A nucleic acid tetrahedron DNA-quercetin complex and its application in treating retinal neovascular diseases

Abstract

The present invention discloses a nucleic acid tetrahedron DNA-quercetin complex and its application in treating retinal neovascular diseases. In the nucleic acid tetrahedron DNA-quercetin complex of the present invention, the quercetin molecule is connected to one of the four single-stranded DNAs of the nucleic acid tetrahedron through an azide coupling reaction. The composite has stable physical and chemical properties, and the quantitatively carried quercetin molecules ensure the stability of the therapeutic efficacy of the composite, which can effectively prevent the formation of new blood vessels, promote vascular remodeling in the retinal non-perfusion area, and restore retinal vascular damage, providing a new strategy for the treatment and prevention of retinal neovascular diseases. At the same time, the tFNAs-QUE synthesized by the azide coupling method has a better therapeutic effect than the tFNAs-QUE obtained by the existing electrostatic adsorption method. While greatly reducing pathological new blood vessels, it significantly promotes the formation of physiological blood vessels in the avascular area.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and more specifically, to a nucleic acid tetrahedron DNA-quercetin complex and its application in treating retinal neovascular diseases. Background Art

[0002] Retinal neovascular disease is a complex pathophysiological process caused by the imbalance between angiogenesis-promoting factors and angiogenesis-inhibiting factors in the retina, which seriously affects visual function. It includes a variety of diseases, such as retinopathy of prematurity (ROP), proliferative diabetic retinopathy (PD), retinal vein occlusion (RVO), wet-Age related Macular Degeneration (wAMD), etc. Neovascularization is a complex process involving multiple factors and pathways, and is also the common pathogenesis of such diseases. Retinal vascular retardation, chronic high glucose, thrombosis, and changes in blood rheology can all cause micro / small blood vessel occlusion, leading to retinal hypoxia and inducing neovascularization.

[0003] Intravitreal injection of anti-vascular endothelial growth factor (VEGF) drugs is the first-line treatment for retinal neovascularization diseases today, and has achieved good results. However, this therapy only reduces pathological retinal neovascularization, does not protect damaged retinal blood vessels and structural neurons, and requires multiple injections and follow-up visits, which is a heavy burden on patients.

[0004] Neurons, glial cells and vascular cells in local areas of retinal tissue are functionally coupled and interdependent. The retinal neurovascular unit (RNVU) includes glial cells (Muller cells, astrocytes and microglia), vascular cells (endothelial cells and pericytes) and neurons (ganglion cells, bipolar cells). The RNVU is located in the inner layer of the retina, and its components are closely connected. While maintaining the integrity of the inner blood retinal barrier (IBRB), it dynamically regulates blood flow to meet the metabolic needs of neurons. Changes in the photoreceptor cells in the outer layer of the retina can also affect the homeostasis of the RNVU. Retinal neovascular diseases are often accompanied by retinal neuronal cell degeneration and impaired RNVU function.

[0005] In order to inhibit neovascularization, improve the recovery of physiological vascular structure, and protect the function of retinal neurovascular unit, a series of explorations have been carried out. Recent studies have shown that quercetin (3,5,7,30,40-pentahydroxyflavone, QUE) has a wide range of biological activities, including but not limited to antioxidant, anti-inflammatory, anti-diabetic, anti-obesity, anti-hypertension, cardiomyocyte protection, anti-Alzheimer's disease, and inhibition of neuronal apoptosis. Many studies have shown that quercetin can inhibit oxidative stress and excessive inflammatory response of immune cells, thereby inhibiting systemic inflammation and multi-organ dysfunction including kidney, heart, lung, etc. Its specific mechanism involves quercetin reducing LPS-induced ROS by inhibiting NOX2 and promoting Nrf2 production. Recent studies have shown that quercetin can protect RNVU by upregulating the AKT-Nrf2-HO-1 pathway, thereby achieving the purpose of treating retinal neovascular diseases. However, quercetin has the characteristics of low water solubility, low bioavailability, fast clearance, fast metabolism, and enzymatic degradation, which largely hinders its clinical application as a drug.

[0006] Tetrahedral framework nucleic acids (tFNAs) are a new type of bio-nanomaterial. tFNAs is a tetrahedral structure formed by four single-stranded DNAs through denaturation and renaturation and then through complementary base pairing between chains. It is easy to synthesize, has a stable structure, high biocompatibility, stable structure and excellent mechanical properties, and shows considerable potential in the biomedical field. tFNAs have been initially applied in the fields of stem cells, biosensors and tumor treatment. Recent studies have shown that tFNAs have shown good effects in the treatment of various systemic diseases such as ischemic stroke, type 2 diabetes, osteoarthritis, and skin wound healing. In addition, tFNAs are also excellent carriers of drugs, which can prolong the duration of drugs in the body and allow drugs to pass through the blood-brain barrier. Therefore, it is of great clinical significance to explore the construction of new treatments for retinal neovascular diseases based on tFNAs. Patent CN115040657A discloses a DNA tetrahedron-quercetin complex and its use in preventing sepsis. The complex is prepared by electrostatic adsorption. The inventors' previous article (Jin Y, Zhou X, Chen L, Xu X, Yan W, Wang Q, Lin Y, Ding X. Framework Nucleic Acids Loaded with Quercetin: Protecting Retinal Neurovascular Unitvia the Protein Kinase B / Heme Oxygenase-1 Pathway. ACS Nano. 2024 Sep 13. doi: 10.1021 / acsnano.4c05845. PMID: 39268926.) further disclosed a framework nucleic acid loaded with quercetin, which uses tetrahedral framework nucleic acid (tFNA) as a carrier, and quercetin (QUE) is also combined with DNA nucleic acid tetrahedron by electrostatic adsorption to form a deoxyribonucleic acid (DNA) nanocomplex, tFNAs-QUE. The data show that this nanocomplex can inhibit pathological neovascularization, reduce the area of ​​retinal non-perfusion area, protect retinal neurons, and preserve visual function. However, the existing tFNAs-QUE obtained by electrostatic adsorption has poor thermal stability and structural stability. At the same time, since the electrostatic adsorption method is a random combination, it will bring unpredictability to the therapeutic effect. Summary of the invention

[0007] The purpose of the present invention is to overcome the above defects and shortcomings in the prior art and provide a nucleic acid tetrahedron DNA-quercetin complex.

[0008] The second object of the present invention is to provide a method for preparing the nucleic acid tetrahedron DNA-quercetin complex.

[0009] The third object of the present invention is to provide the use of the nucleic acid tetrahedron DNA-quercetin complex in the preparation of a drug for treating retinal neovascular diseases.

[0010] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0011] A nucleic acid tetrahedral DNA-quercetin complex (tFNAs-QUE) comprises nucleic acid tetrahedral DNA and quercetin, wherein the 5' end of a single-stranded DNA in the nucleic acid tetrahedral DNA is connected to a connecting group on the benzene ring of quercetin through a triazole structure formed by a reaction between a DBCO group and an azide group.

[0012] The tFNAs-QUE complex of the present invention uses nucleic acid tetrahedron as a carrier, and the quercetin molecule is connected to one of the four single-stranded DNAs of the nucleic acid tetrahedron through an azide coupling reaction. By applying the azide coupling method to connect QUE to the single-stranded DNA, the finally formed tFNAs can stably load QUE molecules, have stable physical and chemical properties, and the quantitatively carried quercetin molecules ensure the stability of the therapeutic efficacy of the complex. At the same time, the tFNAs-QUE synthesized by the azide coupling method has a better therapeutic effect than the tFNAs-QUE obtained by the existing electrostatic adsorption method.

[0013] Furthermore, the nucleotide sequences of the four DNA single strands of the nucleic acid tetrahedron are shown as SEQ ID NOs. 1 to 4, respectively.

[0014] The present invention also provides a method for preparing the nucleic acid tetrahedron DNA-quercetin complex, comprising the following steps:

[0015] S1. Modify the hydroxyl group of the phenyl ring of quercetin with an azide group;

[0016] S2. Modifying the 5' end of one of the DNA strands of the nucleic acid tetrahedron DNA with a DBCO group;

[0017] S3. subjecting the quercetin modified with an azide group to a single-stranded DNA modified with a DBCO group to a DBCO-azide click chemistry reaction for coupling, thereby synthesizing a single-stranded DNA connected with quercetin;

[0018] S4. The DNA single strand connected with quercetin and the remaining three single strands of nucleic acid tetrahedral DNA are self-assembled in an equimolar ratio to obtain.

[0019] The method of the present invention comprises the following steps: firstly modifying an azide group on a quercetin molecule, then modifying a DBCO group on the 5' end of a single-stranded DNA, and then coupling quercetin with the single-stranded DNA through a DBCO-Azide click chemical reaction in the click chemistry technology, wherein one single-stranded DNA is connected to one quercetin molecule, and finally the single-stranded DNA connected to the quercetin molecule is self-assembled with other three single-stranded DNAs to form a nucleic acid tetrahedron, thereby obtaining tFNAs-QUE. The tFNAs-QUE obtained by the preparation method has good stability and can quantitatively carry quercetin molecules.

[0020] Furthermore, step S1 is to react quercetin with an active agent containing an azide group, thereby introducing an azide group into the hydroxyl position of the benzene ring in the quercetin structure.

[0021] Preferably, in order to introduce a methyl group into quercetin to form a protecting group to protect quercetin, sodium azide is added to introduce an azide group, and the protecting group is removed after separation and purification to obtain an azide-modified quercetin molecule.

[0022] As a preferred embodiment, the modification of the azide group on quercetin comprises the following steps:

[0023] (1) Introduction of quercetin protective group: dissolve quercetin in an organic solvent, add anhydrous potassium carbonate as a base, mix well, and then add dimethyl sulfate as a methylating agent to introduce a methyl group on quercetin to obtain quercetin modified with a protective group. Preferably, the organic solvent is dichloromethane; the molar ratio of quercetin, anhydrous potassium carbonate, and dimethyl sulfate is 1:2-4:1-3 (preferably 1:3:2); the reaction is carried out under ice bath conditions (0-4°C) for 1-3 hours (preferably 2 hours).

[0024] (2) Introduction of azide groups: The quercetin modified with a protective group is dissolved in an organic solvent, and sodium azide is added to react to introduce an azide group. After the reaction is completed, the reaction system is cooled to room temperature and the excess sodium azide is washed away. Preferably, the organic solvent is tetrahydrofuran; the molar ratio of the quercetin modified with a protective group to sodium azide is 1:2 to 4 (preferably 1:3); the reaction is stirred at 58 to 62°C for 3 to 5 hours.

[0025] (3) Isolation and purification of products: The reaction system was separated by using deionized water and dichloromethane, and the organic phase was taken, dried, filtered, and then the solvent was removed by rotary evaporation to obtain a crude product. The crude product was purified by column chromatography, and the eluent was a dichloromethane / methanol mixture (volume ratio 95:5).

[0026] (4) Deprotection: Dissolve the purified product in an appropriate amount of methanol, add sodium hydroxide solution, and stir at room temperature to remove the protecting group. After the reaction is completed, adjust the pH to neutral, concentrate, and purify by column chromatography again to obtain the final product of azide-modified quercetin.

[0027] Furthermore, step S2 is to first synthesize a DNA single strand modified with a 5' terminal amino group (NH2-C6), and then activate it with DBCO to form a diphenylcyclooctyne-carbon 6-amino-DNA single strand (DBCO-C6-NH2-DNA single strand, DBCO-C6-amine-oligosequence).

[0028] Furthermore, the DBCO is DBCO-PEG4-NHS ester, and the spacer arm structure of (PEG)n can enhance the hydrophilicity of the compound.

[0029] Preferably, the structure of the single-stranded DNA linked to quercetin is as follows:

[0030] .

[0031] Furthermore, the self-assembly is performed by adding the DNA single strand connected with quercetin and the remaining three single strands of nucleic acid tetrahedral DNA into TM buffer in an equimolar ratio, maintaining at 93-97° C. for 8-12 minutes, and rapidly cooling to 3-5° C. for 18-22 minutes.

[0032] Preferably, the reaction solution is heated to 95° C. and maintained for 10 min, and then rapidly cooled to 4° C. and maintained for 20 min for synthesis.

[0033] Retinal neovascular diseases are accompanied by the appearance of retinal non-perfusion area (NPA, also known as avascular area, AVA), which becomes the root cause of the disease's reversal, easy recurrence, and the need for repeated treatment. The above-mentioned retinal neovascular diseases include but are not limited to retinopathy of prematurity (ROP), proliferative diabetic retinopathy (PDR), wet age-related macular degeneration (wAMD), retinal vein occlusion (RVO) and other abnormal angiogenesis diseases.

[0034] Pathological retinal neovascularization is seen in common and severe retinal diseases of all ages. Currently, patients with advanced ROP, PDR or RVO are treated with retinal photocoagulation or anti-vascular endothelial growth factor (VEGF) therapy to inhibit neovascularization. Retinal photocoagulation can lead to complications such as decreased visual acuity, decreased night vision and persistent narrowing of the visual field due to the loss of retinal neural tissue caused by the laser. Anti-VEGF therapy has been used clinically to treat patients with ROP, PDR and RVO, but there are potential drawbacks. First, adverse reactions associated with blocking vascular endothelial growth factor signaling include damage to normal retinal vascular growth and retinal function. Second, recurrence of pathological neovascularization is common in premature infants or diabetic patients after intravitreal injection of anti-VEGF antibodies due to persistent ischemic / nonperfusion states. The tFNAs-QUE complex of the present invention has excellent anti-retinal neovascularization and neuroprotective effects. The tFNAs-QUE complex of the present invention can effectively prevent the formation of new blood vessels, promote vascular remodeling in the retinal non-perfused area (promote the formation of physiological blood vessels in the non-vascular area), restore retinal vascular damage, and provide a new strategy for the treatment and prevention of retinal neovascular diseases. It has great potential to become a new drug for retinal neovascular diseases.

[0035] Therefore, the present invention also provides the use of the nucleic acid tetrahedron DNA-quercetin complex in the preparation of drugs for preventing and / or treating retinal neovascularization-related diseases.

[0036] Furthermore, the retinal neovascularization-related diseases include, but are not limited to, one or more of retinopathy of prematurity, proliferative diabetic retinopathy, wet age-related macular degeneration or retinal vein occlusion.

[0037] As a preferred embodiment, when administered to cells, the preferred dose of the tFNAs-QUE complex is 250 nM. When administered to animals, the preferred dose of tFNAs-QUE is 250 nM, and the dosage for intravitreal administration is 1 μL.

[0038] Furthermore, the pharmaceutical preparation is one or more of an injection, eye drops, liposomes or aerosols.

[0039] The present invention also provides a drug for preventing and / or treating retinal neovascular diseases, wherein the drug comprises any one of the above-mentioned nucleic acid tetrahedron DNA-quercetin complexes.

[0040] Furthermore, the medicine also includes pharmaceutically acceptable excipients.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] In the nucleic acid tetrahedron DNA-quercetin complex of the present invention, the quercetin molecule is connected to one of the four single-stranded DNAs of the nucleic acid tetrahedron through an azide coupling reaction. The tFNAs-QUE complex can stably load the quercetin molecules, has stable physical and chemical properties, and the quantitatively carried quercetin molecules ensure the stability of the therapeutic efficacy of the complex. The tFNAs-QUE complex can effectively prevent the formation of new blood vessels, promote vascular remodeling in the retinal non-perfusion area, restore retinal vascular damage, and provide a new strategy for the treatment and prevention of retinal neovascular diseases. At the same time, the tFNAs-QUE synthesized by the azide coupling method of the present invention has a better therapeutic effect than the tFNAs-QUE obtained by the existing electrostatic adsorption method. While greatly reducing pathological new blood vessels, it significantly promotes the formation of physiological blood vessels in the avascular area. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is the H NMR spectrum of the azide-modified quercetin compound (deuterated methanol).

[0044] Figure 2 Analysis of the physicochemical properties of the complex tFNAs-Que.

[0045] Figure 3 This is the UV-Visible Spectroscopy analysis of tFNAs-QUE and tFNAs+QUE.

[0046] Figure 4 Ultra Performance Liquid Chromatography (UPLC) of tFNAs-QUE and tFNAs+QUE.

[0047] Figure 5 This is the liquid chromatography-mass spectrometry analysis (LC-MS analysis) of tFNAs-QUE and tFNAs+QUE.

[0048] Figure 6 These are the statistical results of the retinal neovascularization area and the avascular area area of ​​each group of mice after each dosing group was administered to the mouse oxygen-induced retinopathy (OIR) model, including the blank control group (Control), aflibercept (AFL, positive control) group, tFNAs+QUE group, and tFNA-QUE group. DETAILED DESCRIPTION

[0049] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0050] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0051] Example 1 Synthesis of Tetrahedral DNA-Quercetin Complex (tFNAs-QUE) by Azide Coupling Method

[0052] The synthesis of nucleic acid tetrahedral DNA-quercetin complex (tFNAs-QUE) was carried out using the dibenzocyclooctyne (DBCO)-azide (Azide) click chemistry scheme. Dibenzocyclooctyne (DBCO) is a type of reagent used for click chemistry labeling, which can specifically react with azide-labeled molecules or biomolecules to form stable triazole compounds. This click chemistry reaction is called stress-promoted alkyne-azide cycloaddition reaction (SPAAC). Depending on the properties of the substrate molecule, the DBCO click chemistry reaction can be carried out in aqueous buffer or organic solvent. At the same time, in order to increase its solubility in aqueous solution, the spacer arm structure of CA (PEG) n is selected to improve the hydrophilicity of the compound. In brief, this DBCO-Azide method is divided into the following steps: 1. First, activate quercetin and the azide group to obtain azide-modified quercetin. 2. DNA single strand S1 is modified with amino group (NH2-C6) and activated with DBCO to form diphenylcyclooctyne-carbon 6-amino-DNA single strand DBCO-C6-NH2-DNA single strand (DBCO-C6-amine-oligo sequence). 3. The two activated biomolecules are then mixed to form a conjugate. 4. Finally, it self-assembles with other DNA single strands S2, S3, and S4 to form a tFNAs-QUE complex. The specific steps include the following:

[0053] (1) Synthesis of azide-modified quercetin molecules

[0054] Experimental steps:

[0055] 1) Introduction of quercetin protective group: dissolve quercetin in an appropriate amount of anhydrous dichloromethane, add an appropriate amount of anhydrous potassium carbonate (3 times the molar amount) as a base, and stir thoroughly. Slowly add dimethyl sulfate (2 times the molar amount) dropwise under ice bath conditions, and keep stirring the reaction system for 2 hours. After the reaction is completed, add water to separate the liquid, take the organic phase, concentrate and dry to obtain quercetin modified with the protective group.

[0056] 2) Introduction of azide groups: The quercetin modified with the protecting group was dissolved in tetrahydrofuran, sodium azide (3 times the molar amount) was added, and the mixture was stirred at 60°C for 4 hours. After the reaction, the reaction system was cooled to room temperature and washed with hydrochloric acid solution to remove excess sodium azide.

[0057] 3) Isolation and purification of the product: The reaction system was separated with deionized water and dichloromethane, the organic phase was taken, dried with anhydrous sodium sulfate, filtered and then the solvent was removed by rotary evaporation to obtain a crude product. Column chromatography was used for purification, and the eluent was a dichloromethane / methanol mixture (volume ratio 95:5).

[0058] 4) Deprotection: Dissolve the purified product in an appropriate amount of methanol, add sodium hydroxide solution, and stir at room temperature for 2 hours to remove the protecting group. After the reaction, adjust the pH to neutral, concentrate, and purify by column chromatography again to obtain the final product of azide-modified quercetin.

[0059] The final product was analyzed by nuclear magnetic resonance spectroscopy, and the results showed that there were mainly three different isomers of azide-modified quercetin. Figure 1 shown.

[0060] (2) Modification of the 5' end of DNA single strand S1 using dibenzocyclooctyne (DBCO):

[0061] To synthesize amino (NH2-C6) modified (5' end modified) single-stranded DNA S1, the amino-modified single-stranded DNA S1 was mixed with 20-30 times the molar equivalent of DBCO-PEG4-NHS ester (CAS No.: 1427004-19-0, dissolved in 10mM DMSO). The DMSO ratio in the final mixture was about 20%, and the concentration of amino-modified single-stranded DNA S1 was about 1mg / mL. Incubate at room temperature for 60 minutes. Add Tris solution (10μL, 100mM, aqueous solution) to quench the unreacted DBCO-PEG4-NHS ester. Incubate again for 15 minutes. Use a spin desalting column to remove the unreacted DBCO-PEG4-NHS ester to obtain the 5' end modified DBCO single-stranded DNA S1.

[0062] (3) Click chemistry was used to couple azide-modified quercetin with DBCO-modified DNA single-strand S1

[0063] The obtained DBCO-modified DNA single-strand S1 was mixed with 2-4 times molar equivalents of azide-modified quercetin. Incubated overnight at 4°C. The final conjugate was verified by SDS gel electrophoresis. Unreacted oligonucleotides were removed by liquid chromatography (reverse phase HPLC or ion exchange HPLC) to obtain DNA single-strand S1 (S1-QUE) connected with quercetin, the structure of which is shown below:

[0064] .

[0065] (4) Synthesis of tFNAs-QUE

[0066] The four single strands (S1-QUE, S2, S3, S4) were added in an equimolar ratio (1 μL of 100 μM storage solution was added to each single strand) into a 200 μL EP tube containing 96 μL TM buffer (10 mM Tris-HCl, 50 mM MgCl2, 35 pH 8.0). The reaction solution was heated to 95°C for 10 min, then quickly cooled to 4°C and maintained for 20 min.

[0067] The sequences of the four single strands (5′→3′) are as follows:

[0068] S1-QUE:ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO.1);

[0069] S2:ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG (SEQ ID NO. 2);

[0070] S3:ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO.3);

[0071] S4:ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO. 4).

[0072] The physicochemical properties of the synthesized tetrahedral DNA-quercetin complex (tFNAs-QUE) are as follows Figure 2 As shown, the electron microscopy image of the complex tFNAs-Que shows that it has a tetrahedral structure ( Figure 2 The particle size of the synthesized complex tFNAs-Que is uniform, mainly containing two sizes, of which 14.91nm accounts for 87.1% and 13.2nm accounts for 12.9% ( Figure 2In comparison, the DNA-quercetin complex (tFNAs+Que) synthesized by electrostatic adsorption contains 7 particle sizes, mainly 10.34nm (27.0%), 11.68nm (28.9%), 13.2nm (20.4%), 14.91nm (7.3%) ( Figure 2 lower left).

[0073] Example 2 Comparison of thermal stability of nucleic acid tetrahedral DNA-quercetin complex synthesized by azide coupling method and nucleic acid tetrahedral DNA-quercetin complex synthesized by electrostatic adsorption method

[0074] (1) UV-visible spectroscopy, ultra-high performance liquid chromatography, and liquid chromatography-mass spectrometry were used to detect the thermal stability of the two, including the synthesis of nucleic acid tetrahedral DNA-quercetin complex (referred to as tFNAs-QUE) by azide coupling method in Example 1 and electrostatic adsorption method (quercetin (80 μM) tetrahedral framework nucleic acid (250 nM). The nucleic acid tetrahedral DNA + quercetin complex (referred to as tFNAs + QUE) was synthesized by shaking and mixing at 4°C for 6 hours. The detection was carried out under the conditions of 60°C / 10 min, 60°C / 20 min, 70°C / 10 min, 70°C / 20 min, 80°C / 10 min, and 80°C / 20 min. After ultrafiltration (molecular weight cutoff of 30 kilodaltons), the unloaded quercetin and the remaining single-stranded DNA were removed)

[0075] Figure 3 The UV-visible spectroscopic analysis results of tFNAs-QUE and tFNAs+QUE show that tFNAs-QUE has a single peak at 4.79-4.88 min under different temperature and reaction time conditions, while tFNAs+QUE has a double peak at 0.50 min and 1.46 min under different temperature and reaction time conditions. This shows that tFNAs-QUE has better thermal stability and a more stable structure than tFNAs+QUE.

[0076] Figure 4 This is the ultra-high performance liquid chromatography spectrum of tFNAs-QUE and tFNAs+QUE. The results show that under different temperature and reaction time conditions, tFNAs-QUE has main peaks between 1.792 and 2.153 min, and the area proportion of the main peaks is higher than 95%; tFNAs+QUE has multiple main peaks around 0.34 min, around 0.73 min, and between 1.51 and 2.04 min, and the area proportion of the main peaks is less than 30%. This shows that the material composition of tFNAs-QUE is more single.

[0077] Figure 5The results of LC-MS analysis of tFNAs-QUE and tFNAs+QUE are shown in Figure 2. tFNAs-QUE has a peak at 4.80-4.88 min under different temperatures and reaction times, and tFNAs+QUE has two peaks at 0.50 min and 1.45-1.46 min under different temperatures and reaction times. This indicates that tFNAs-QUE has better thermal stability than tFNAs+QUE.

[0078] In summary, Figures 2 to 5 The experimental results show that tFNAs-QUE has a simpler material composition, better thermal stability and more stable structure than tFNAs+QUE.

[0079] Example 3 In vivo model experiment

[0080] (1) Observation of retinal vascularization in the oxygen-induced retinopathy (OIR) mouse model

[0081] Experimental animals: C57BL / 6 mice;

[0082] 1) Mice were placed in an oxygen box with an oxygen concentration of 75% from P7 to P12 after birth. High oxygen concentrations can lead to the loss of immature retinal blood vessels and slow down the development of the normal retinal vascular system, resulting in the formation of avascular areas in the central retina.

[0083] 2) At P12, the mice were returned to normal room air (oxygen concentration of about 21%). The hypoxic environment induced the expression of angiogenic factors, leading to the regeneration of normal retinal blood vessels and the pathological formation of new blood vessels, simulating the second stage of ROP.

[0084] 3) The mice were divided into groups and administered intravitreal drugs at P12. The administration methods were as follows: ① blank control group (Control): no intravitreal drug administration; ② aflibercept (AFL, positive control) group: 1 μL 40 mg / mL AFL was administered intravitreally to both eyes; ③ the nucleic acid tetrahedron DNA-quercetin complex synthesized by electrostatic adsorption method, i.e. tFNAs+QUE group: 1 μL (250 nM: 80 μM) was administered intravitreally to both eyes; ④ the nucleic acid tetrahedron DNA-quercetin complex synthesized by azide coupling method, i.e. tFNAs-Que group: 1 μL 250 nM was administered intravitreally to both eyes;

[0085] 4) At P17, the retina was observed and immunofluorescence stained, and then photographed. ImageJ was used to calculate the area of ​​retinal neovascularization and avascular area.

[0086] The experimental results are as follows Figure 6As shown, compared with the control group, the AFL group and the tFNAs+QUE group can reduce retinal neovascularization, and the tFNAs-QUE group showed an inhibitory effect superior to the first three groups (control group, AFL group, tFNAs+QUE group). In terms of reducing the retinal avascular area, the effect of the tFNAs-QUE group was better than the first three groups (compared with the control group, the AFL group, and the tFNAs+QUE group), and was significantly better than the AFL group and the control group. In addition, while tFNAs-QUE significantly reduced pathological neovascularization, it also significantly promoted the formation of physiological blood vessels in the avascular area. In addition, the area ratio of the avascular area and the ratio of the neovascular group were both less than 10%, which was defined as effective. The effective rate of tFNAs-QUE was 83.8% (10 / 12), which was much higher than the effective rate of tFNAs+QUE (50%, 6 / 12), indicating that tFNAs-QUE had a better neovascularization inhibition rate and more stable therapeutic effect compared with tFNAs+QUE. If the same therapeutic effect is achieved, the concentration of quercetin used in the tFNAs-QUE group can be reduced by at least 1 to 2 orders of magnitude compared to the tFNAs+QUE group, achieving a reduction in the amount of the drug and an increase in efficacy. In addition, the drug tFNAs-QUE complex has no obvious retinal toxicity and has high biological safety.

Claims

1. A nucleic acid tetrahedral DNA-quercetin complex, comprising nucleic acid tetrahedral DNA and quercetin, characterized in that: The 5' end of a single-stranded DNA in the nucleic acid tetrahedral DNA is connected to the linking group on the benzene ring of quercetin through a triazole structure formed by the reaction of a DBCO group and an azide group; The preparation method of the nucleic acid tetrahedron DNA-quercetin complex comprises the following steps: S1. Modifying the hydroxyl group of the benzene ring of quercetin with an azide group: introducing a methyl group to quercetin to form a protecting group, then adding sodium azide to introduce an azide group, removing the protecting group after separation and purification, and obtaining an azide-modified quercetin molecule; S2. Modify the 5' end of one of the DNA single strands of the nucleic acid tetrahedral DNA with a DBCO group: first synthesize a DNA single strand modified with NH2-C6 at the 5' end, and then activate it with DBCO-PEG4-NHS ester to form a diphenylcyclooctyne-carbon 6-amino-DNA single strand; S3. The quercetin modified with an azide group and the single-stranded DNA modified with a DBCO group are subjected to a DBCO-azide click chemistry reaction to synthesize a single-stranded DNA connected with quercetin; the structure of the single-stranded DNA connected with quercetin is as follows: ； S4. The DNA single strand connected with quercetin and the remaining three single strands of nucleic acid tetrahedral DNA are self-assembled in an equimolar ratio to obtain.

2. The nucleic acid tetrahedron DNA-quercetin complex according to claim 1, characterized in that: The nucleotide sequences of the four DNA single strands of the nucleic acid tetrahedron DNA are shown in SEQ ID NOs. 1 to 4 respectively.

3. The nucleic acid tetrahedron DNA-quercetin complex according to claim 1, characterized in that: The self-assembly is performed by adding the DNA single strand connected with quercetin and the remaining three single strands of nucleic acid tetrahedral DNA into TM buffer in an equimolar ratio, maintaining at 93-97° C. for 8-12 minutes, and rapidly cooling to 3-5° C. and maintaining for 18-22 minutes.

4. The nucleic acid tetrahedron DNA-quercetin complex according to claim 1, characterized in that: The reaction solution is heated to 95°C and maintained for 10 minutes, and then quickly cooled to 4°C and maintained for 20 minutes for synthesis.

5. Use of the nucleic acid tetrahedron DNA-quercetin complex according to any one of claims 1 to 4 in the preparation of a drug for preventing and / or treating retinal neovascularization-related diseases.

6. The use according to claim 5, characterized in that: The retinal neovascularization-related diseases are one or more of retinopathy of prematurity, proliferative diabetic retinopathy, wet age-related macular degeneration or retinal vein occlusion.

7. The use according to claim 5, characterized in that: The drug preparation is one or more of injection, eye drops, liposome or aerosol.

8. A drug, characterized in that The invention comprises the nucleic acid tetrahedron DNA-quercetin complex according to any one of claims 1 to 4.

9. The drug according to claim 8, characterized in that: The drug also includes pharmaceutically acceptable excipients.

Images