide bond. In some embodiments, each internucleotide bond in the oligonucleotide is independently a phosphorothioate internucleotide bond. In some embodiments, the oligonucleotide comprises one or more natural phosphate bonds. In some embodiments, each natural phosphate bond is independently bonded to at least one modified sugar. In some embodiments, each sugar bonded to a natural phosphate bond is independently a modified sugar. In some embodiments, each sugar bonded to a natural phosphate bond is independently a 2'-OR s Modified sugars or bicyclic sugars (eg, LNA sugars). In some embodiments, each sugar bonded to a natural phosphate linkage is independently 2'-OR sModified Sugars. In some embodiments, each sugar bonded to a native phosphate linkage is independently a 2'-MOE modified sugar.

[0124] Wings and core

[0125] In some embodiments, the oligonucleotide comprises or consists of a 5'-wing-core-wing-3' structure.

[0126] Wings and core can independently have various suitable lengths. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more core bases are independently present in a wing or core. In some embodiments, each core base independently comprises an optionally substituted monocyclic, bicyclic or polycyclic ring having at least one nitrogen ring atom; in some embodiments, each core base independently comprises an optionally substituted A, T, C, G or U, or a substituted tautomer of A, T, C, G or U. In some embodiments, the number of core bases in a wing is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In some embodiments, the number of wings is 1. In some embodiments, the number of wings is 2. In some embodiments, the number of wings is 3. In some embodiments, the number of wings is 4. In some embodiments, the number of wings is 5. In some embodiments, the number of wings is 6. In some embodiments, the number of wings is 7. In some embodiments, the number of wings is 8. In some embodiments, the number of wings is 9. In some embodiments, the number of wings is 10. In some embodiments, in a wing-core-wing structure, the two wings have the same length. In some embodiments, the two wings have different lengths. In some embodiments, the number of cores is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more. In some embodiments, the number of cores is 5-15, for example, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15. In some embodiments, the number of cores is 1. In some embodiments, the number of cores is 2. In some embodiments, the number of cores is 3. In some embodiments, the number of cores is 4. In some embodiments, the number of cores is 5. In some embodiments, the number of cores is 6. In some embodiments, the number of cores is 7. In some embodiments, the number of cores is 8. In some embodiments, the number of cores is 9. In some embodiments, the number of cores is 10. In some embodiments, the number of cores is 11. In some embodiments, the number of cores is 12. In some embodiments, the number of cores is 13. In some embodiments, the number of cores is 14. In some embodiments, the number of cores is 15.

[0127] In some embodiments, wing-core-wing is described as "XYZ", wherein "X" represents the length of the 5' wing (as the number of nucleobases), "Y" represents the length of the core (as the number of nucleobases), and "Z" represents the length of the 3' wing (as the number of nucleobases). Example embodiments of X, Y, and Z include those lengths described as numbers (e.g., above) and as examples of oligonucleotide species (e.g., Table 1). In some embodiments, the two wings have the same or different lengths and / or have the same or different modifications or modified patterns. In some embodiments, Y is between 8 and 15. In some embodiments, X, Y, or Z can each independently be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more. In some embodiments, each of X, Y, and Z is independently 1-30. In some embodiments, XZZ is 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7-5, 4-7-5, 5-7-4, or 4-7-4.

[0128] In some embodiments, the wing comprises one or more sugar modifications. In some embodiments, each sugar in the wing is independently modified. In some embodiments, each wing sugar in the oligonucleotide is independently modified. In some embodiments, each modified sugar independently comprises a 2'-modification (e.g., 2'-OR s In some embodiments, each wing sugar is independently 2'-OR s In some embodiments, each sugar modification in the wing is the same. In some embodiments, the wing comprises different sugar modifications, such as different 2'-OR s In some embodiments, the 2'-OR s In some embodiments, 2'-OR s In some embodiments, each sugar in the wing is a 2'-MOE modified sugar. In some embodiments, each sugar in the wing is a 2'-OMe modified sugar. In some embodiments, the wing comprises one or more 2'-OMe modified sugars and one or more 2'-MOE modified sugars.

[0129] In some embodiments, the two wings of the wing-core-wing structure comprise different sugar modifications or patterns thereof.

[0130] In some embodiments, under certain conditions, certain sugar modifications (eg, 2'-MOE) provide greater stability than other sugar modifications (eg, 2'-OMe or native DNA or RNA sugars).

[0131] In some embodiments, the wing comprises a bicyclic sugar. In some embodiments, the bicyclic sugar is an LNA, cEt, or BNA sugar.

[0132] In some embodiments, one or more internucleotide linkages bonded to the 5'-wing sugar are each independently modified internucleotide linkages. In some embodiments, they are each independently phosphorothioate internucleotide linkages. In some embodiments, each internucleotide linkage bond bonded to the 5'-wing sugar is independently a modified internucleotide linkage. In some embodiments, each such internucleotide linkage bond is independently a phosphorothioate internucleotide linkage.

[0133] In some embodiments, one or more internucleotide linkages bonded to the 3'-wing sugar are each independently modified internucleotide linkages. In some embodiments, they are each independently phosphorothioate internucleotide linkages. In some embodiments, each internucleotide linkage bond bonded to the 3'-wing sugar is independently a modified internucleotide linkage. In some embodiments, each such internucleotide linkage bond is independently a phosphorothioate internucleotide linkage.

[0134] In some embodiments, the core comprises one or more, for example, about 1-20, 5-20, 6-20, 7-20, 8-20, 9-20, 10-20, or 5-15, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 natural DNA sugars. In some embodiments, the core comprises 2 or more natural DNA sugars. In some embodiments, the core comprises 3 or more natural DNA sugars. In some embodiments, the core comprises 4 or more natural DNA sugars. In some embodiments, the core comprises 5 or more natural DNA sugars. In some embodiments, the core comprises 6 or more natural DNA sugars. In some embodiments, the core comprises 7 or more natural DNA sugars. In some embodiments, the core comprises 8 or more natural DNA sugars. In some embodiments, the core comprises 9 or more natural DNA sugars. In some embodiments, the core comprises 10 or more natural DNA sugars. In some embodiments, the core comprises 11 or more natural DNA sugars. In some embodiments, the core comprises 12 or more natural DNA sugars. In some embodiments, the core comprises 13 or more natural DNA sugars. In some embodiments, the core comprises 14 or more natural DNA sugars. In some embodiments, the core comprises 15 or more natural DNA sugars. In some embodiments, such DNA sugars are continuous. In some embodiments, each sugar in the core is independently a natural DNA sugar.

[0135] In some embodiments, one or more internucleotide linkages bonded to the core sugar are each independently a modified internucleotide linkage. In some embodiments, they are each independently a phosphorothioate internucleotide linkage. In some embodiments, each internucleotide linkage bond bonded to the core sugar is independently a modified internucleotide linkage. In some embodiments, each such internucleotide linkage bond is independently a phosphorothioate internucleotide linkage.

[0136] In some embodiments, the core is capable of hybridizing to a target mRNA to form a duplex structure that can be recognized by RNase H, allowing RNase H to cleave the mRNA.

[0137] Oligonucleotides

[0138] Among other things, the present disclosure provides various oligonucleotides. As described herein, oligonucleotides can contain various core base modifications, sugar modifications, internucleotide linkages and patterns thereof. In some embodiments, the present disclosure provides the oligonucleotides in Table 1 as examples.

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145] NOTE: Unless otherwise indicated, oligonucleotides are described from 5' to 3'. As will be understood by those skilled in the art, the internucleotide linkage links the 5' and 3' positions of the sugars. * ” indicates a phosphorothioate internucleotide linkage), the internucleotide linkage is a natural phosphate linkage. Unless otherwise indicated, each of A, T, C and G is independently deoxyadenosine, thymidine, deoxycytidine and deoxyguanosine, respectively (e.g., as commonly found in natural DNA). “2MOEr” indicates a 2'-MOE modification to the sugar; “5” indicates that the nucleoside has a 5'-OH group (e.g., when at the 5' end of the oligonucleotide); “3” indicates that the nucleoside has a 3'-OH group (e.g., when at the 3' end of the oligonucleotide); “i” indicates that the nucleoside is in the middle of the oligonucleotide with its 5' and 3' positions bonded to the indicated internucleotide linkage; “Me-dC” indicates 5-methyl-2'-deoxycytidine nucleoside. As will be appreciated by those skilled in the art, oligonucleotides can exist in various forms, including various salt forms.

[0146] / 52MOErA / is

[0147] / 52MOErT / is

[0148] / 52MOErC / is

[0149] / 52MOErG / is

[0150] * is -OP(O)(SH)-O-;

[0151] / i2MOErA / is / i2MOErT / is / i2MOErC / is / i2MOErG / is / iMe-dC / is

[0152] / 32MOErA / is / 32MOErT / is

[0153] / 32MOErC / is and

[0154] / 32MOErG / is In some embodiments, the oligonucleotide provided is capable of hybridizing to a calpain-2 transcript. In some embodiments, the oligonucleotide provided can reduce the level of a calpain-2 transcript or its product. In some embodiments, the oligonucleotide provided can reduce the level of a calpain-2 mRNA. In some embodiments, the oligonucleotide provided can reduce the level of a calpain-2 polypeptide. In some embodiments, the oligonucleotide provided can reduce the activity level of a calpain-2 polypeptide observed in a system (e.g., a sample, a subject, etc.). In some embodiments, the oligonucleotide is selected from Table 1. In some embodiments, the oligonucleotide is a pharmaceutically acceptable salt of an oligonucleotide selected from Table 1.

[0155] In some embodiments, the present disclosure provides oligonucleotides that are particularly effective in reducing calpain-2 transcript, polypeptide, and / or activity levels.

[0156] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*T*T* / iMe-dC / *T*G*T*A*G*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0157] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *A* / iMe-dC / *T*G*G*T*T* / iMe-dC / *A*G* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / 32MOErT / or a salt thereof.

[0158] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErA / *G*G*T* / iMe-dC / *A*G*G* / iMe-dC / *A*G* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErT / or a salt thereof.

[0159] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / * / iMe-dC / *T*T*T*T*T*G* / iMe-dC / *A* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / or a salt thereof.

[0160] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / *T*G*T*G* / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / 32MOErT / or a salt thereof.

[0161] In some embodiments, the present disclosure provides a composition comprising a provided oligonucleotide. In some embodiments, the oligonucleotide composition comprises the provided oligonucleotide or its salt, and various diastereomers and salts thereof. In some embodiments, the oligonucleotide composition comprises the provided oligonucleotide or its salt, and various diastereomers relative to the phosphorus and its salt of the chiral linker. In some embodiments, the oligonucleotide can exist in one or more forms. In some embodiments, the oligonucleotide in the composition exists in salt form. In some embodiments, the oligonucleotide in the composition exists in one or more salt forms. In some embodiments, the salt form is a pharmaceutically acceptable salt form. In some embodiments, the salt form is a metal salt. In some embodiments, the salt form is an alkali metal salt. In some embodiments, the salt form is a sodium salt. In some embodiments, the salt form is a potassium salt. In some embodiments, the salt form is a calcium salt. In some embodiments, the salt form is an ammonium salt form (e.g., N(R')3, wherein R' is as described herein; in some embodiments, each R' is independently -H or an optionally substituted C 1-6In some embodiments, the oligonucleotide composition is a liquid composition wherein the oligonucleotide is dissolved in a solution. In some embodiments, the solution is a buffer. In some embodiments, the solution is a buffered saline. In some embodiments, in the composition, acidic internucleotide linkages, such as natural phosphate linkages, phosphorothioate internucleotide linkages, for example, independently exist in anionic form and the composition comprises one or more types of cations, such as Na + , K + wait.

[0162] Additional chemistry section

[0163] In some embodiments, oligonucleotide comprises one or more other chemical moieties.Various other chemical moieties known in the art, for example targeting moiety, carbohydrate moiety, lipid moiety etc., and can be utilized according to the disclosure, to regulate the character and / or activity of oligonucleotide, for example stability, half-life, activity, sending, pharmacodynamic properties, pharmacokinetic properties etc. In some embodiments, some other chemical moieties help oligonucleotide to be delivered to desired cell, tissue and / or organ, including but not limited to the cell of central nervous system. In some embodiments, some other chemical moieties promote the internalization of oligonucleotide. In some embodiments, some other chemical moieties increase oligonucleotide stability. In some embodiments, the disclosure provides the technology for various other chemical moieties to be mixed in the oligonucleotide.

[0164] Some useful additional chemical moieties are described in US 9394333, US 9744183, US 9605019, US9598458, US 9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 and / or WO 2019 / 032612, the additional chemical moieties in each of which are incorporated herein by reference.

[0165] preparation

[0166] Various technologies can be obtained in this area to prepare the oligonucleotide provided, and can be utilized according to the disclosure. For example, in some embodiments, oligonucleotide is prepared on a solid support (support) using phosphoramidite. In some embodiments, oligonucleotide is prepared in solution. In some embodiments, the preparation of oligonucleotide comprises multiple cycles, and in each cycle, one or more nucleoside units are added, typically one. In some embodiments, circulation comprises the coupling of phosphoramidite, the unreacted 5'-OH group of blocking, modification (such as sulfurization) and / or the 5'-OH group of blocking protection in the nucleoside of new coupling. In some embodiments, when reaching the oligonucleotide of certain length, modification can be carried out at the end of the cycle.

[0167] Certain techniques for preparing oligonucleotides are described in US 3687808, US 4469863, US 4476301, US5177195, US 5023243, US 5034506, US 5166315, US 5185444, US 5188897, US 5214134, US5216141, US 5235033, US 5264423, US 5264564, US 5276019, US 5278302, US 5286717, US5321131, US 5399676, US 5405938, US 5405939, US 5434257, US 5453496, US 5455233, US5466677, US 5466677, US 5470967, US 5476925, US 5489677, US 5519126, US 5536821, US5541307, US 5541316, US 5550111, US 5561225, US 5563253, US 5571799, US 5587361, US5596086, US 5602240, US 5608046, US 5610289, US 5618704, US 5623070, US 5625050, US5633360, US 564562, US 5663312, US 5677437, US 5677439, US 6160109, US 6239265, US6028188, US 6124445, US 6169170, US 6172209, US 6277603, US 6326199, US 6346614, US644442, US 6531590, US 6534639, US 6608035, US 6683167, US 6858715, US 6867294, US6878805, US 7015315, US 7041816, US 7273933, US 7321029, US RE39464, US 9394333, US9744183, US 9605019, US 9598458, US 9982257, US10160969, US10479995, US 2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO 2018 / 223056, WO2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 or WO 2019 / 032612.

[0168] In some embodiments, oligonucleotide and / or composition are provided as the stereo random composition relative to the phosphorus of chiral link.For example, when using the traditional phosphoramidite comprising N, N-diisopropylamine and 2-cyanoethoxy group to carry out oligonucleotide synthesis, can form chiral link without stereoselectivity or low stereoselectivity.In some embodiments, oligonucleotide is provided as the mixture of various diastereomers and / or its salt.In some embodiments, composition comprises oligonucleotide and / or its one or more or all diastereomers relative to the phosphorus of chiral link.In some embodiments, oligonucleotide and / or its diastereomer exist independently with one or more forms.In some embodiments, oligonucleotide and / or its diastereomer exist independently with one or more salt forms (for example, one or more pharmaceutically acceptable salt forms).In some embodiments, for the phosphorus of each chiral link, Rp and Sp configuration are present in composition. In some embodiments, for each phosphorus of a chiral linkage, the Rp and Sp configurations both have a percentage of at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45%. In some embodiments, for a chiral internucleotide linkage, the Rp and Sp configurations both have a percentage of about 50%. In some embodiments, for each chiral internucleotide linkage, the Rp and Sp configurations both have a percentage of about 50%. In some embodiments, for each chiral internucleotide linkage, the Rp and Sp configurations both have a percentage of about 20-80%. In some embodiments, for each chiral internucleotide linkage, the Rp and Sp configurations both have a percentage of about 30-70%. In some embodiments, for each chiral internucleotide linkage, the Rp and Sp configurations both have a percentage of about 40-60%. In some embodiments, for each chiral internucleotide linkage, the Rp and Sp configurations both have a percentage of about 45-55%. In some embodiments, the Rp configuration independently has a percentage of about 20-80%, 30-70%, 40-60%, or 45-55%, or about 20%, 30%, 40%, 50%, 60%, 70%, or 80% for each phosphorus of the linkage.

[0169] The amount, concentration, etc. of the oligonucleotides provided can be assessed using various techniques according to the present disclosure, such as by UV (e.g., at 260 nm), weight, etc. In some embodiments, the amount, concentration, etc. of all oligonucleotides present in the composition are assessed. In some embodiments, the amount, concentration, etc. of all oligonucleotides sharing the same composition (e.g., diastereomers relative to the phosphorus of the chiral linkage) are included, including all forms including pharmaceutically acceptable salt forms.

[0170] Calpain-2

[0171] In some embodiments, calpain-2 (CAPN2) refers to a gene or its gene product (e.g., nucleic acid (e.g., DNA, RNA, etc.), transcript (e.g., calpain-2 mRNA), protein encoded thereby (e.g., calpain-2 polypeptide), etc.) from a species, which may be referred to as CAPN2, CANP2, CANPL2, mCANP, CANPml, calpain-2, calpain 2, m-calpain, millimolar calpain, calpain M-type, calpain-2 large subunit, calpain 2 (m / ll) large subunit, calpain large polypeptide L2, calpain-2 catalytic subunit, calcium-activated neuroprotease 2, CANP 2, etc. Various CAPN2 sequences (including various variants thereof) are readily available to those skilled in the art. Various techniques, such as assays, cells, animal models, etc., have also been reported and can be used according to the present disclosure to characterize and / or evaluate the provided technologies (e.g., oligonucleotides, compositions, methods, etc.).

[0172] The CAPN2 gene is reported to encode a calpain-2 protein, which, according to various reports, comprises 622 or 700 amino acids, depending on the isoform, and is primarily localized to the cytoplasm and plasma membrane in various tissues, including the central nervous system (CNS). It is reported that, in some embodiments, human calpain-2 comprises multiple domains, which, from the N-terminal region to the C-terminal region, include: (i) an α-helix; (ii) a CysPc domain comprising a first protease core domain (PC1) and a second protease core domain (PC2); (iii) a calpain-type β-sandwich (CBSW) domain; and (iv) a penta-EF-hand in the catalytic large subunit (PEF(L)) domain. Calpain-2 proteins from other species (e.g., monkey, rat, and mouse) are reported to comprise various conserved domains, like human calpain-2.

[0173] It is reported that calpain-2 belongs to the calcium-dependent protease family and can cleave a variety of protein targets, including actin, cytoplasmic polyadenylation element binding protein 3 (CPEB3), p35, phosphatase and tensin homolog deleted on chromosome 10 (PTEN), protein tyrosine phosphatase (PTPN13; also known as Fas-associated protein-1 (FAP1)), spectrin, TDP-43, neurofilament light chain (Wang et al., Expert Opin. Ther. Targets, 2018; Baudry, Curr. Neuropharmacol., 2019), etc. It is reported that the activation of calpain-2 involves a relatively high concentration of calcium ions (Ca 2+ ), with reported ranges including near-millimolar amounts, such as 400-800 μM. Furthermore, some studies have suggested that calpain-2 may be activated by phosphorylation by epidermal growth factor (EGF) or brain-derived neurotrophic factor (BDNF) via extracellular signal-regulated kinase (ERK) (Glading et al., Mol. Cell Biol., 2004; Zadran et al., J. Neurosci., 2010). Calpain-2 has been reported to act as a regulator of synaptic plasticity and may limit such plasticity (Baudry and Bi, Trends Neurosci., 2017), and has also been reported to be involved in excitotoxic neurotoxicity, as inhibition of calpain-2 can reduce such toxicity (Wang et al., J. Neurosci., 2013).

[0174] It is reported that the disorder of calpain-2 is associated with various forms of neurodegeneration. Calpain-2 is associated with neurodegenerative conditions, disorders or diseases (including amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD), etc.). It is reported that another neurodegenerative disease, Wolfram syndrome (WS), involves overactivation of calpain-2 and calpain-2-related cell death (Lu et al., Proc. Natl. Acad. Sci., 2014). In addition to progressive neurodegenerative diseases, inhibition of calpain-2 has been reported as a potential target for treating acute neuronal injury (Wang et al. Expert Opin. Ther. Targets, 2018). Some studies have also associated calpain-2 with traumatic brain injury (TBI), as it is reported that calpain-2 deletion or inhibition leads to improvement of neuropathological features in TBI mouse models (Wang et al. Sci. Adv., 2020). It has been reported that calpain-2 inhibition may lead to improved TDP-43 localization in TBI; TDP-43 has been reported to form inclusion bodies in certain forms of neurodegeneration (Gao et al., J. Neurochem., 2018). Therefore, calpain-2 may be a potential therapeutic target for both progressive neurodegenerative diseases and acute neuronal injury.

[0175] CAPN2-associated condition, disorder or disease

[0176] It is reported that various conditions, disorders or diseases are associated with calpain-2 and can be prevented or treated by the present disclosure. Generally, if the presence, level, activity and / or form of calpain-2 and / or its products (e.g., transcripts, encoded proteins, etc.) are associated with the incidence and / or susceptibility (e.g., in a related population), the disease, disorder or condition is associated with calpain-2. In some embodiments, conditions, disorders or diseases associated with calpain-2 can be treated and / or prevented by reducing the expression, level and / or activity of calpain-2 transcripts and / or proteins.

[0177] Among other things, the present disclosure provides technologies for preventing and / or treating various conditions, disorders, or diseases. In some embodiments, the condition, disorder, or disease is a neurodegenerative disease. In some embodiments, the condition, disorder, or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder, or disease is traumatic brain injury (TBI). In some embodiments, the condition, disorder, or disease is Alzheimer's disease (AD). In some embodiments, the condition, disorder, or disease is Parkinson's disease (PD). In some embodiments, the condition, disorder, or disease is frontotemporal dementia (FTD). In some embodiments, the condition, disorder, or disease is progressive supranuclear palsy (PSP). In some embodiments, the condition, disorder, or disease is corticobasal degeneration (CBD). In some embodiments, the condition, disorder, or disease is Wolfram syndrome (WS). In some embodiments, the condition, disorder, or disease is Friedreich's ataxia (FRDA). In some embodiments, the condition, disorder, or disease is multiple system atrophy (MSA). In some embodiments, the patient's condition, disorder or disease is spinocerebellar ataxia (SCA). In some embodiments, the patient's condition, disorder or disease is spinal muscular atrophy (SMA). In some embodiments, the patient's condition, disorder or disease is Pick's disease (PD). In some embodiments, the patient's condition, disorder or disease is progressive motor atrophy. In some embodiments, the patient's condition, disorder or disease is concussion. In some embodiments, the patient's condition, disorder or disease is spinal cord injury (SCI). In some embodiments, the patient's condition, disorder or disease is chronic traumatic encephalopathy (CTE). In some embodiments, the patient's condition, disorder or disease is epileptic seizure (seizure). In some embodiments, the patient's condition, disorder or disease is stroke. In some embodiments, the patient's condition, disorder or disease is cerebral hemorrhage. In some embodiments, the patient's condition, disorder or disease is tauopathy (tauopathy). In some embodiments, the patient's condition, disorder or disease is related to Wallerian degeneration. In some embodiments, the patient's condition, disorder or disease is acute glaucoma. In some embodiments, the patient's condition, disorder or disease is cancer. In some embodiments, the condition, disorder, or disease is diabetes. In some embodiments, the condition, disorder, or disease is chemotherapy-induced peripheral neuropathy.

[0178] Characterization and evaluation

[0179] In some embodiments, the properties and / or activities of the oligonucleotides and compositions thereof provided can be characterized and / or evaluated using various techniques available to those skilled in the art, such as biochemical assays (e.g., RNase H assays), cell-based assays, animal models, clinical trials, and the like. Certain useful techniques are described in the Examples. Those skilled in the art who read this disclosure will readily appreciate that other techniques can be designed and / or used based on this disclosure, such as in vitro models (e.g., cell lines) for various conditions, disorders, or diseases, animal models for various conditions, disorders, or diseases, clinical trials, and the like, to evaluate the provided techniques (e.g., oligonucleotides, compositions, methods, and the like).

[0180] Biological applications

[0181] As will be appreciated by those skilled in the art, oligonucleotides are useful for many purposes. In some embodiments, the technology provided (e.g., oligonucleotides, compositions, methods, etc.) is useful for reducing the level and / or activity of various calpain-2 transcripts (e.g., RNA) and / or the products (e.g., proteins) encoded thereby. In some embodiments, the technology provided reduces the level and / or activity of calpain-2 RNA transcripts. In some embodiments, the oligonucleotides and compositions provided provide for knocking down calpain-2 mRNA. In some embodiments, the technology provided reduces the level of calpain-2 polypeptides. In some embodiments, the technology provided reduces the level of calpain-2 activity (e.g., protease activity).

[0182] In some embodiments, the present disclosure provides a method for reducing the level of calpain-2 mRNA in a system, comprising administering or delivering an effective amount of an oligonucleotide or oligonucleotide composition to the system. In some embodiments, the present disclosure provides a method for reducing the level of calpain-2 polypeptide in a system, comprising administering or delivering an effective amount of an oligonucleotide or oligonucleotide composition to the system. In some embodiments, the present disclosure provides a method for reducing the level of calpain-2 activity in a system, comprising administering or delivering an effective amount of an oligonucleotide or oligonucleotide composition to the system. In some embodiments, the present disclosure provides a method for reducing the level of calpain-2 protease activity in a system, comprising administering or delivering an effective amount of an oligonucleotide or oligonucleotide composition to the system. In some embodiments, the reduction in the level of calpain-2 mRNA and / or polypeptide increases the mRNA and / or polypeptide levels of calpain-2 targets. In some embodiments, the reduction in the level of calpain-2 mRNA and / or polypeptide increases the mRNA and / or polypeptide levels of calpain inhibitors. In some embodiments, the present disclosure provides a technique for increasing the level of calpain inhibitor mRNA and / or polypeptide in a system, comprising administering or delivering an effective amount of an oligonucleotide or oligonucleotide composition targeting calpain-2 to the system. Calpain-2 is reported to interact with various partners (e.g., TDP43 and other ALS biomarkers). In some embodiments, the present disclosure provides techniques for regulating the interaction between calpain-2 and a partner. In some embodiments, the present disclosure provides techniques for regulating the interaction between calpain-2 and a partner in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or oligonucleotide composition targeting calpain-2.

[0183] In some embodiments, the system comprises calpain-2 mRNA. In some embodiments, the system expresses calpain-2 mRNA. In some embodiments, the system expresses calpain-2 polypeptide.

[0184] In some cases, the system is an in vitro system. In some cases, the system is an in vivo system.

[0185] In some embodiments, the system comprises a cell. In some embodiments, the system is a cell. In some embodiments, the system comprises a population of cells. In some embodiments, the system is a population of cells. In some embodiments, the cell is a neural cell. In some embodiments, the cell is a cell in the nervous system. In some embodiments, the cell is a cell in the CNS. In some embodiments, the cell has one or more characteristics, properties, and / or activities of a neural cell.

[0186] In some embodiments, the system is a tissue. In some embodiments, the system comprises a tissue. In some embodiments, the system is an organ. In some embodiments, the system comprises an organ. In some embodiments, the system is the brain or a portion thereof. In some embodiments, the system comprises the brain or a portion thereof. In some embodiments, the system is an organism. In some embodiments, the system comprises an organism. In some embodiments, the system is a subject. In some embodiments, the system is a mammal, such as a mouse, rat, monkey, etc. In some embodiments, the system is a human.

[0187] In some embodiments, the level is reduced by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 75%, 80%, 85%, 90% or 95% compared to the absence of the oligonucleotide or composition provided and / or the presence of a reference oligonucleotide or composition. In some embodiments, this reduction is achieved at certain oligonucleotide concentrations (e.g., 1nM, 5nM, 10nM, 100nM, 500nM, 1uM, 5uM, etc.) or dosages. In some embodiments, this reduction is achieved in systems such as various suitable assays (e.g., assays based on in vitro cells, assays described in the examples, etc.). In some embodiments, the reference composition does not include oligonucleotides targeting calpain-2. In some embodiments, the reference oligonucleotide targets nucleic acids different from calpain-2. In some embodiments, the level is the level of mRNA (e.g., calpain 2 mRNA). In some embodiments, the level is the level of polypeptides (e.g., calpain 2 protein). In some embodiments, the level is reduced by at least about 10%. In some embodiments, the level is reduced by at least about 20%. In some embodiments, the level is reduced by at least about 30%. In some embodiments, the level is reduced by at least about 40%. In some embodiments, the level is reduced by at least about 50%. In some embodiments, the level is reduced by at least about 60%. In some embodiments, the level is reduced by at least about 70%. In some embodiments, the level is reduced by at least about 75%. In some embodiments, the level is reduced by at least about 80%. In some embodiments, the level is reduced by at least about 85%. In some embodiments, the level is reduced by at least about 90%. In some embodiments, the level is reduced by at least about 95%.In some embodiments, the level of calpain-2 mRNA is reduced by about or at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% at about 20 uM oligonucleotide; by about or at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% at about 15 uM oligonucleotide; by about or at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% at about 10 uM oligonucleotide; and by about or at least about 5 uM oligonucleotide. or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70%; in some embodiments, at 2.5 uM oligonucleotide, it is reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% or 60%; in some embodiments, at about 1.25 uM oligonucleotide, it is reduced by about or at least about In some embodiments, the reduction is about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% or 60%; in some embodiments, at about 0.63uM oligonucleotide, it is reduced by about 10%, 15%, 20%, 25%, 30%, 35% or 40%; in some embodiments, at about 0.32uM oligonucleotide, it is reduced by about or at least about 10%, 15%, 20%, 25% or 30%. In some embodiments, the reduction is about or at least about 50%. In some embodiments, the reduction is about or at least about 55%. In some embodiments, the reduction is about or at least about 60%. In some embodiments, the reduction is about or at least about 65%. In some embodiments, the reduction is about or at least about 70%. In some embodiments, the reduction is about or at least about 75%. In some embodiments, the reduction is about or at least about 80%. In some embodiments, the reduction is about or at least about 85%. In some embodiments, the reduction is about or at least about 90%. In some embodiments, the reduction is about or at least about 95%.In some embodiments, the reduction is assessed at about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks before or after administration or delivery of a provided oligonucleotide or composition.In some embodiments, reduction is assessed at about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks, of or after removing or flushing the provided oligonucleotide or composition. In some embodiments, reduction is assessed at day 0. In some embodiments, reduction is assessed at about day 3. In some embodiments, reduction is assessed at about day 10. In some embodiments, reduction is assessed at about day 14. In some embodiments, reduction is assessed at about day 21. In some embodiments, the reduction in one or more assessments (e.g., calpain mRNA levels) is independently about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%; in some embodiments, the reduction is independently about or at least about 75%; in some embodiments, the reduction is about or at least about 80%. In some embodiments, the reduction in one or more assessments (e.g., of calpain 2 protein or activity) is independently about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80%; in some embodiments, the reduction is about or at least about 20%; in some embodiments, the reduction is about or at least about 25%; in some embodiments, the reduction is about or at least about 30%; in some embodiments, the reduction is about or at least about 35%; in some embodiments, the reduction is about or at least about 40%; in some embodiments, the reduction is about or at least about 45%; in some embodiments, the reduction is about or at least about 50%; in some embodiments, the reduction is about or at least about 55%; in some embodiments, the reduction is about or at least about 60%; in some embodiments, the reduction is about or at least about 70%. In some embodiments, the reduction is relative to the absence of an oligonucleotide. In some embodiments, the reduction is relative to the presence of a reference oligonucleotide or composition (e.g., an oligonucleotide targeting TUG1 as described herein). In some embodiments, assessments are performed according to those described in the Examples, for example, in some embodiments, assessments are performed using iPSC-derived motor neurons at an oligonucleotide concentration of about 20 uM using gymnotic delivery.

[0188] In some embodiments, the activity of the oligonucleotide or oligonucleotide compositions provided can be assessed by IC50, which is the concentration at which the level of, for example, calpain-2 mRNA, polypeptide, activity, etc., is reduced by 50% under appropriate conditions (e.g., in vitro assays based on cells, assays described in the Examples, etc.). In some embodiments, the oligonucleotide or compositions provided have an IC50 of approximately or no more than approximately 0.001, 0.01, 0.1, 0.5, 1, 2, 5, 10, 50, 100, 200, 500, 1000, 2000, 5000, or 10000 nM. In some embodiments, the oligonucleotide has an IC50 of approximately or no more than approximately 10000 nM. In some embodiments, the oligonucleotide has an IC50 of approximately or no more than approximately 5000 nM. In some embodiments, the oligonucleotide has an IC50 of approximately or no more than approximately 2000 nM. In some embodiments, the oligonucleotide has an IC50 of approximately or no more than approximately 1000 nM. In some embodiments, the IC50 is about or no more than about 500 nM. In some embodiments, the IC50 is about or no more than about 200 nM. In some embodiments, the IC50 is about or no more than about 100 nM. In some embodiments, the IC50 is about or no more than about 50 nM. In some embodiments, the IC50 is about or no more than about 20 nM. In some embodiments, the IC50 is about or no more than about 10 nM. In some embodiments, the IC50 is about or no more than about 5 nM. In some embodiments, the IC50 is about or no more than about 2 nM. In some embodiments, the IC50 is about or no more than about 1 nM.

[0189] In some embodiments, provided oligonucleotides and compositions are useful for treating various conditions, disorders, or diseases by reducing the level and / or activity of calpain-2 transcripts and / or products encoded thereby that are associated with the condition, disorder, or disease.

[0190] In some embodiments, the present disclosure provides a method for preventing a condition, disorder, or disease, comprising administering or delivering an effective amount of an oligonucleotide or composition of the present disclosure to a subject susceptible to the condition, disorder, or disease. In some embodiments, the present disclosure provides a method for treating a condition, disorder, or disease, comprising administering or delivering an effective amount of an oligonucleotide or composition of the present disclosure to a subject suffering from the condition, disorder, or disease.

[0191] The technology provided can be used to prevent or treat various conditions, disorders or diseases associated with calpain-2. In some embodiments, the subject benefits from a reduction in the level of calpain-2 transcripts, polypeptides and / or activity in certain cells, tissues and / or organs. In some embodiments, the condition, disorder or disease is a neurodegenerative condition, disorder or disease. In some embodiments, the condition, disorder or disease is or includes Wallerian degeneration. In some embodiments, Wallerian degeneration is associated with injury. In some embodiments, Wallerian degeneration is associated with pressure. In some embodiments, the condition, disorder or disease is associated with Wallerian degeneration. In some embodiments, the condition, disorder or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder or disease is neuropathy. In some embodiments, the condition, disorder or disease is peripheral neuropathy. In some embodiments, the condition, disorder or disease is chemotherapy-induced peripheral neuropathy. In some embodiments, the condition, disorder or disease is Parkinson's disease. In some embodiments, the condition, disorder or disease is Huntington's disease. In some embodiments, the condition, disorder, or disease is Alzheimer's disease. In some embodiments, the condition, disorder, or disease is frontotemporal dementia. In some embodiments, the condition, disorder, or disease is brain injury. In some embodiments, the condition, disorder, or disease is traumatic brain injury. In some embodiments, the condition, disorder, or disease is progressive supranuclear palsy. In some embodiments, the condition, disorder, or disease is corticobasal degeneration. In some embodiments, the condition, disorder, or disease is Wolfram syndrome. In some embodiments, the condition, disorder, or disease is Friedreich's Ataxia. In some embodiments, the condition, disorder, or disease is multiple system atrophy. In some embodiments, the condition, disorder, or disease is spinocerebellar ataxia. In some embodiments, the condition, disorder, or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder, or disease is Pick's disease. In some embodiments, the condition, disorder, or disease is progressive motor atrophy. In some embodiments, the condition, disorder, or disease is associated with neuronal damage. In some embodiments, the condition, disorder, or disease is associated with neuronal cell damage. In some embodiments, the condition, disorder, or disease is associated with neuronal cell death. In some embodiments, the condition, disorder, or disease is axonal degeneration. In some embodiments, the condition, disorder, or disease is axonal degeneration is ALS.

[0192] Various technologies can be utilized to apply or deliver the oligonucleotide or composition provided. In some embodiments, the oligonucleotide or composition are orally administered or delivered. In some embodiments, the oligonucleotide or composition are administered or delivered by a parenteral route. In some embodiments, the parenteral route comprises intravenous, intraarterial, intramuscular, intradermal, subcutaneous, intranasal and intraperitoneal approaches. In some embodiments, the oligonucleotide or composition are administered or delivered by an intraocular, intraorbital, subconjunctival, intravitreal, subretinal, scleral or cochlear intravenous route. In some embodiments, the oligonucleotide or composition are administered or delivered by a parenteral route. In some embodiments, the oligonucleotide or composition are administered or delivered intrathecally. In some embodiments, the oligonucleotide or composition are administered or delivered intravenously. In some embodiments, the oligonucleotide is administered or delivered as a liquid composition. In some embodiments, the oligonucleotide is dissolved in a liquid, such as a buffered saline solution (such as aCSF), for administering or delivering.

[0193] In some embodiments, the oligonucleotide or composition can be utilized in combination with another therapy (eg, another therapeutic agent).

[0194] In some embodiments, the technology provided (such as oligonucleotides, compositions, methods, etc.) delays or prevents the occurrence of one or more symptoms and / or hallmarks of the patient's condition, illness or disease. In some embodiments, the technology provided delays, slows down or prevents the progress of the patient's condition, illness or disease. In some embodiments, the technology provided alleviates (alleviate), improves, alleviates (relieve), suppresses, prevents, delays the occurrence of one or more symptoms or features of the patient's condition, illness and / or illness, reduces the severity of one or more symptoms or features of the patient's condition, illness and / or illness and / or reduces the incidence of one or more symptoms or features of the patient's condition, illness and / or illness. In some embodiments, the technology provided improves the performance of the subject in one or more assessments. In some embodiments, the technology provided improves the performance of the subject in one or more clinical assessments. In some embodiments, the technology provided independently improves one or more clinical assessment results of the subject.

[0195] Pharmaceutical composition

[0196] In some embodiments, the present disclosure provides a pharmaceutical composition comprising a provided compound (e.g., an oligonucleotide or a pharmaceutically acceptable salt thereof) and a pharmaceutical carrier. In some embodiments, for example, for therapeutic and clinical purposes, the oligonucleotides of the present disclosure are provided as pharmaceutical compositions.

[0197] As will be appreciated by those skilled in the art, oligonucleotides can be provided in various forms. In some embodiments, the oligonucleotides may be in acid form, such as in the form of -OP(O)(OH)O- for natural phosphate linkages; in the form of -OP(O)(SH)O- for phosphorothioate internucleotide linkages; etc. In some embodiments, the oligonucleotides provided may be in salt form, such as in the form of -OP(O)(ONa)O- in sodium salts for natural phosphate linkages; in the form of -OP(O)(SNa)O- in sodium salts for phosphorothioate internucleotide linkages; etc. Unless otherwise indicated, the oligonucleotides of the present disclosure may be in the form of acids, bases, and / or salts. In some embodiments, the compositions comprise one or more forms of the oligonucleotides. In some embodiments, the compositions comprise one or more salt forms of the oligonucleotides. In some embodiments, the compositions comprise one or more pharmaceutically acceptable salt forms of the oligonucleotides.

[0198] In some embodiments, the oligonucleotide or composition provided are used as a pharmaceutical composition. In some embodiments, the pharmaceutical composition is suitable for administering or delivering the oligonucleotide to a region or part of a body affected by the patient's condition, illness or disease. In some embodiments, the pharmaceutical composition comprises the oligonucleotide or its pharmaceutically acceptable salt provided for the treatment of an effective amount, and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises the oligonucleotide of each other diastereomers of the treatment of an effective amount, wherein the oligonucleotide exists in one or more forms. In some embodiments, the pharmaceutical composition comprises the oligonucleotide of each other diastereomers relative to the phosphorus of the chiral linker for the treatment of an effective amount, wherein the oligonucleotide exists in one or more forms.

[0199] In some embodiments, the pharmaceutically acceptable carrier is a buffer. In some embodiments, the pharmaceutically acceptable carrier is a buffered saline. In some embodiments, the pharmaceutically acceptable carrier is artificial cerebrospinal fluid. In some embodiments, the composition is a liquid composition comprising dissolved oligonucleotides.

[0200] In some embodiments, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ophthalmic administration, or otic administration. In some embodiments, the pharmaceutical composition is a tablet, pill, capsule, liquid, inhalant, nasal spray solution, suppository, suspension, gel, colloid, dispersion, suspension, solution, emulsion, ointment, lotion, eye drops, or ear drops. In some embodiments, the pharmaceutical composition is formulated for intrathecal administration.

[0201] As will be appreciated by those skilled in the art, oligonucleotides can exist in various salt forms. In some embodiments, the salt is a pharmaceutically acceptable salt. In some embodiments, the pharmaceutical composition comprises an oligonucleotide (optionally in the form of a salt) and a sodium salt. In some embodiments, the pharmaceutical composition comprises an oligonucleotide (optionally in the form of a salt) and sodium chloride. In some embodiments, each hydrogen ion of the oligonucleotide that can contribute to an alkali (e.g., under the conditions of an aqueous solution, a pharmaceutical composition, etc.) is replaced by a non-H+ cation. For example, in some embodiments, the pharmaceutically acceptable salt of an oligonucleotide is a full metal ion salt, wherein each hydrogen ion of each internucleotide bond (e.g., a natural phosphate bond, a thiophosphate internucleotide bond, etc.) (e.g., -OH, -SH, etc.) is replaced by a metal ion. Various suitable metal salts for pharmaceutical compositions are well known in the art and can be utilized according to the present disclosure. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a magnesium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is an ammonium salt (cation N(R')4 + In some embodiments, the pharmaceutically acceptable salt comprises one and no more than one type of cation. In some embodiments, the pharmaceutically acceptable salt comprises two or more types of cations. In some embodiments, the cation is Li + 、Na + , K + Mg 2+ or Ca 2+ In some embodiments, the pharmaceutically acceptable salt is an all-sodium salt. In some embodiments, the pharmaceutically acceptable salt is an all-sodium salt, wherein each internucleotide linkage that is a natural phosphate linkage (acid form -OP(O)(OH)-O-), if any, is present in its sodium salt form (-OP(O)(ONa)-O-), and each internucleotide linkage that is a phosphorothioate internucleotide linkage (acid form -OP(O)(SH)-O-), if any, is present in its sodium salt form (-OP(O)(SNa)-O-).

[0202] In some embodiments, the oligonucleotide or composition (e.g., pharmaceutical composition) is provided as a solid. In some embodiments, the oligonucleotide or composition (e.g., pharmaceutical composition) is lyophilized.

[0203] In some embodiments, the oligonucleotide or composition (eg, pharmaceutical composition) is stored at a temperature below ambient temperature, for example, at about or no higher than about -78°C, -20°C, 0°C, 4°C, or 10°C.

[0204] Various techniques for delivering nucleic acids and / or oligonucleotides are known in the art and can be utilized in accordance with the present disclosure. For example, various supramolecular nanocarriers can be used to deliver nucleic acids. Example nanocarriers include liposomes, cationic polymer complexes, and various polymer compounds. Complexation of nucleic acids with various polycations is another method for intracellular delivery; this includes the use of PEGylated polycations, polyvinylamine (PEI) complexes, cationic block copolymers, and dendrimers. Several cationic nanocarriers (including PEI and polyvinylamine dendrimers) may facilitate the release of contents from endosomes. Other methods may include the use of polymer nanoparticles, microspheres, liposomes, dendrimers, biodegradable polymers, conjugates, prodrugs, inorganic colloids (e.g., sulfur or iron), antibodies, implants, biodegradable implants, biodegradable microspheres, osmotic control implants, lipid nanoparticles, emulsions, oily solutions, aqueous solutions, biodegradable polymers, poly(lactide-co-glycolic acid), poly(lactic acid), liquid depots, polymer micelles, quantum dots, and lipid complexes. In some embodiments, the oligonucleotide is conjugated to another molecule.

[0205] In some embodiments, the oligonucleotide is administered or delivered by gymnotic uptake.

[0206] In some embodiments, the oligonucleotide or composition is formulated for a variety of modes of administration, including systemic and local or localized administration. Techniques and formulations generally can be found in Remington, The Science and Practice of Pharmacy (2000, 20th edition).

[0207] In certain embodiments, oligonucleotide or composition are delivered to CNS.In certain embodiments, oligonucleotide and composition are delivered to cerebrospinal fluid.In certain embodiments, oligonucleotide and composition are applied to brain parenchyma.In certain embodiments, oligonucleotide and composition are delivered to animal / experimenter by intrathecal administration or intraventricular administration.The wide distribution of oligonucleotide and composition can be realized with administration method described herein and / or known in the art.

[0208] In certain embodiments, parenteral administration is by injection, e.g., injection by a syringe, pump, etc. In certain embodiments, the injection is a bolus injection In certain embodiments, the injection is administered directly into a tissue or location, e.g., cerebrospinal fluid, striatum, caudate, cortex, hippocampus, and / or cerebellum.

[0209] The oligonucleotide provided and composition thereof are effective in a wide dosage range. In some embodiments, dosage is from about 0.01 to about 1000mg, from about 0.5 to about 100mg, from about 1 to about 50mg or from about 5 to about 100mg. Exact dosage can depend on the form of the approach used, the oligonucleotide used therein, the experimenter (such as body weight, age, body surface area, etc.), the patient's condition, illness or disease, and / or the doctor's preference and experience. In some embodiments, a fixed dose is used. In some embodiments, the oligonucleotide or composition provided is used or delivered (such as by injection or infusion), once a week, once every two weeks, once a month, once every two months, once every 90 days, once every 3 months, once every 6 months, once every 9 months or once a year. In some embodiments, two or more dosages are approximately the same amount. In some embodiments, one or more dosages are independently more than one or more other dosages. For example, in some embodiments, before one or more maintenance doses (each independent of lower amount), one or more loading doses (each independent of higher dosage) are used. In some embodiments, two or more or all of the loading doses are about the same amount. In some embodiments, a loading dose has a higher amount than another loading dose. In some embodiments, two or more or all of the maintenance doses are about the same amount. In some embodiments, a maintenance dose has a higher amount than another maintenance dose.

[0210] Example Implementation

[0211] Among other things, this disclosure provides the following example embodiments:

[0212] 1. An oligonucleotide, wherein:

[0213] The base sequence of the oligonucleotide comprises 10 or more consecutive bases of ATCAGTTTCTGTAGGCTTCC, wherein each T is optionally and independently replaced by U; and

[0214] The oligonucleotides contain modified nucleobases, modified sugars or modified internucleotide linkages.

[0215] 2. The oligonucleotide of embodiment 1, wherein the base sequence of the oligonucleotide is ATCAGTTTCTGTAGGCTTCC.

[0216] 3. An oligonucleotide, wherein:

[0217] The base sequence of the oligonucleotide comprises 10 or more consecutive bases of GGCATACTGGTTCAGTTGAT, wherein each T is optionally and independently replaced by U; and

[0218] The oligonucleotides contain modified nucleobases, modified sugars or modified internucleotide linkages.

[0219] 4. The oligonucleotide of embodiment 3, wherein the base sequence of the oligonucleotide is GGCATACTGGTTCAGTTGAT.

[0220] 5. An oligonucleotide, wherein:

[0221] The base sequence of the oligonucleotide comprises 10 or more consecutive bases of GCTCAGGTCAGGCAGTGGTT, wherein each T is optionally and independently replaced by U; and

[0222] The oligonucleotides contain modified nucleobases, modified sugars or modified internucleotide linkages.

[0223] 6. The oligonucleotide of embodiment 5, wherein the base sequence of the oligonucleotide is GCTCAGGTCAGGCAGTGGTT.

[0224] 7. An oligonucleotide, wherein:

[0225] The base sequence of the oligonucleotide comprises 10 or more consecutive bases of GAGAGCCTTTTTGCAGAGCT, wherein each T is optionally and independently replaced by U; and

[0226] The oligonucleotides contain modified nucleobases, modified sugars or modified internucleotide linkages.

[0227] 8. The oligonucleotide of embodiment 7, wherein the base sequence of the oligonucleotide is GAGAGCCTTTTTGCAGAGCT.

[0228] 9. An oligonucleotide, wherein:

[0229] The base sequence of the oligonucleotide comprises 10 or more consecutive bases of TCCAGCTCTGTGCCTCTAGT, wherein each T is optionally and independently replaced by U; and

[0230] The oligonucleotides contain modified nucleobases, modified sugars or modified internucleotide linkages.

[0231] 10. The oligonucleotide of embodiment 9, wherein the base sequence of the oligonucleotide is TCCAGCTCTGTGCCTCTAGT.

[0232] 11. An oligonucleotide, wherein:

[0233] The base sequence of the oligonucleotide comprises 10 or more consecutive bases of GTTCCAGCTTGGGCAGTTGT, wherein each T is optionally and independently replaced by U; and

[0234] The oligonucleotides contain modified nucleobases, modified sugars or modified internucleotide linkages.

[0235] 12. The oligonucleotide of embodiment 11, wherein the base sequence of the oligonucleotide is GTTCCAGCTTGGGCAGTTGT.

[0236] 13. An oligonucleotide, wherein:

[0237] The base sequence of the oligonucleotide comprises 10 or more consecutive bases of GGAAGCTTAGTCCTTGGCTG, wherein each T is optionally and independently replaced by U; and

[0238] The oligonucleotides contain modified nucleobases, modified sugars or modified internucleotide linkages.

[0239] 14. The oligonucleotide of embodiment 13, wherein the base sequence of the oligonucleotide is GGAAGCTTAGTCCTTGGCTG.

[0240] 15. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises a 5'-wing-gap-wing-3' structure.

[0241] 16. The oligonucleotide of any preceding embodiment, wherein there are about 3-10 nucleosides in the 5'-wing.

[0242] 17. The oligonucleotide of any preceding embodiment, wherein there are 5 nucleosides in the 5'-wing.

[0243] 18. The oligonucleotide of any preceding embodiment, wherein each sugar in the 5'-wing is independently a modified sugar.

[0244] 19. The oligonucleotide of any one of the preceding embodiments, wherein the sugar in the 5'-wing is 2'-OR s Modified sugars, where R s It is C 1-6 Fatty.

[0245] 20. The oligonucleotide of any preceding embodiment, wherein the sugar in the 5'-wing is a 2'-MOE modified sugar.

[0246] 21. The oligonucleotide of any preceding embodiment, wherein the sugar in the 5'-wing is a 2'-OMe modified sugar.

[0247] 22. The oligonucleotide of any preceding embodiment, wherein the sugar in the 5'-wing is a bicyclic sugar.

[0248] 23. The oligonucleotide of embodiment 22, wherein the bicyclic sugar is an LNA sugar.

[0249] 24. The oligonucleotide of embodiment 22, wherein the bicyclic sugar is a cEt sugar.

[0250] 25. The oligonucleotide of any one of embodiments 1-19, wherein each sugar in the 5'-wing is independently 2'-OR s Modified sugars, where R s It is C 1-6 Fatty.

[0251] 26. The oligonucleotide of any one of embodiments 1-19, wherein each sugar in the 5'-wing is independently a 2'-MOE modified sugar.

[0252] 27. The oligonucleotide of any preceding embodiment, wherein there are about 8-15 nucleosides in the gap.

[0253] 28. The oligonucleotide of any one of the preceding embodiments, wherein there are 10 nucleosides in the gap.

[0254] 29. The oligonucleotide of any preceding embodiment, wherein each sugar in the gap is independently a natural DNA sugar.

[0255] 30. The oligonucleotide of any one of the preceding embodiments, wherein the gap does not contain cytosine.

[0256] 31. The oligonucleotide of any one of the preceding embodiments, wherein the gap comprises one or more 5-methylcytosines.

[0257] 32. The oligonucleotide of any preceding embodiment, wherein there are about 3-10 nucleosides in the 3'-wing.

[0258] 33. The oligonucleotide of any preceding embodiment, wherein there are 5 nucleosides in the 3'-wing.

[0259] 34. The oligonucleotide of any preceding embodiment, wherein each sugar in the 3'-wing is independently a modified sugar.

[0260] 35. The oligonucleotide of any one of the preceding embodiments, wherein the sugar in the 3'-wing is 2'-OR s Modified sugars, where R s It is C 1-6 Fatty.

[0261] 36. The oligonucleotide of any preceding embodiment, wherein the sugar in the 3'-wing is a 2'-MOE modified sugar.

[0262] 37. The oligonucleotide of any preceding embodiment, wherein the sugar in the 3'-wing is a 2'-OMe modified sugar.

[0263] 38. The oligonucleotide of any preceding embodiment, wherein the sugar in the 3'-wing is a bicyclic sugar.

[0264] 39. The oligonucleotide of embodiment 38, wherein the bicyclic sugar is an LNA sugar.

[0265] 40. The oligonucleotide of embodiment 38, wherein the bicyclic sugar is a cEt sugar.

[0266] 41. The oligonucleotide of any one of embodiments 1-35, wherein each sugar in the 3'-wing is independently 2'-OR s Modified sugars, where R s It is C 1-6 Fatty.

[0267] 42. The oligonucleotide of any one of embodiments 1-35, wherein each sugar in the 3'-wing is independently a 2'-MOE modified sugar.

[0268] 43. The oligonucleotide of any preceding embodiment, wherein the oligonucleotide comprises a modified internucleotide linkage.

[0269] 44. The oligonucleotide of embodiment 43, wherein the modified internucleotide linkage is a phosphorothioate internucleotide linkage.

[0270] 45. The oligonucleotide of any preceding embodiment, wherein each internucleotide linkage is independently a modified internucleotide linkage.

[0271] 46. ​​The oligonucleotide of any preceding embodiment, wherein each internucleotide linkage is independently a phosphorothioate internucleotide linkage.

[0272] 47. An oligonucleotide having the structure:

[0273] / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*T*T* / iMe-dC / *T *G*T*A*G*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / or its salt, where:

[0274] / 52MOErA / is

[0275] * is -OP(O)(SH)-O-;

[0276] / i2MOErT / is

[0277] / i2MOErC / is

[0278] / i2MOErA / is

[0279] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0280] / iMe-dC / is and

[0281] / 32MOErC / is

[0282] 48. An oligonucleotide having the structure:

[0283] / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *A* / iMe-dC / *T*G*G*T*T * / iMe-dC / *A*G* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / 32MOErT / or its salt, where:

[0284] / 52MOErG / is

[0285] * is -OP(O)(SH)-O-;

[0286] / i2MOErT / is

[0287] / i2MOErC / is

[0288] / i2MOErA / is

[0289] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0290] / iMe-dC / is and

[0291] / 32MOErT / is

[0292] 49. An oligonucleotide having the structure:

[0293] / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErA / *G*G*T* / iMe-dC / *A*G*G * / iMe-dC / *A*G* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErT / or its salt, where:

[0294] / 52MOErG / is

[0295] * is -OP(O)(SH)-O-;

[0296] / i2MOErT / is

[0297] / i2MOErC / is

[0298] / i2MOErA / is

[0299] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0300] / iMe-dC / is and

[0301] / 32MOErT / is

[0302] 50. An oligonucleotide having the structure:

[0303] / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / * / iMe-dC / *T*T*T *T*T*G* / iMe-dC / *A* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / or its salt, where: / 52MOErG / is

[0304] * is -OP(O)(SH)-O-;

[0305] / i2MOErT / is

[0306] / i2MOErC / is

[0307] / i2MOErA / is

[0308] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0309] / iMe-dC / is and

[0310] / 32MOErT / is

[0311] 51. An oligonucleotide having the structure:

[0312] / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / *T*G*T*G * / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / 32MOErT / or its salt, where:

[0313] / 52MOErT / is

[0314] * is -OP(O)(SH)-O-;

[0315] / i2MOErT / is

[0316] / i2MOErC / is

[0317] / i2MOErA / is

[0318] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0319] / iMe-dC / is and

[0320] / 32MOErT / is

[0321] 52. An oligonucleotide having the structure:

[0322] / 52MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A*G* / iMe-dC / *T*T*G*G *G* / iMe-dC / *A* / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErT / or its salt, where:

[0323] / 52MOErG / is

[0324] * is -OP(O)(SH)-O-;

[0325] / i2MOErT / is

[0326] / i2MOErC / is

[0327] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0328] / iMe-dC / is and

[0329] / 32MOErT / is

[0330] 53. An oligonucleotide having the structure:

[0331] / 52MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T*T*A*G*T* / iMe -dC / * / iMe-dC / *T*T* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErG / or its salt, where:

[0332] / 52MOErG / is

[0333] * is -OP(O)(SH)-O-;

[0334] / i2MOErT / is

[0335] / i2MOErC / is

[0336] / i2MOErA / is

[0337] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0338] / iMe-dC / is and

[0339] / 32MOErG / is

[0340] 54. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide is a pharmaceutically acceptable salt.

[0341] 55. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide is a sodium salt.

[0342] 56. A composition comprising the oligonucleotide of any one of the preceding embodiments and one or more diastereomers of the oligonucleotide relative to the phosphorus of the chiral linkage.

[0343] 57. A composition comprising:

[0344] oligonucleotide or a salt thereof, and

[0345] one or more diastereomers of said oligonucleotide relative to the phosphorus of the chiral linker, or one or more salts of said diastereomers,

[0346] The oligonucleotide is / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*T*T* / iMe-dC / *T*G*T*A*G*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / , wherein:

[0347] / 52MOErA / is

[0348] * is -OP(O)(SH)-O-;

[0349] / i2MOErT / is

[0350] / i2MOErC / is

[0351] / i2MOErA / is

[0352] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0353] / iMe-dC / is and

[0354] / 32MOErC / is

[0355] 58. A composition comprising:

[0356] oligonucleotide or a salt thereof, and

[0357] one or more diastereomers of said oligonucleotide relative to the phosphorus of the chiral linker, or one or more salts of said diastereomers,

[0358] The oligonucleotide is / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *A* / iMe-dC / *T*G*G*T*T* / iMe-dC / *A*G* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / 32MOErT / , wherein: / 52MOErG / is

[0359] * is -OP(O)(SH)-O-;

[0360] / i2MOErT / is

[0361] / i2MOErC / is

[0362] / i2MOErA / is

[0363] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0364] / iMe-dC / is and

[0365] / 32MOErT / is

[0366] 59. A composition comprising:

[0367] oligonucleotide or a salt thereof, and

[0368] one or more diastereomers of said oligonucleotide relative to the phosphorus of the chiral linker, or one or more salts of said diastereomers,

[0369] The oligonucleotide is / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErA / *G*G*T* / iMe-dC / *A*G*G* / iMe-dC / *A*G* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErT / , wherein:

[0370] / 52MOErG / is

[0371] * is -OP(O)(SH)-O-;

[0372] / i2MOErT / is

[0373] / i2MOErC / is

[0374] / i2MOErA / is

[0375] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively; / iMe-dC / is and

[0376] / 32MOErT / is

[0377] 60. A composition comprising:

[0378] oligonucleotide or a salt thereof, and

[0379] one or more diastereomers of said oligonucleotide relative to the phosphorus of the chiral linker, or one or more salts of said diastereomers,

[0380] wherein the oligonucleotide is / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / *T*G*T*G* / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / 32MOErT / , wherein:

[0381] / 52MOErT / is

[0382] * is -OP(O)(SH)-O-;

[0383] / i2MOErT / is

[0384] / i2MOErC / is

[0385] / i2MOErA / is

[0386] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0387] / iMe-dC / is and

[0388] / 32MOErT / is

[0389] 61. A composition comprising:

[0390] oligonucleotide or a salt thereof, and

[0391] one or more diastereomers of said oligonucleotide relative to the phosphorus of the chiral linker, or one or more salts of said diastereomers,

[0392] The oligonucleotide is / 52MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A*G* / iMe-dC / *T*T*G*G*G* / iMe-dC / *A* / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErT / , wherein:

[0393] / 52MOErG / is

[0394] * is -OP(O)(SH)-O-;

[0395] / i2MOErT / is

[0396] / i2MOErC / is

[0397] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0398] / iMe-dC / is and

[0399] / 32MOErT / is

[0400] 62. A composition comprising:

[0401] oligonucleotide or a salt thereof, and

[0402] one or more diastereomers of said oligonucleotide relative to the phosphorus of the chiral linker, or one or more salts of said diastereomers,

[0403] The oligonucleotide is / 52MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T*T*A*G*T* / iMe-dC / * / iMe-dC / *T*T* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErG / , wherein:

[0404] / 52MOErG / is

[0405] * is -OP(O)(SH)-O-;

[0406] / i2MOErT / is

[0407] / i2MOErC / is

[0408] / i2MOErA / is

[0409] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively;

[0410] / iMe-dC / is and

[0411] / 32MOErG / is

[0412] 63. A composition comprising:

[0413] oligonucleotide or a salt thereof, and

[0414] one or more diastereomers of said oligonucleotide relative to the phosphorus of the chiral linker, or one or more salts of said diastereomers,

[0415] wherein the oligonucleotide is / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / * / iMe-dC / *T*T*T*T*T*G* / iMe-dC / *A* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / , wherein: / 52MOErG / is

[0416] * is -OP(O)(SH)-O-;

[0417] / i2MOErT / is

[0418] / i2MOErC / is

[0419] / i2MOErA / is

[0420] / i2MOErG / is Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively; / iMe-dC / is and

[0421] / 32MOErT / is

[0422] 64. The composition of any of embodiments 56-63, wherein for each chiral linker phosphorus, the percentage of Rp configuration is independently about 20%-80%.

[0423] 65. The composition of any of embodiments 56-63, wherein for each chiral linker phosphorus, the percentage of the Rp configuration is independently about 30%-70%.

[0424] 66. The composition of any of embodiments 56-63, wherein for each chiral linker phosphorus, the percentage of Rp configuration is independently about 40%-60%.

[0425] 67. The composition of any of embodiments 56-63, wherein for each chiral linker phosphorus, the percentage of Rp configuration is independently about 45%-55%.

[0426] 68. The composition of any of embodiments 56-63, wherein for each chiral linker phosphorus, the percentage of Rp configuration is independently about 50%.

[0427] 69. The composition of any one of embodiments 56-68, wherein the composition comprises a salt of the oligonucleotide and one or more salts of one or more diastereomers.

[0428] 70. The composition of any one of embodiments 56-69, wherein the composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable carrier.

[0429] 71. The composition of any one of embodiments 56-70, wherein the composition comprises a pharmaceutically acceptable salt of the oligonucleotide, one or more pharmaceutically acceptable salts of one or more diastereomers, and a pharmaceutically acceptable carrier.

[0430] 72. A pharmaceutical composition comprising the oligonucleotide of any one of the preceding embodiments and a pharmaceutically acceptable carrier.

[0431] 73. The composition of embodiment 72, wherein the composition comprises one or more pharmaceutically acceptable salts of the oligonucleotide.

[0432] 74. The composition of any one of embodiments 56-73, wherein the composition is a liquid composition.

[0433] 75. The composition of any one of embodiments 70-74, wherein the pharmaceutically acceptable carrier is a buffer.

[0434] 76. The composition of any one of embodiments 70-74, wherein the composition is buffered saline.

[0435] 77. The composition of any one of embodiments 70-74, wherein the pharmaceutically acceptable carrier is artificial cerebrospinal fluid.

[0436] 78. A method of reducing the level of calpain-2 mRNA in a system comprising administering or delivering to the system an effective amount of the oligonucleotide or composition of any one of the preceding embodiments.

[0437] 79. A method of reducing the level of a calpain-2 polypeptide in a system comprising administering or delivering to the system an effective amount of the oligonucleotide or composition of any one of the preceding embodiments.

[0438] 80. A method of reducing the level of calpain-2 activity in a system comprising administering or delivering to the system an effective amount of the oligonucleotide or composition of any one of the preceding embodiments.

[0439] 81. The method of any one of embodiments 78-80, wherein the system expresses calpain-2 mRNA.

[0440] 82. The method of any of embodiments 78-81, wherein the system is or comprises a cell.

[0441] 83. The method of any of embodiments 78-81, wherein the system is or comprises a tissue.

[0442] 84. The method of any one of embodiments 78-81, wherein the system is or comprises an organ.

[0443] 85. The method of any of embodiments 78-81, wherein the system is or comprises the brain or a portion thereof.

[0444] 86. The method of any one of embodiments 78-81, wherein the system is or comprises an organism.

[0445] 87. The method of any of embodiments 78-81, wherein the system is a subject.

[0446] 88. The method of any one of embodiments 78-81, wherein the system is a human.

[0447] 89. The method of any of embodiments 78-88, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% compared to the absence of the oligonucleotide or composition.

[0448] 90. The method of any one of embodiments 78-88, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 50% compared to in the absence of the oligonucleotide or composition.

[0449] 91. The method of any one of embodiments 78-88, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 60% compared to the absence of the oligonucleotide or composition.

[0450] 92. The method of any one of embodiments 78-88, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 65% compared to in the absence of the oligonucleotide or composition.

[0451] 93. The method of any one of embodiments 78-88, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 70% compared to in the absence of the oligonucleotide or composition.

[0452] 94. The method of any one of embodiments 78-88, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 75% compared to in the absence of the oligonucleotide or composition.

[0453] 95. The method of any one of embodiments 78-88, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 80% compared to in the absence of the oligonucleotide or composition.

[0454] 96. The method of any one of embodiments 78-88, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 85% compared to in the absence of the oligonucleotide or composition.

[0455] 97. The method of any of embodiments 78-96, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% compared to the absence of the oligonucleotide or composition.

[0456] 98. The method of any one of embodiments 78-96, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 20% compared to the absence of the oligonucleotide or composition.

[0457] 99. The method of any one of embodiments 78-96, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 30% compared to the absence of the oligonucleotide or composition.

[0458] 100. The method of any one of embodiments 78-96, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 40% compared to the absence of the oligonucleotide or composition.

[0459] 101. The method of any one of embodiments 78-96, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 50% compared to the absence of the oligonucleotide or composition.

[0460] 102. The method of any one of embodiments 78-96, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 60% compared to the absence of the oligonucleotide or composition.

[0461] 103. The method of any of embodiments 78-102, wherein the level of calpain-2 activity in the system is reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% compared to the absence of the oligonucleotide or composition.

[0462] 104. The method of any one of embodiments 78-102, wherein the level of calpain-2 activity in the system is reduced by about or at least about 20% compared to the absence of the oligonucleotide or composition.

[0463] 105. The method of any one of embodiments 78-102, wherein the level of calpain-2 activity in the system is reduced by about or at least about 30% compared to the absence of the oligonucleotide or composition.

[0464] 106. The method of any one of embodiments 78-102, wherein the level of calpain-2 activity in the system is reduced by about or at least about 40% compared to the absence of the oligonucleotide or composition.

[0465] 107. The method of any one of embodiments 78-102, wherein the level of calpain-2 activity in the system is reduced by about or at least about 50% compared to the absence of the oligonucleotide or composition.

[0466] 108. The method of any one of embodiments 78-102, wherein the level of calpain-2 activity in the system is reduced by about or at least about 60% compared to the absence of the oligonucleotide or composition.

[0467] 109. The method of any of embodiments 78-108, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% compared to administration or delivery of a reference oligonucleotide or composition.

[0468] 110. The method of any one of embodiments 78-108, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 50% compared to administration or delivery of a reference oligonucleotide or composition.

[0469] 111. The method of any one of embodiments 78-108, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 60% compared to administration or delivery of a reference oligonucleotide or composition.

[0470] 112. The method of any one of embodiments 78-108, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 65% compared to administration or delivery of a reference oligonucleotide or composition.

[0471] 113. The method of any one of embodiments 78-108, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 70% compared to administration or delivery of a reference oligonucleotide or composition.

[0472] 114. The method of any one of embodiments 78-108, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 75% compared to administration or delivery of a reference oligonucleotide or composition.

[0473] 115. The method of any one of embodiments 78-108, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 80% compared to administration or delivery of a reference oligonucleotide or composition.

[0474] 116. The method of any one of embodiments 78-108, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 85% compared to administration or delivery of a reference oligonucleotide or composition.

[0475] 117. The method of any of embodiments 78-116, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% compared to administration or delivery of a reference oligonucleotide composition.

[0476] 118. The method of any one of embodiments 78-116, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 20% compared to administration or delivery of a reference oligonucleotide composition.

[0477] 119. The method of any one of embodiments 78-116, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 30% compared to administration or delivery of a reference oligonucleotide composition.

[0478] 120. The method of any one of embodiments 78-116, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 40% compared to administration or delivery of a reference oligonucleotide composition.

[0479] 121. The method of any of embodiments 78-116, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 50% compared to administration or delivery of a reference oligonucleotide composition.

[0480] 122. The method of any one of embodiments 78-116, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 60% compared to administration or delivery of a reference oligonucleotide composition.

[0481] 123. The method of any of embodiments 78-122, wherein the level of calpain-2 activity in the system is reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% compared to administration or delivery of a reference oligonucleotide composition.

[0482] 124. The method of any one of embodiments 78-122, wherein the level of calpain-2 active peptide in the system is reduced by about or at least about 20% compared to administration or delivery of a reference oligonucleotide composition.

[0483] 125. The method of any one of embodiments 78-122, wherein the level of calpain-2 active peptide in the system is reduced by about or at least about 30% compared to administration or delivery of a reference oligonucleotide composition.

[0484] 126. The method of any one of embodiments 78-122, wherein the level of calpain-2 active peptide in the system is reduced by about or at least about 40% compared to administration or delivery of a reference oligonucleotide composition.

[0485] 127. The method of any one of embodiments 78-122, wherein the level of calpain-2 active peptide in the system is reduced by about or at least about 50% compared to administration or delivery of a reference oligonucleotide composition.

[0486] 128. The method of any one of embodiments 78-122, wherein the level of calpain-2 active peptide in the system is reduced by about or at least about 60% compared to administration or delivery of a reference oligonucleotide composition.

[0487] 129. The method of any one of embodiments 109-128, wherein the reference oligonucleotide does not target calpain-2 or the reference composition does not comprise an oligonucleotide targeting calpain-2.

[0488] 130. The method of any one of embodiments 109-128, wherein the reference oligonucleotide targets TUG1 or the reference composition comprises an oligonucleotide targeting TUG1.

[0489] 131. The method of any of embodiments 89-130, wherein reduction is assessed at about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks, of or after administration or delivery of the oligonucleotide or composition.

[0490] 132. The method of any one of embodiments 89-131, wherein the reduction is assessed at about D3 after administration or delivery of the oligonucleotide or composition.

[0491] 133. The method of any one of embodiments 89-132, wherein the reduction is assessed at about D7 after administration or delivery of the oligonucleotide or composition.

[0492] 134. The method of any one of embodiments 89-133, wherein the reduction is assessed at about D10 after administration or delivery of the oligonucleotide or composition.

[0493] 135. The method of any one of embodiments 89-134, wherein the reduction is assessed at about D14 after administration or delivery of the oligonucleotide or composition.

[0494] 136. The method of any one of embodiments 89-135, wherein the reduction is assessed at about D21 after administration or delivery of the oligonucleotide or composition.

[0495] 137. The method of any of embodiments 89-136, wherein the reduction is assessed at about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks, of or after removing or washing the oligonucleotide or composition.

[0496] 138. The method of any one of embodiments 89-137, wherein the reduction is assessed at approximately D3 after removing or washing the oligonucleotide or composition.

[0497] 139. The method of any one of embodiments 89-138, wherein the reduction is assessed at approximately D7 after removing or washing the oligonucleotide or composition.

[0498] 140. The method of any one of embodiments 89-139, wherein the reduction is assessed at about D10 after removing or washing the oligonucleotide or composition.

[0499] 141. The method of any of embodiments 89-140, wherein the reduction is assessed at approximately D14 after removing or washing the oligonucleotide or composition.

[0500] 142. The method of any one of embodiments 89-141, wherein the reduction is assessed at approximately D21 after removing or washing the oligonucleotide or composition.

[0501] 143. The method of any one of embodiments 89-142, wherein the reduction is assessed in iPSC-derived motor neurons at an oligonucleotide concentration of about 20 μM using naked delivery.

[0502] 144. A method for preventing or treating a condition, disorder or disease comprising administering or delivering an effective amount of the oligonucleotide or composition of any one of embodiments 1-77 to a subject susceptible to the condition, disorder or disease.

[0503] 145. The method of embodiment 144, wherein the onset of the condition, disorder or disease is delayed.

[0504] 146. The method of embodiment 144, wherein the occurrence of the condition, disorder or disease is prevented.

[0505] 147. A method for treating a condition, disorder or disease comprising administering or delivering an effective amount of the oligonucleotide or composition of any one of embodiments 1-77 to a subject suffering from the condition, disorder or disease.

[0506] 148. The method of embodiment 147, wherein the severity of the symptoms of the condition, disorder or disease is reduced.

[0507] 149. The method of any of embodiments 147-148, wherein one or more clinical assessment outcomes of the subject are independently improved.

[0508] 150. The method of any one of embodiments 144-149, wherein the condition, disorder or disease is associated with Wallerian degeneration.

[0509] 151. The method of any of embodiments 144-149, wherein the condition, disorder or disease is a neurodegenerative condition, disorder or disease.

[0510] 152. The method of any of embodiments 144-149, wherein the condition, disorder or disease is amyotrophic lateral sclerosis.

[0511] 153. The method of any one of embodiments 144-149, wherein the condition, disorder or disease is peripheral neuropathy.

[0512] 154. The method of any one of embodiments 144-149, wherein the condition, disorder or disease is chemotherapy-induced peripheral neuropathy.

[0513] 155. The method of any of embodiments 144-149, wherein the condition, disorder or disease is Parkinson's disease.

[0514] 156. The method of any one of embodiments 144-149, wherein the condition, disorder or disease is Huntington's disease.

[0515] 157. The method of any of embodiments 144-149, wherein the condition, disorder or disease is Alzheimer's disease.

[0516] 158. The method of any of embodiments 144-149, wherein the condition, disorder or disease is frontotemporal dementia.

[0517] 159. The method of any of embodiments 144-149, wherein the condition, disorder or disease is traumatic brain injury.

[0518] 160. The method of any of embodiments 144-149, wherein the condition, disorder or disease is progressive supranuclear palsy.

[0519] 161. The method of any of embodiments 144-149, wherein the condition, disorder or disease is corticobasal degeneration.

[0520] 162. The method of any of embodiments 144-149, wherein the condition, disorder or disease is Wolfram's syndrome.

[0521] 163. The method of any of embodiments 144-149, wherein the condition, disorder or disease is Friedreich's ataxia.

[0522] 164. The method of any of embodiments 144-149, wherein the condition, disorder or disease is multiple system atrophy.

[0523] 165. The method of any of embodiments 144-149, wherein the condition, disorder or disease is spinocerebellar ataxia.

[0524] 166. The method of any of embodiments 144-149, wherein the condition, disorder or disease is spinal muscular atrophy.

[0525] 167. The method of any one of embodiments 144-149, wherein the condition, disorder or disease is Pick's disease.

[0526] 168. The method of any of embodiments 144-149, wherein the condition, disorder or disease is progressive motor atrophy.

[0527] 169. The method of any of embodiments 144-149, wherein the condition, disorder or disease is stroke.

[0528] 170. The method of any one of embodiments 144-149, wherein the condition, disorder or disease is concussion.

[0529] 171. The method of any of embodiments 144-149, wherein the condition, disorder or disease is cerebral hemorrhage.

[0530] 172. The method of any one of embodiments 144-149, wherein the condition, disorder or disease is acute glaucoma.

[0531] 173. The method of any of embodiments 144-149, wherein the condition, disorder or disease is an epileptic seizure.

[0532] 174. The method of any of embodiments 144-149, wherein the condition, disorder or disease is spinal cord injury.

[0533] 175. The method of any one of embodiments 78-174, wherein NF-L secretion is reduced.

[0534] 176. A method for reducing secretion excretion, comprising administering or delivering to a subject an effective amount of the oligonucleotide or composition of any one of embodiments 1-77.

[0535] 177. The method of any of the preceding embodiments, wherein neuroinflammatory degeneration is reduced.

[0536] 178. A method for reducing neuroinflammatory degeneration comprising administering or delivering to a subject an effective amount of the oligonucleotide or composition of any one of embodiments 1-77.

[0537] 179. The method of any one of embodiments 175-178, wherein NF-L secretion and / or neuroinflammatory degeneration is toxicity-triggered.

[0538] 180. The method of any of embodiments 144-179, wherein the oligonucleotide or composition is administered or delivered intrathecally.

[0539] 181. The method of any of embodiments 144-179, wherein the oligonucleotide or composition is administered or delivered intravenously. Example

[0540] Presented herein are certain examples of the provided technology (compounds (oligonucleotides, reagents, etc.), compositions, methods (methods of making, using, evaluating, etc.). One skilled in the art will appreciate that, given the present disclosure, a variety of techniques can be utilized to prepare and / or evaluate the properties and / or activity of the provided technology.

[0541] Example 1 Various oligonucleotides and compositions can reduce calpain-2 expression.

[0542] The oligonucleotides and compositions described herein can provide in vitro knockdown of calpain-2 (CAPN2) transcripts. In the evaluation, glutamatergic neurons (bit.bio-ioGlutamatergic neurons, catalog number: io1001) derived from human induced pluripotent stem cells (iPSC) were seeded in a 96-well format at 20,000 cells / well. After the cells were cultured for 4 days, various oligonucleotide compositions were added to the cells at a concentration of 5 μM in 5% TE buffer. The cells were incubated with the oligonucleotides for 48 hours to allow naked uptake and knockdown of CAPN2 expression. After this incubation period, the cells were lysed and RNA was collected (Thermo Fisher catalog number #A25603). RNA was used for real-time RT-qPCR to quantify the fold change in CAPN2 expression. In some embodiments, such as Figure 1 As shown, various oligonucleotides provided in vitro knockdown of calpain-2 expression. Figure 1 As shown, various oligonucleotides provided substantial in vitro knockdown of CAPN2 expression compared to the reference condition. Negative controls were / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErT / *A*G*G*A* / iMe-dC / *T*A*T* / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / 32MOErA / . See also Figure 2 The data in (positive control is<T*G*C*A*A*> G*T*C*T*G*A*C*G*C*C*<C*A*T*C*T> , the negative control is<A*C*C*A*G*> T*G*C*A*T*T*C*A*T*T*<C*G*A*G*T> ; All nucleosides are DNA nucleosides except those modified by 2'-MOE in <>, and each * independently represent phosphorothioate internucleotide linkages).

[0543] Example 2 Various oligonucleotides and compositions did not show significant cytotoxicity.

[0544] Among other things, the present disclosure provides oligonucleotides and compositions with low or no cytotoxicity. In the evaluation, glutamatergic neurons derived from human iPSC (bit.bio-ioGlutamatergic neurons, catalog number: io1001) were seeded in a 96-well format at 20,000 cells / well. After the cells were cultured for 4 days, various oligonucleotides were added to the cells at a concentration of 5 μM in 5% TE buffer. The cells were incubated with the oligonucleotides for 48 hours. After this incubation period, the cells were stained with Hoechst (5 μg / mL). The number of live cells, dead cells, and total (live + dead) cells was counted, and the percentage of live cells was calculated. Figure 3 As shown, no significant changes in the percentage of viable cells were observed after treatment with various oligonucleotides compared to vehicle treatment (TE buffer).<T*G*C*A*A*> G*T*C*T*G*A*C*G*C*C*<C*A*T*C*T> (targeting NEAT1), the negative control is<A*C*C*A*G*> T*G*C*A*T*T*C*A*T*T*<C*G*A*G*T> ; All nucleosides are DNA nucleosides except those modified by 2'-MOE in <>, and each * (A represents independently phosphorothioate internucleotide linkages). Toxicity was induced in separate wells using staurosporine.

[0545] Example 3 Various oligonucleotides and compositions can provide dose-dependent reduction of calpain-2 expression.

[0546] Among other things, the present disclosure demonstrates that various provided oligonucleotides and compositions can provide a dose-dependent reduction in calpain-2 mRNA levels. The results from the evaluation are illustrated below as examples.

[0547] Cells: Human Bit.bio-io Glutamatergic neurons, seeded at 20,000 cells / well in a 96-well format, thawed, seeded, and cultured according to the supplier's instructions (coating: 0.01% PLO and 26 ng / cm2 laminin).

[0548] Oligonucleotide treatment: Oligonucleotide compositions 14, 15, 36, 39, 71, 77 and TUG1 (negative control). Concentration range: 20 μM, 15 μM, 10 μM, 5 μM, 2.5 μM, 1.25 μM, 0.63 μM, 0.31 μM. Positive control (targeting NEAT1): Oligonucleotide targeting NEAT1 (5 μM). Negative control: TUG1 (5 μM). Vehicle: 20% TE buffer without oligonucleotide (TE buffer content is the same under all conditions). Oligonucleotides were added to cells 4 days after seeding (by naked uptake, 48 hours incubation). Treatments were repeated on separate plates except for the negative control TUG1 oligonucleotide. Positive control:<T*G*C*A*A*> G*T*C*T*G*A*C*G*C*C*<C*A*T*C*T> (targeting NEAT1); negative control:<A*C*C*A*G*> T*G*C*A*T*T*C*AT*T*<C*G*A*G*T> ; All nucleosides are DNA nucleosides except those modified with 2'-MOE in <>, and each * independently represents a phosphorothioate internucleotide linkage.

[0549] Harvest: Cells-to-Ct 1-Step TaqMan Kit (Life technologies) according to the supplier's instructions (cell lysis and one-step reverse transcription + real-time PCR (RT-PCR) without separate RNA purification). 30 μL / well lysis buffer. 2 days after treatment.

[0550] RT-qPCR: 10% Cells-to-Ct lysate sample (or water as a no-template control; NTC). Single-plex reactions in a 384-well format, in technical replicates. TaqMan gene expression assays were performed using a LightCycler 480 instrument (NEAT1 TaqMan assay for control oligonucleotide samples only, CAPN2 and RPLP0 TaqMan assays for both control and test oligonucleotide samples).

[0551] Primer-probe set supplier Measurement ID Human NEAT1 FAM (target; control sample) IDT Human CAPN2 FAM (target) Thermo Fisher Hs00965097_m1 Human RPLP0VIC_PL (housekeeping gene) Thermo Fisher Hs00420895_gH

[0552] Data analysis: Cp values ​​were determined using the second derivative method (Lightcycler software). Fold changes in gene expression were determined by the ΔΔCp method (normalized to the negative control oligonucleotide: 5 μM TUG1). For NEAT1 expression: ΔCp = Cp NEAT1 –Cp RPLP0 ; ΔΔCp=ΔCp NEAT1 –ΔCp TUG1 ;Fold change of NEAT1 expression = 2 -ΔΔCpFor CAPN2 expression: ΔCp = Cp CAPN2 –Cp RPLP0 ; ΔΔCp=ΔCp CAPN2 –ΔCp TUG1 ; Fold change of CAPN2 expression = 2 -ΔΔCp .

[0553] Strong separation of positive and negative control oligonucleotides was observed. There was no obvious intra-plate or inter-plate variation between the positive and negative controls. Based on control sample performance (vehicle, positive and negative controls), no plate position effect was observed, and no obvious plate drift was observed between the plates tested. Compared with vehicle treatment (fold change and / or Cp value), no control treatment effects on calpain-2 and / or RPLP0 expression were observed. Consistency between biological replicates was observed.

[0554] As shown in the table below, for various provided oligonucleotide compositions, a concentration-dependent increase in calpain-2 gene knockdown was observed. No effect on the expression of RPLP0 was observed. The negative control targeting TUG1 did not show a concentration-dependent effect on calpain-2 expression. No significant cytotoxicity was observed at the highest oligonucleotide concentration evaluated (20 μM) and at lower concentrations.

[0555]

[0556] Example 4 Various oligonucleotides and compositions can provide dose-dependent reduction of calpain-2 mRNA levels.

[0557] Among other things, the present disclosure demonstrates that various provided oligonucleotides and compositions can provide a dose-dependent reduction in calpain-2 mRNA levels. The results from the evaluation are illustrated below as examples.

[0558] Cells: iCell motor neurons, seeded at 32,000 cells / well in a 96-well format. Thaw, seed, and culture according to the supplier's instructions (e.g., coating: 0.07% PEI + 10 μg / ml Cultrex 3D mouse laminin; culture medium: complete maintenance medium with 20 mM DAPT from day 0 to day 6, complete maintenance medium without DAPT from day 7 to day 10). Cell viability was checked on day 10 by staining with Hoechst (5 μg / ml) and imaging to count nuclei.

[0559] Oligonucleotide treatments: Oligonucleotide compositions 14, 39, 71, and TUG1 (negative control). Concentration range: 20 μM, 6.329 μM, 2.003 μM, 0.634 μM, 0.201 μM, 0.063 μM, 0.020 μM, 0.006 μM. Positive control (targeting NEAT1): Oligonucleotide targeting NEAT1 (20 μM). Vehicle: 2% (v / v) TE buffer without oligonucleotide. Oligonucleotides were added to cells 7 days after seeding and updated on day 9 (by naked uptake, 72 hours total incubation). Treatments were repeated three times on separate plates, except that both the positive control NEAT1 oligonucleotide and the vehicle had 6 replicates per plate. Positive control:<T*G*C*A*A*> G*T*C*T*G*A*C*G*C*C*<C*A*T*C*T> (targeting NEAT1); negative control:<A*C*C*A*G*> T*G*C*A*T*T*C*A*T*T*<C*G*A*G*T> ; All nucleosides are DNA nucleosides except those modified with 2'-MOE in <>, and each * independently represents a phosphorothioate internucleotide linkage.

[0560] Harvesting: Cells can be harvested using the Cells-to-Ct 1-Step TaqMan Kit (Life Technologies) according to the supplier's instructions (cell lysis without separate RNA purification and one-step reverse transcription + real-time PCR (real-time RT-PCR)). 25 μL / well lysis buffer. 3 days after treatment.

[0561] RT-qPCR: 15% Cells-to-Ct lysate sample (or water as a no-template control; NTC). Single-plex reactions in a 384-well format, in technical replicates. TaqMan gene expression assays were performed using a LightCycler 480 instrument (NEAT1 TaqMan assay for control oligonucleotide samples only, CAPN2 and RPLP0 TaqMan assays for both control and test oligonucleotide samples).

[0562] Primer-probe set supplier Measurement ID Human NEAT1 FAM (target; control sample) IDT Human CAPN2 FAM (target) Thermo Fisher Hs00965097_m1 Human RPLP0VIC_PL (housekeeping gene) Thermo Fisher Hs00420895_gH

[0563] Data analysis: Cp values ​​were determined using the second derivative method (Lightcycler software). % knockdown of gene expression was determined by the Pfaffl method to account for primer efficiency mismatches: RQ = (E 靶标 ) ΔCt(靶标) / (E 参考 ) ΔCt(参考)(normalized to negative control: TUG1), where ΔCt(target)=Ct(target gene in calibrator)-Ct(target gene in test) and ΔCt(reference)=Ct(reference gene in calibrator)-Ct(reference gene in test).

[0564] Treatment with a positive control oligonucleotide targeting NEAT1 resulted in specific knockdown of NEAT1, and treatment with a negative control oligonucleotide targeting TUG1 resulted in slightly lower NEAT1 Cp values ​​compared to vehicle. Treatment with a positive control oligonucleotide targeting NEAT1 or a negative control oligonucleotide targeting TUG1 did not significantly affect RPLP0 or CAPN2 Cp values ​​when compared to vehicle treatment. No significant inter-plate variation was observed. During the experiment, significant variation in cell viability was observed by brightfield imaging, which resulted in changes in sample input for RT-qPCR and the exclusion of some data points. Small variation was observed between most technical replicates. The NTC showed no amplification, indicating the absence of contamination. No substantial variation in total cell counts was observed between plates. No significant oligonucleotide-specific cytotoxicity was observed at any concentration.

[0565] like Figure 4 As shown in the table below, a concentration-dependent increase in CAPN2 knockdown was observed. Oligonucleotide 14 provided approximately 96% knockdown of CAPN2 at 20 μM at 72 hours. No significant effect on RPLP0 expression was observed. A negative control oligonucleotide targeting TUG1 showed no concentration-dependent effect on CAPN2 mRNA levels. EC50 values ​​were converted to pEC50 values ​​using nonlinear regression (variable Hill slope).

[0566] Oligonucleotides pEC50 <![CDATA[Goodness of fit (R 2 )]]> 14 7.44 0.9048 39 6.41 0.9361

[0567] Example 5 Various oligonucleotides and compositions can provide neuroprotection.

[0568] Among other things, the present disclosure demonstrates that various provided oligonucleotides and compositions can provide neuroprotection, such as reduced neurofilament-L (NF-L) secretion following exposure to a toxic trigger. Results from the evaluation are exemplified below.

[0569] Cells: iCell motor neurons, seeded at 32,000 cells / well in a 96-well format. Thaw, seed, and culture according to the supplier's instructions (e.g., coating: 0.07% PEI + 10 μg / ml Cultrex 3D mouse laminin; culture medium: complete maintenance medium with 20 mM DAPT from day 0 to day 6, complete maintenance medium without DAPT from day 7 to day 10).

[0570] Oligonucleotide treatment: Oligonucleotide composition 14 and TUG1 (negative control). Concentration: 20 μM. Vehicle: 2% (v / v) TE buffer without oligonucleotide (TE buffer content is the same for all conditions). Oligonucleotides were added to cells 7 days after seeding and refreshed on day 9 (by naked uptake, 72 hours total incubation). Treatments were performed in replicates (in some embodiments, N=4 per oligonucleotide treatment per toxicity trigger). Negative control:<A*C*C*A*G*> T*G*C*A*T*T*C*A*T*T*<C*G*A*G*T> (Targeting TUG1); all nucleosides are DNA nucleosides except those with 2'-MOE modifications in <>, each * independently represents a phosphorothioate internucleotide linkage.

[0571] Toxicity triggers: Various toxicity triggers were added on day 9. The toxicity triggers used included vincristine (1.5 nM, 3 nM, 6 nM), rotenone (5 μM, 10 μM, 15 μM), and colchicine (10 nM, 100 nM, 1000 nM).

[0572] Neurofilament-L assay: Supernatants from cells were harvested 24 hours after addition of the toxic trigger on day 10. The concentration of neurofilament-L (NF-L) was determined using the R-PLEX Human Neurofilament-L Assay Kit (Meso Scale Discovery) according to the supplier's instructions.

[0573] like Figure 5 As shown, pretreatment with oligonucleotide composition 14 reduced toxic trigger-induced NF-L secretion compared to vehicle. Compared to vehicle, exposure to vincristine (1.5 nM, 3 nM, or 6 nM; Figure 5 , (A)), rotenone (5 μM, 10 μM, or 15 μM; Figure 5 , (B) ) or colchicine (100 nM; Figure 5 , (C)), a significant reduction in NF-L secretion was observed after administration of the oligonucleotide composition 14. Compared to the vehicle, the negative control (targeting TUG1) oligonucleotide composition also reduced NF-L secretion induced by the toxic trigger. Without being limited by any theory, the observed reduction using the oligonucleotide composition targeting TUG1 may be due to calpain-independent effects. In addition, in various cases, a greater reduction in NF-L secretion was observed using the oligonucleotide composition 14 compared to the oligonucleotide composition targeting TUG1. In some embodiments, NF-L analysis by MSD shows an observable assay window relative to the oligonucleotide composition 14 for TUG1.

[0574] When evaluated in a neuritic degeneration assay, it appears that oligonucleotide composition 14 partially prevents trigger-induced neuritic degeneration, for example, as measured by tubulin immunoreactive areas following exposure to a toxic trigger. In some embodiments, some effects were also observed for oligonucleotide compositions targeting TUG1.

[0575] The technology provided in Example 6 can reduce the reduction of calpain-2 mRNA and protein levels.

[0576] Among other things, the present disclosure demonstrates that various provided oligonucleotides and compositions can, in some cases, provide reductions in calpain-2 mRNA and protein levels for days, weeks, or longer. The following is an illustration using the results from certain evaluations. Those skilled in the art will appreciate that, in accordance with the present disclosure, other techniques can also be utilized to evaluate the provided techniques to confirm the technical effects, benefits, advantages, etc. of the provided techniques.

[0577] Cells: iCell motor neurons, seeded at 32,000 cells / well in a 96-well format. Thawing, seeding, and culturing can be performed according to the supplier's instructions.

[0578] Oligonucleotide treatment: oligonucleotide composition 14, 39, 71, and TUG1 (negative control). Concentration: 20 μM for oligonucleotide composition 14, 18.9 μM for oligonucleotide composition 39, and 20 μM for negative control oligonucleotide targeting TUG1. Vehicle: 2% (v / v) TE buffer without oligonucleotide. On the 7th day after inoculating the cells, the oligonucleotides were added to the cells (by naked uptake) and removed by culture medium renewal on the 9th day (48 hours total incubation). Cells were collected and lysed on the 7th day after inoculating the cells (baseline) and 3, 7, 10, 14 and 21 days after removing the oligonucleotide composition. For mRNA collection, 3 replicates were processed for each condition, and a separate plate was used for each collection time point. For protein collection, 3 replicates were processed for each condition, and a separate plate was used for each collection time point.

[0579] Negative control:<A*C*C*A*G*> T*G*C*A*T*T*C*A*T*T*<C*G*A*G*T> ; All nucleosides are DNA nucleosides except those modified with 2'-MOE in <>, and each * independently represents a phosphorothioate internucleotide linkage.

[0580] mRNA harvesting: Cells were harvested using the Cells-to-Ct 1-Step TaqMan kit (Thermo Fisher) according to the supplier's instructions (25 μL / well lysis buffer) on day 7 after seeding (baseline) and on days 3, 7, 10, 14, and 21 after oligonucleotide removal.

[0581] RT-PCR: 15% of the Cells-to-Ct lysate sample was assayed with the primer-probe sets listed in the table below as single-plex reactions in a 384-well format in technical replicates. TaqMan gene expression assays were performed using a LightCycler 480 instrument (Roche). (CAPN2 and RPLP0 TaqMan assays were used for control and test oligonucleotide samples.)

[0582] Primer-probe set supplier Measurement ID Human CAPN2 FAM (target) Thermo Fisher Hs00965097_m1 Human RPLP0 VIC_PL (housekeeping gene) Thermo Fisher Hs00420895_gH

[0583] mRNA data analysis: Cp values ​​were determined using the second derivative method (Lightcycler software). The % knockdown of gene expression was determined by the Pfaffl method to account for primer efficiency mismatches: RQ = (E 靶标 ) ΔCt(靶标) / (E 参考 ) ΔCt(参考) (normalized to negative control: TUG1), where ΔCt(target)=Ct(target gene in calibrator)-Ct(target gene in test) and ΔCt(reference)=Ct(reference gene in calibrator)-Ct(reference gene in test).

[0584] Treatment of cells with vehicle (TE buffer) or negative control oligonucleotides targeting TUG1 resulted in only minor changes in Cp values ​​for housekeeping (RPLP0) and target (CAPN2) genes. The small variations in Cp values ​​observed in replicate samples of CAPN2 and RPLP0 after treatment with vehicle (TE buffer) or negative control oligonucleotides targeting TUG1 may be due to well-to-well differences in cell viability. Cell viability was assessed by Hoechst staining (allowing nuclei to be counted) and brightfield imaging. No major cytotoxicity was observed. Some variation in cell viability was observed between individual wells, but there was no significant difference in the mean nuclei counts after treatment with oligonucleotides targeting CAPN2 compared to treatment with vehicle (TE buffer) or negative control oligonucleotides targeting TUG1. In addition, as Figure 8As shown, no significant effect on cell morphology was observed after treatment with vehicle (TE buffer), a negative control oligonucleotide targeting TUG1, or an oligonucleotide targeting CAPN2. Furthermore, there was no significant difference in cell morphology between treatment conditions for at least 21 days after oligonucleotide removal. For the oligonucleotide targeting CAPN2, formation of cell clusters was observed on day 21, and also under control conditions. Neuronal network formation was observed under all treatment conditions.

[0585] like Figure 6 As shown in the table below, calpain-2 (CAPN2) mRNA knockdown was confirmed. Oligonucleotide 14 can provide about 94% knockdown of calpain-2 mRNA at 20 μM on the 0th day after removing the oligonucleotide, and about 77% knockdown of calpain-2 mRNA at 20 μM on the 21st day after removing the oligonucleotide. Oligonucleotide 39 can provide about 87% knockdown of calpain-2 mRNA at 18.9 μM on the 0th day after removing the oligonucleotide, and about 82% knockdown of calpain-2 mRNA at 18.9 μM on the 21st day after removing the oligonucleotide. From the 0th day after removing the oligonucleotide to at least the 21st day after removing the oligonucleotide, oligonucleotide 14 and oligonucleotide 39 both showed a continuous knockdown of calpain-2 mRNA. The negative control oligonucleotide targeting TUG1 did not show a knockdown of calpain-2 mRNA levels. Among other things, the data of this example demonstrate that the provided technology can provide sustained knockdown of calpain-2 mRNA, for example, after removal or washing of the oligonucleotide or composition.

[0586] Protein harvest: Cell lysates were prepared using RIPA lysis buffer (30 μL / well) (including Halt protease inhibitor cocktail) (Thermo Fisher). Three wells were combined per replicate to ensure sufficient protein for detection. Three replicates were harvested per time point under each condition. Protein yield was assessed by BCA assay.

[0587] Protein detection: Calpain-2 protein was detected by Western blotting using a Jess instrument (ProteinSimple) according to the supplier's instructions. Two replicates were examined for each condition and time point. Calpain-2 antibody (EPR5977 / ab126600; Abcam) was used at a 1:6 dilution.

[0588] Protein data analysis: Chemiluminescence-based target immunoreactivity detection. Signal analysis was performed using Compass software for area under the curve (AUC), molecules detected (MW), and signal-to-noise ratio. Quantification of target protein knockdown % was normalized to total protein. Calpain-2 protein levels were not affected by vehicle (TE buffer) or negative control treatment compared to untreated cells 48 hours after treatment. Some variation in calpain-2 protein levels between replicates was observed under certain conditions at certain time points (e.g., in some cases, possibly due to well-to-well differences in cell viability). For the negative control for oligonucleotide 39, slight depletion of calpain-2 protein signal was observed in samples at 10, 14, and 21 days due to high protein loading and insufficient substrate, which may have led to underestimation of protein knockdown. Cell viability was assessed by Hoechst staining (allowing for counting of nuclei) and brightfield imaging. No major cytotoxicity was observed. Some variation in cell viability was observed between individual wells, but the mean nuclei counts following treatment with oligonucleotides targeting CAPN2 were not significantly different compared to treatment with vehicle (TE buffer) or a negative control oligonucleotide targeting TUG1. Figure 8 As shown, no significant effect on cell morphology was observed after treatment with vehicle (TE buffer), a negative control oligonucleotide targeting TUG1, or an oligonucleotide targeting CAPN2. Furthermore, there was no significant difference in cell morphology between treatment conditions for at least 21 days after oligonucleotide removal. For the oligonucleotide targeting CAPN2, formation of cell clusters was observed on day 21, and also under control conditions. Neuronal network formation was observed under all treatment conditions.

[0589] like Figure 7 As shown in the table below, calpain-2 protein knockdown was confirmed. Oligonucleotide 14 can provide about 51% knockdown of calpain-2 protein at 20 μM on day 14 after oligonucleotide removal, as shown in Figure 7 As shown in A. Oligonucleotide 39 can provide about 60% knockdown of calpain-2 protein at 18.9 μM on day 14 after oligonucleotide removal, as shown in Figure 7 As shown in B. Oligonucleotide 14 and oligonucleotide 39 both showed sustained calpain-2 protein knockdown from day 7 after oligonucleotide removal, and maintained sustained calpain-2 protein knockdown at least 21 days after oligonucleotide removal. Negative control oligonucleotide targeting TUG1 did not show knockdown of calpain-2 protein levels. Among other things, the data of this example demonstrate that the provided technology can provide sustained knockdown of calpain-2 protein, for example, after removal or washing of the oligonucleotide or composition.

[0590]

[0591] According to the present disclosure, various other techniques can be used to assess the properties and / or activity of the technology provided. For example, the reduction in calpain-2 polypeptide levels can be assessed by Western blotting or immunostaining. In some embodiments, the oligonucleotides and compositions provided are assessed for the reduction in calpain-2 activation. In some embodiments, the oligonucleotides and compositions provided are assessed for the reduction in calpain-2 protease activity. In some embodiments, the oligonucleotides and compositions provided are assessed for the reduction in neuronal degeneration (e.g., by using one or more cell models). In some embodiments, the oligonucleotides and compositions provided are assessed for accelerated recovery from axotomy. Although various embodiments have been described and illustrated herein, a person of ordinary skill in the art will readily envision various other methods and / or structures for performing functions and / or obtaining results and / or one or more advantages described in the present disclosure, and each of such variations and / or modifications is considered to be included. More generally, it will be readily understood by those skilled in the art that all parameters, dimensions, materials, and configurations described herein are examples, and that actual parameters, dimensions, materials, and / or configurations may depend on the specific application or applications to which the present disclosure is applied. Those skilled in the art will recognize or be able to determine many equivalents of the embodiments of the present disclosure using only routine experiments. Therefore, it should be understood that the above-described embodiments are presented by way of example only, and that, within the scope of the appended claims and their equivalents, the claimed technology may be practiced otherwise than as specifically described and claimed. In addition, any combination of two or more features, systems, articles, materials, kits, and / or methods is included within the scope of the present disclosure if such features, systems, articles, materials, kits, and / or methods are not inconsistent with each other.

Claims

1. An oligonucleotide, wherein: The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of ATCAGTTTCTGTAGGCTTCC, GGCATACTGGTTCAGTTGAT, GCTCAGGTCAGGCAGTGGTT, GAGAGCCTTTTTGCAGAGCT, TCCAGCTCTGTGCCTCTAGT, GTTCCAGCTTGGGCAGTTGT, or GGAAGCTTAGTCCTTGGCTG, wherein each T is optionally and independently replaced by U; and The oligonucleotides contain modified nucleobases, modified sugars or modified internucleotide linkages.

2. The oligonucleotide of claim 1, wherein the base sequence of the oligonucleotide is ATCAGTTTCTGTAGGCTTCC, GGCATACTGGTTCAGTTGAT, GCTCAGGTCAGGCAGTGGTT, GAGAGCCTTTTTGCAGAGCT, TCCAGCTCTGTGCCTCTAGT, GTTCCAGCTTGGGCAGTTGT or GGAAGCTTAGTCCTTGGCTG.

3. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises a 5'-wing-gap-wing-3' structure.

4. The oligonucleotide of any of the preceding claims, wherein there are about 3-10 nucleosides in the 5'-wing, optionally there are 5 nucleosides in the 5'-wing.

5. The oligonucleotide of any one of the preceding claims, wherein each sugar in the 5'-wing is independently a modified sugar.

6. The oligonucleotide of any of the preceding claims, wherein the sugar in the 5'-wing is 2'-OR s Modified sugars, where R s It is C 1-6 Fat; wherein the sugar in the 5'-wing is a 2'-MOE modified sugar; wherein the sugar in the 5'-wing is a 2'-OMe modified sugar; and / or wherein the sugar in the 5'-wing is a bicyclic sugar, optionally wherein the bicyclic sugar is an LNA sugar or a cEt sugar.

7. The oligonucleotide of any one of claims 1 to 6, wherein each sugar in the 5'-wing is independently a 2'-OR s Modified sugars, where R s It is C 1-6 Aliphatic or wherein each sugar in the 5'-wing is independently a 2'-MOE modified sugar.

8. The oligonucleotide of any of the preceding claims, wherein there are about 8-15 nucleosides in the gap, optionally wherein there are 10 nucleosides in the gap.

9. The oligonucleotide of any one of the preceding claims, wherein each sugar in the gap is independently a natural DNA sugar.

10. The oligonucleotide of any one of the preceding claims, wherein the gap contains no cytosine and / or wherein the gap comprises one or more 5-methylcytosines.

11. The oligonucleotide of any one of the preceding claims, wherein there are about 3-10 nucleosides in the 3'-wing, optionally there are 5 nucleosides in the 3'-wing.

12. The oligonucleotide of any one of the preceding claims, wherein each sugar in the 3'-wing is independently a modified sugar.

13. The oligonucleotide of any of the preceding claims, wherein the sugar in the 3'-wing is 2'-OR s Modified sugars, where R s It is C 1-6 Fat; wherein the sugar in the 3'-wing is a 2'-MOE modified sugar; wherein the sugar in the 3'-wing is a 2'-OMe modified sugar; and / or wherein the sugar in the 3'-wing is a bicyclic sugar, optionally wherein the bicyclic sugar is an LNA sugar or a cEt sugar.

14. The oligonucleotide of any one of claims 1 to 13, wherein each sugar in the 3'-wing is independently a 2'-OR s Modified sugars, where R s It is C 1-6 Aliphatic or wherein each sugar in the 3'-wing is independently a 2'-MOE modified sugar.

15. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises a modified internucleotide linkage, optionally wherein the modified internucleotide linkage is a phosphorothioate internucleotide linkage.

16. The oligonucleotide of any of the preceding claims, wherein each internucleotide linkage is independently a modified internucleotide linkage and / or wherein each internucleotide linkage is independently a phosphorothioate internucleotide linkage.

17. An oligonucleotide having the structure: / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*T*T* / iMe-dC / *T*G*T*A*G*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / 、 / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *A* / iMe-dC / *T*G*G*T*T* / iMe-dC / *A*G* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / 32MOErT / 、 / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErA / *G*G*T* / iMe-dC / *A*G*G* / iMe-dC / *A*G* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErT / 、 / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / iMe-dC / * / iMe-dC / * / iMe-dC / *T*T*T*T*G* / iMe-dC / *A* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / 、 / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / *T*G*T*G* / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / 32MOErT / 、 / 52MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A*G* / iMe-dC / *T*T*G*G*G* / iMe-dC / *A* / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErT / , or / 52MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T*T*A*G*T* / iMe-dC / * / iMe-dC / *T*T* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErG / , or its salt, among which / 52MOErT / Yes / 52MOErA / Yes / 52MOErG / Yes *is-OP(O)(SH)-O-; / i2MOErT / is / i2MOErC / is / i2MOErA / is / i2MOErG / is Each of A, T and G is independently deoxyadenosine, thymidine and deoxyguanosine; / iMe-dC / is / 32MOErT / Yes / 32MOErC / Yes and / 32MOErG / Yes 18. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is a pharmaceutically acceptable salt, optionally wherein the oligonucleotide is a sodium salt.

19. A composition comprising an oligonucleotide according to any one of the preceding claims and one or more diastereomers of said oligonucleotide relative to the phosphorus of a chiral linkage.

20. A composition comprising: oligonucleotide or a salt thereof, and one or more diastereomers of the oligonucleotide relative to the phosphorus of the chiral linker, or one or more salts of the diastereomers, wherein the oligonucleotide is / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*T*T* / iMe-dC / *T*G*T*A*G*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / 、 / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *A* / iMe-dC / *T*G*G*T*T* / iMe-dC / *A*G* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / 32MOErT / 、 / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErA / *G*G*T* / iMe-dC / *A*G*G* / iMe-dC / *A*G* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErT / 、 / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / *T*G*T*G*G* / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / 32MOErT / 、 / 52MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A*G* / iMe-dC / *T*T*G*G*G* / iMe-dC / *A* / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErT / 、 / 52MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MO ErG / * / iMe-dC / *T*T*A*G*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*T* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErG / , or / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / * / iMe-dC / *T*T*T*T*T*G* / iMe-dC / *A* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / , among which: / 52MOErT / Yes / 52MOErA / Yes / 52MOErG / Yes *is-OP(O)(SH)-O-; / i2MOErT / is / i2MOErC / is / i2MOErA / is / i2MOErG / is Each of A, T and G is independently deoxyadenosine, thymidine and deoxyguanosine; / iMe-dC / is / 32MOErT / Yes / 32MOErC / Yes and / 32MOErG / Yes 21. The composition of any of claims 19-20, wherein for each chiral linker phosphorus, the percentage of the Rp configuration is independently about 20%-80%, about 30%-70%, about 40%-60%, about 45%-55%, or about 50%.

22. The composition of any one of claims 19-21, wherein the composition comprises a salt of the oligonucleotide and one or more salts of one or more diastereomers.

23. The composition of any one of claims 19-22, wherein the composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable carrier.

24. The composition of any one of claims 19-23, wherein the composition comprises a pharmaceutically acceptable salt of the oligonucleotide, one or more pharmaceutically acceptable salts of one or more diastereomers, and a pharmaceutically acceptable carrier.

25. A pharmaceutical composition comprising the oligonucleotide of any one of the preceding claims and a pharmaceutically acceptable carrier.

26. The composition of claim 25, wherein the composition comprises one or more pharmaceutically acceptable salts of the oligonucleotide.

27. The composition of any one of claims 19-26, wherein the composition is a liquid composition.

28. The composition of any one of claims 23-27, wherein the pharmaceutically acceptable carrier is a buffer, buffered saline, or artificial cerebrospinal fluid.

29. A method of reducing the level of calpain-2 mRNA in a system comprising administering or delivering to the system an effective amount of the oligonucleotide or composition of any one of the preceding claims.

30. A method of reducing the level of a calpain-2 polypeptide in a system comprising administering or delivering to the system an effective amount of the oligonucleotide or composition of any one of the preceding claims.

31. A method of reducing the level of calpain-2 activity in a system comprising administering or delivering to the system an effective amount of the oligonucleotide or composition of any one of the preceding claims.

32. The method of any one of claims 29-31, wherein the system expresses calpain-2 mRNA.

33. The method of any one of claims 29-32, wherein the system is or comprises a cell, a tissue, an organ, a brain or a part thereof, an organism, a subject, or a human.

34. The method of any one of claims 29-33, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% compared to the absence of the oligonucleotide or composition.

35. The method of any one of claims 29-33, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% compared to the absence of the oligonucleotide or composition.

36. The method of any one of claims 29-33, wherein the level of calpain-2 activity in the system is reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% compared to the absence of the oligonucleotide or composition.

37. The method of any of claims 29-33, wherein the level of calpain-2 mRNA in the system is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% compared to administration or delivery of a reference oligonucleotide or composition.

38. The method of any one of claims 29-33, wherein the level of calpain-2 polypeptide in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% compared to administration or delivery of a reference oligonucleotide composition.

39. The method of any one of claims 29-33, wherein the level of calpain-2 activity in the system is reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% compared to administration or delivery of a reference oligonucleotide composition.

40. The method of any one of claims 37-39, wherein the reference oligonucleotide does not target calpain-2 or the reference composition does not comprise an oligonucleotide that targets calpain-2.

41. The method of any one of claims 37-39, wherein the reference oligonucleotide targets TUG1 or the reference composition comprises an oligonucleotide targeted to TUG1.

42. The method of any one of claims 34-41, wherein the reduction is assessed at about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks of or after administration or delivery of the oligonucleotide or composition.

43. The method of any of claims 34-42, wherein the reduction is assessed at about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks, of or after removing or washing the oligonucleotide or composition.

44. The method of any one of claims 34-43, wherein the reduction is assessed in iPSC-derived motor neurons at an oligonucleotide concentration of about 20 uM using naked delivery.

45. A method for preventing or treating a condition, disorder or disease comprising administering or delivering an effective amount of the oligonucleotide or composition of any one of claims 1-28 to a subject susceptible to the condition, disorder or disease.

46. ​​The method of claim 45, wherein the onset of the condition, disorder or disease is delayed or prevented.

47. A method for treating a condition, disorder or disease comprising administering or delivering an effective amount of the oligonucleotide or composition of any one of claims 1-28 to a subject suffering from the condition, disorder or disease.

48. The method of claim 47, wherein the severity of symptoms of the condition, disorder or disease is reduced.

49. The method of any one of claims 47-48, wherein one or more clinical assessment outcomes of the subject are independently improved.

50. The method of any one of claims 45-49, wherein the condition, disorder or disease is a neurodegenerative condition, disorder or disease, amyotrophic lateral sclerosis, peripheral neuropathy, chemotherapy-induced peripheral neuropathy, Parkinson's disease, Huntington's disease, Alzheimer's disease, frontotemporal dementia, traumatic brain injury, progressive supranuclear palsy, corticobasal degeneration, Wolfram syndrome, Friedreich's ataxia, multiple system atrophy, spinocerebellar ataxia, spinal muscular atrophy, Pick's disease, progressive motor atrophy, stroke, concussion, intracerebral hemorrhage, acute glaucoma, seizure, spinal cord injury, and / or a condition, disorder or disease associated with Wallerian degeneration.

51. The method of any one of claims 29-50, wherein NF-L secretion is decreased.

52. A method for reducing NF-L secretion comprising administering or delivering to a subject an effective amount of the oligonucleotide or composition of any one of claims 1-28.

53. The method of any of the preceding claims, wherein neuroinflammatory degeneration is reduced.

54. A method for reducing neuritic degeneration comprising administering or delivering to a subject an effective amount of the oligonucleotide or composition of any one of claims 1-28.

55. The method of any one of claims 51-54, wherein NF-L secretion and / or neuritic degeneration is toxic triggered.

56. The method of any one of claims 45-55, wherein the oligonucleotide or composition is administered or delivered intrathecally and / or intravenously.

57. The oligonucleotide, composition or method of any one of exemplified embodiments 1-181.

Images