Nano composite material dispersion liquid and preparation method thereof, and kit and method for detecting m6A-RNA and m5C-RNA

Abstract

The invention provides a nano composite material dispersion liquid and a preparation method thereof, and a kit and a method for detecting m6A-RNA and m5C-RNA, and belongs to the technical field of biological detection. The nano composite material dispersion liquid provided by the invention comprises tris-(2, 2 '-dipyridyl) ruthenium, platinum nanoparticles, gold nanoparticles, a perfluorosulfonic acid polytetrafluoroethylene copolymer and water. The nano composite material is an aggregate formed by tris-(2, 2 '-bipyridine) ruthenium, platinum nanoparticles and gold nanoparticles, and simple and high-sensitivity detection of m6A-RNA and m5C-RNA can be realized by preparing the biosensor on the basis of the aggregate.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a nanocomposite material dispersion liquid and a preparation method thereof, and a kit and a method for detecting mA-RNA and mA-RNA. Background Art

[0002] DNA methylation is considered a true epigenetic mark that is involved in a variety of regulatory processes. Compared with genomic DNA, RNA undergoes complex post-transcriptional processing. RNA splicing significantly increases the complexity of gene expression by connecting exons and removing introns. So far, more than 170 RNA modifications have been identified as multiple RNA post-transcriptional regulators. RNA modifications include N7 methylguanine (m7G), N6 methyladenine (m6A), 2'-O-dimethyladenosine (m6Am), N1 methyladenosine (m1A), 5-methylcytosine (m5C) and 5-hydroxymethylcytosine, of which m6A and m5C are the two most abundant modifications in eukaryotes. m6A is involved in the translation, export, splicing and degradation metabolism of all mRNAs. m5C modification plays an important role in regulating the biological clock, embryonic development and maintaining the pluripotency of embryonic stem cells.

[0003] In recent years, researchers have been vigorously researching and developing methods for detecting RNA methylation. At present, the detection strategies of RNA methylation (such as m6A-RNA and m5C-RNA) mainly include high-performance liquid chromatography (HPLC), thin-layer chromatography (TLC) and RNA immunoprecipitation followed by sequencing (MeRIP-Seq). However, these methods require radioisotope labeling, and the operation procedures are complicated and require precision instruments. Therefore, there is an urgent need for a simple and highly sensitive RNA methylation detection technology. Summary of the invention

[0004] The object of the present invention is to provide a nanocomposite dispersion and a preparation method thereof, a kit and a method for detecting m6A-RNA and m5C-RNA, wherein the nanocomposite is Ru(bpy)3 2+ , PtNPs and AuNPs to form aggregates, and the preparation of biosensors based on this can achieve simple and highly sensitive detection of mA-RNA and m5C-RNA.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a nano composite material dispersion liquid, which comprises tri-(2,2'-bipyridine) ruthenium, platinum nanoparticles, gold nanoparticles, perfluorosulfonic acid polytetrafluoroethylene copolymer and water.

[0007] Preferably, the particle size of the platinum nanoparticles is 2 to 5 nm; the particle size of the gold nanoparticles is 15 to 20 nm.

[0008] The present invention provides a method for preparing the nanocomposite material dispersion described in the above technical solution, comprising the following steps:

[0009] The H2PtCl6 solution is subjected to a first reduction reaction in the presence of 3-thiophenemalonic acid to generate platinum nanoparticles, thereby obtaining a first reduction product solution;

[0010] The first reduction product solution is mixed with a tri-(2,2′-bipyridine)ruthenium solution, the obtained mixture is mixed with a HAuCl4 solution, a trisodium citrate solution and a NaBH4 solution, and a second reduction reaction is performed to generate gold nanoparticles to obtain a second reduction product solution;

[0011] The second reduction product solution is mixed with the Nafion solution to obtain the nanocomposite material dispersion.

[0012] The present invention provides a kit for detecting m6A-RNA and m5C-RNA, comprising a modified nanocomposite material dispersion, an H1 DNA probe solution with -SH, a hexanethiol solution, an output DNA-Fc solution, a four-arm tetrahedron DNA walker solution and a zinc salt solution;

[0013] The modified nanocomposite dispersion is obtained by modifying anti-m5C antibody and bovine serum albumin after activation treatment of the nanocomposite dispersion, and the nanocomposite dispersion is the nanocomposite dispersion described in the above technical solution or the nanocomposite dispersion prepared by the preparation method described in the above technical solution;

[0014] The preparation method of the output DNA-Fc liquid comprises the following steps: activating the MB suspension and then performing Fc-HP1 modification to obtain the MB-HP1 suspension; mixing the mA-RNA solution, MazF, RNase inhibitor and MazF reaction buffer for cleavage reaction to obtain the cleavage product liquid; mixing the cleavage product liquid, the MB-HP1 suspension and a hybridization buffer for hybridization reaction to obtain the hybridization product liquid; mixing the hybridization product liquid, DSN and a DSN main buffer for output treatment, and obtaining the output DNA-Fc liquid through magnetic separation;

[0015] The preparation method of the four-arm tetrahedron DNA walker liquid comprises the following steps: dispersing four single sequences T1, T2, T3 and T4 in TM buffer for a first assembly, mixing the obtained liquid with HP2 solution for a second assembly, and obtaining the four-arm tetrahedron DNA walker liquid;

[0016] The nucleotide sequence of the H1 DNA probe in the H1 DNA probe solution with -SH is shown in SEQ ID NO.1;

[0017] The nucleotide sequence of HP1 in the Fc-HP1 is shown in SEQ ID NO.2;

[0018] The nucleotide sequence of T1 is shown in SEQ ID NO.3;

[0019] The nucleotide sequence of T2 is shown in SEQ ID NO.4;

[0020] The nucleotide sequence of T3 is shown in SEQ ID NO.5;

[0021] The nucleotide sequence of T4 is shown in SEQ ID NO.6;

[0022] The nucleotide sequence of HP2 is shown in SEQ ID NO.7.

[0023] Preferably, the molar ratio of T1, T2, T3 and T4 is 1:1:1:1.

[0024] The present invention provides a method for detecting m6A-RNA and m5C-RNA for non-disease diagnosis purposes using the kit described in the above technical solution, comprising the following steps:

[0025] Using a modified nanocomposite material dispersion to perform a first modification on the surface of a base electrode to obtain a first modified electrode;

[0026] Using a H1 DNA probe solution with -SH to perform a second modification on the surface of the first modified electrode to obtain a second modified electrode;

[0027] Performing a third modification on the surface of the second modified electrode using a hexanethiol solution to obtain a third modified electrode;

[0028] The output DNA-Fc solution is used to perform a fourth modification on the surface of the third modified electrode to obtain a fourth modified electrode; wherein the mA-RNA solution used in preparing the output DNA-Fc solution is the mA-RNA solution to be tested;

[0029] Performing a fifth modification on the surface of the fourth modified electrode using a m5C-RNA solution to be tested to obtain a fifth modified electrode;

[0030] Using a four-arm tetrahedral DNA walker liquid to perform a sixth modification on the surface of the fifth modified electrode to obtain a sixth modified electrode;

[0031] Performing a seventh modification on the surface of the sixth modified electrode using a zinc salt solution to obtain a biosensor;

[0032] The biosensor is used as a working electrode for electrochemiluminescence detection to obtain an electrochemiluminescence intensity, and the m6A-RNA concentration in the m6A-RNA solution to be tested and the m5C-RNA concentration in the m5C-RNA solution to be tested are calculated based on the electrochemiluminescence intensity and the m6A-RNA working curve and the m5C-RNA working curve.

[0033] Preferably, the substrate electrode is a glassy carbon electrode.

[0034] Preferably, the electrochemiluminescence detection is carried out in a PBS buffer solution containing K2S2O8.

[0035] Preferably, the concentration of K2S2O8 in the PBS buffer solution is 50-120 mM.

[0036] Preferably, the conditions for electrochemiluminescence detection include: a scan rate of 250 to 350 mV -1 , the scanning potential is -1~1.2V, and the voltage of the photomultiplier tube is 800V.

[0037] The present invention provides a nanocomposite material dispersion, comprising tri-(2,2′-bipyridine)ruthenium (Ru(bpy)3 2+ ), platinum nanoparticles (PtNPs), gold nanoparticles (AuNPs), perfluorosulfonic acid polytetrafluoroethylene copolymer (Nafion) and water. The nanocomposite material of the present invention is Ru(bpy)3 2+ , PtNPs and AuNPs to form aggregates, and the preparation of biosensors based on this can achieve simple and highly sensitive detection of mA-RNA and m5C-RNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 A flow chart of preparing a biosensor in an embodiment of the present invention;

[0039] Figure 2 Ru(bpy)3 2+ Scanning electron microscopy image of @PtNPs@Nafion@AuNPs;

[0040] Figure 3 Ru(bpy)3 2+ Transmission electron microscopy image of @PtNPs@Nafion@AuNPs;

[0041] Figure 4 Ru(bpy)3 2+ EDX element mapping corresponding to @PtNPs@Nafion@AuNPs;

[0042] Figure 5 is the ECL intensity-potential curve;

[0043] Figure 6 The detection results of the ECL biosensor under different concentrations of m6A-RNA and m5C-RNA;

[0044] Figure 7 This is a graph showing the specificity and stability test results of the ECL biosensor for mA-RNA and mA-RNA. DETAILED DESCRIPTION

[0045] The invention provides a nano composite material dispersion liquid, which comprises tri-(2,2'-bipyridine) ruthenium, platinum nanoparticles, gold nanoparticles, perfluorosulfonic acid polytetrafluoroethylene copolymer and water.

[0046] As an embodiment of the present invention, the Ru(bpy)3 2+ , PtNPs and AuNPs form aggregates (i.e., nanocomposite materials); Ru(bpy)3 2+ The concentration of can be 0.038M, the concentration of PtNPs can be 0.075mM, and the concentration of AuNPs can be 29.6mM.

[0047] As an embodiment of the present invention, the particle size of the PtNPs may be 2 to 5 nm, specifically 3 nm; the particle size of the AuNPs may be 15 to 20 nm, specifically 15 to 17 nm.

[0048] The perfluorosulfonic acid polytetrafluoroethylene copolymer (Nafion) in the nano-composite material dispersion of the present invention can play a coating and fixing role, and can improve the anti-interference ability and enhance the electrolyte performance.

[0049] Electrochemiluminescence (ECL) biosensors have attracted great interest due to their fast response, controllable luminescence parameters, and increased sensitivity, making them ideal for real-world applications. ECL is an electrode redox-induced luminescence technology that combines the unique advantages of electrochemistry and spectroscopy. It is known for its simplicity, cost-effectiveness, responsiveness, and sensitivity, making it a powerful sensing platform for bioanalysis. With the development of ECL biosensors specifically designed to detect epigenetic modifications, ECL technology has found widespread application in clinical diagnostics and biomedical research. ECL can manifest itself through either annihilation pathways or co-reaction pathways. The traditional ECL luminogen is Ru(bpy)3 2+ Materials and complexes, as well as co-reactants (H2O2, S2O8 2- and triethylamine). Among these ECL luminophores, Ru(bpy)3 2+It exhibits excellent stability and strong ECL signal because it can undergo a reversible single electron transfer redox process, making it stable, repeatable and accurate for long-term use. In addition, PtNPs can be used as electrocatalysts and have excellent electroactive capabilities. The present invention is based on the formation of Ru(bpy)3 in aqueous solution 2+ , PtNPs and AuNPs, and then attach the aggregates to the surface of a substrate electrode (such as a glassy carbon electrode). On this basis, an ECL biosensor is prepared, which ultimately achieves the quantitative detection of m6A-RNA and m5C-RNA with the advantages of high sensitivity, fast signal response, high specificity, low cost, and easy promotion in clinical laboratories.

[0050] The present invention provides a method for preparing the nanocomposite material dispersion described in the above technical solution, comprising the following steps:

[0051] The H2PtCl6 solution is subjected to a first reduction reaction in the presence of 3-thiophenemalonic acid to generate platinum nanoparticles, thereby obtaining a first reduction product solution;

[0052] The first reduction product solution is mixed with a tri-(2,2′-bipyridine)ruthenium solution, the obtained mixture is mixed with a HAuCl4 solution, a trisodium citrate solution and a NaBH4 solution, and a second reduction reaction is performed to generate gold nanoparticles to obtain a second reduction product solution;

[0053] The second reduction product solution is mixed with the Nafion solution to obtain the nanocomposite material dispersion.

[0054] In the present invention, unless otherwise specified, the raw materials used are commercially available products well known to those skilled in the art or are prepared by methods well known to those skilled in the art.

[0055] The present invention conducts a first reduction reaction on an H2PtCl6 solution in the presence of 3-thiophenemalonic acid to generate platinum nanoparticles, and obtains a first reduction product liquid. In the embodiment of the present invention, the 3-thiophenemalonic acid solution and the H2PtCl6 solution are specifically mixed to conduct the first reduction reaction; the concentration of the 3-thiophenemalonic acid solution can be 0.3M, and the concentration of the H2PtCl6 solution can be 0.75mM; the volume ratio of the 3-thiophenemalonic acid solution to the H2PtCl6 solution can be 100:1; the temperature of the first reduction reaction can be 100°C, the time can be 20min, and the first reduction reaction is preferably carried out under stirring conditions; the first reduction product liquid is specifically a dark brown PtNPs colloidal solution.

[0056] After obtaining the first reduction product liquid, the present invention mixes the first reduction product liquid with a tri-(2,2′-bipyridine)ruthenium solution, mixes the obtained mixture with a HAuCl4 solution, a trisodium citrate solution and a NaBH4 solution, and performs a second reduction reaction to generate gold nanoparticles to obtain a second reduction product liquid. In the embodiment of the present invention, the tri-(2,2′-bipyridine)ruthenium (Ru(bpy)3 2+ The tri-(2,2′-bipyridine)ruthenium can be specifically tri-(2,2′-bipyridine)ruthenium (II) chloride hexahydrate solution, which is added to the first reduction product solution, and then HAuCl4 solution and trisodium citrate solution are added, and the resulting mixed system is heated to the temperature of the second reduction reaction, and then NaBH4 solution is added to carry out the second reduction reaction. In an embodiment of the present invention, the concentration of the tri-(2,2′-bipyridine) ruthenium solution may be 0.03M, the concentration of the HAuCl4 solution may be 24.28mM, the concentration of the trisodium citrate solution may be 10mM, and the concentration of the NaBH4 solution may be 1wt%; the volume ratio of the H2PtCl6 solution, the tri-(2,2′-bipyridine) ruthenium solution, the HAuCl4 solution, the trisodium citrate solution and the NaBH4 solution may be 100mL: 2mL: 200μL: 1mL: 80μL; the temperature of the second reduction reaction may be 80°C, and the time may be 20min; the second reduction product liquid is specifically AuNPs@Ru(bpy)3 2+ @PtNPs dispersion.

[0057] After obtaining the second reduction product liquid, the present invention mixes the second reduction product liquid with the Nafion solution to obtain the nanocomposite dispersion. In the embodiment of the present invention, the concentration of the Nafion solution can be 5wt%; the volume ratio of the H2PtCl6 solution to the Nafion solution can be 100:1. In the embodiment of the present invention, the nanocomposite dispersion (denoted as Ru(bpy)3 2+ @PtNPs@Nafion@AuNPs dispersion), no other treatment is required and it can be used directly later.

[0058] The invention provides a kit for detecting m6A-RNA and m5C-RNA, comprising a modified nanocomposite material dispersion, an H1 DNA probe solution with -SH, a hexanethiol solution, an output DNA-Fc solution, a four-arm tetrahedron DNA walker solution and a zinc salt solution.

[0059] In an embodiment of the present invention, the concentration of the H1 DNA probe solution with -SH can be 1μM; the concentration of the hexanethiol solution can be 10mM; the concentration of the zinc salt solution can be 1mM, and the zinc salt in the zinc salt solution can specifically be zinc chloride. In an embodiment of the present invention, the volume ratio of the modified nanocomposite dispersion, the H1 DNA probe solution with -SH, the hexanethiol solution, the output DNA-Fc solution, the four-arm tetrahedral DNA walker solution and the zinc salt solution can be 1:1:1:1:1:1:1. The following is a detailed description of the preparation methods of the three reagents of the modified nanocomposite dispersion, the output DNA-Fc solution and the four-arm tetrahedral DNA walker solution.

[0060] In the present invention, the preparation method of the modified nanocomposite dispersion comprises the following steps: modifying the anti-m5C antibody and bovine serum albumin after the nanocomposite dispersion is activated to obtain the modified nanocomposite dispersion. In the embodiment of the present invention, Ru(bpy)3 prepared in the above technical solution is specifically 2+ The @PtNPs@Nafion@AuNPs dispersion is mixed with an activator and activated to obtain an activated product solution; an anti-m5C antibody (Ab) solution and a bovine serum albumin (BSA) solution are added to the activated product solution for modification to obtain the modified nanocomposite dispersion. In an embodiment of the present invention, the activator can be obtained by mixing 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) in a molar ratio of 4:1, and the volume ratio of the H2PtCl6 solution to the activator can be 100:0.5; the temperature of the activation treatment can be 37°C and the time can be 2h. In an embodiment of the present invention, the concentration of the Ab solution can be 1mg / mL, and the concentration of the BSA solution can be 0.5wt%; the volume ratio of the H2PtCl6 solution to the Ab solution and the BSA solution can be 100mL:400μL:100μL; the temperature of the modification treatment can be 4°C and the time can be 2h. In the embodiment of the present invention, after modification treatment, the modified nanocomposite dispersion (denoted as Ru(bpy)3 2+ @PtNPs@Nafion@AuNPs-Ab-BSA dispersion) without post-treatment and stored at 4 °C for further use.

[0061] In the present invention, the preparation method of the output DNA-Fc feed liquid comprises the following steps: activating the magnetic bead (MB) suspension and then modifying the hairpin probe HP1 (Fc-HP1) to obtain a magnetic bead-hairpin probe HP1 (MB-HP1) suspension; mixing the m6A-RNA solution, internal ribonuclease (MazF), RNase inhibitor and MazF reaction buffer for cleavage reaction to obtain a cleavage product feed liquid; mixing the cleavage product feed liquid, the MB-HP1 suspension and hybridization buffer for hybridization reaction to obtain a hybridization product feed liquid; mixing the hybridization product feed liquid, double-stranded specific nuclease (DSN) and DSN main buffer for output treatment, and obtaining the output DNA-Fc feed liquid by magnetic separation. The present invention is based on MazF-mediated cleavage reaction and hybridization reaction, which are described in detail below.

[0062] The present invention activates the MB suspension and then modifies Fc-HP1 to obtain an MB-HP1 suspension. In the embodiment of the present invention, the MB suspension is specifically mixed with the EDC solution for activation treatment to activate MB to obtain an activated MB suspension; the activated MB suspension, the NHS solution and the Fc-HP1 solution are mixed for modification treatment to obtain an MB-HP1 suspension. In the embodiment of the present invention, the concentration of the MB suspension can be 5 mg / mL, the concentration of the EDC solution can be 0.2M, the concentration of the NHS solution can be 0.05M, and the concentration of the Fc-HP1 solution can be 1μM; the volume ratio of the MB suspension, the EDC solution, the NHS solution and the Fc-HP1 solution can be 1mL: 40μL: 40μL: 50μL; the temperature of the activation treatment can be 37°C, and the time can be 30min; the temperature of the modification treatment can be 4°C, and the time can be 12h. After the modification treatment in the embodiment of the present invention, the MB-HP1 suspension is obtained, and no other treatment is required, and it can be used directly later.

[0063] The present invention mixes an m6A-RNA solution, MazF, an RNase inhibitor and a MazF reaction buffer to perform a cleavage reaction to obtain a cleavage product solution. In the embodiment of the present invention, the concentration of the m6A-RNA solution can be 10fM to 100nM, specifically 10fM, 100fM, 1pM, 10pM, 100pM, 1nM, 10nM or 100nM; the MazF reaction buffer is specifically 1×MazF reaction buffer (0.01wt% Tween-20, 40mMNa3(PO4)2, pH=7.5); the volume ratio of the m6A-RNA solution to the MazF reaction buffer can be 1:1; the activity of the MazF during the cleavage reaction can be 5U, and the activity of the RNase inhibitor can be 20U. In the embodiment of the present invention, the cleavage reaction specifically includes a first stage reaction and a second stage reaction; the temperature of the first stage reaction can be 37°C, and the time can be 40min; the temperature of the second stage reaction can be 95°C, and the time can be 10min. In the embodiment of the present invention, the cutting product liquid is obtained after the cutting reaction, and no further treatment is required, and it can be directly used later.

[0064] After obtaining the cleavage product liquid and the MB-HP1 suspension, the present invention mixes the cleavage product liquid, the MB-HP1 suspension and the hybridization buffer for hybridization reaction to obtain a hybridization product liquid. In the embodiment of the present invention, the hybridization buffer can be specifically 10× hybridization buffer (30mM MgCl2, 100mM (NH4)2SO4, 1MTris-HCl, pH=8.0); the volume ratio of the cleavage product liquid, the MB-HP1 suspension and the hybridization buffer can be 50:10:4. In the embodiment of the present invention, the temperature of the hybridization reaction can be room temperature, and the time can be 60min; during the hybridization reaction, the undigested m6A-RNA hybridizes with Fc-HP1 to form a DNA-RNA hybrid chain, and the obtained hybridization product liquid is specifically MB-HP1-m6A liquid. In the embodiment of the present invention, the hybridization product liquid is obtained after the hybridization reaction, and no other treatment is required, and it can be used directly later.

[0065] After obtaining the hybridization product solution, the present invention mixes the hybridization product solution, DSN and DSN main buffer for output treatment, and obtains the output DNA-Fc solution by magnetic separation. In the embodiment of the present invention, the DSN main buffer can be specifically 1×DSN main buffer (500mM Tris-HCl, 50mMMgCl2, 10mM DTT); the DSN is preferably used in the form of DSN solution; the volume ratio of the hybridization product solution, DSN solution and DSN main buffer can be 50:1.5:1.5; the activity of DSN during the output treatment can be 0.1U. In the embodiment of the present invention, the temperature of the output treatment can be 60°C and the time can be 40min; during the output treatment, DSN can specifically recognize and digest the DNA part of the DNA-RNA hybrid chain, and the output DNA is released. After the output treatment, in the embodiment of the present invention, a DSN stop solution can be added to the obtained system for denaturation treatment, and then the output DNA-Fc solution can be obtained by magnetic separation. In the embodiment of the present invention, the DSN stop solution can be specifically a 10 mM ethylenediaminetetraacetic acid (EDTA) solution; the volume ratio of the DSN stop solution to the DSN solution can be 2:1.5; the temperature of the denaturation treatment can be room temperature, and the time can be 1 to 2 hours, specifically 1.5 hours.

[0066] In the present invention, the preparation method of the four-arm tetrahedral DNA walker liquid comprises the following steps: dispersing four single sequences T1, T2, T3 and T4 in TM buffer for a first assembly, mixing the obtained liquid with HP2 solution for a second assembly, and obtaining the four-arm tetrahedral DNA walker liquid. The present invention prepares the four-arm tetrahedral DNA walker based on a rapid annealing process, which is described in detail below.

[0067] The present invention disperses four single sequences T1, T2, T3 and T4 in TM buffer for the first assembly. In the embodiment of the present invention, the TM buffer is specifically prepared by Tris-HCl (0.5M, pH=7.5) and MgSO4 (80mM); the molar ratio of T1, T2, T3 and T4 can be 1:1:1:1; the concentration of T1 in the TM buffer can be 100μM. In the embodiment of the present invention, the first assembly includes heating treatment and cooling treatment in sequence; the temperature of the heating treatment can be 95°C, and the insulation time can be 2min; the cooling treatment is specifically cooled to 4°C within 30s.

[0068] After the first assembly, the present invention mixes the obtained feed liquid with the HP2 solution for a second assembly to obtain the four-arm tetrahedral DNA walker feed liquid. In the embodiment of the present invention, the concentration of the HP2 solution can be 100 μM; the volume ratio of the TM buffer solution to the HP2 solution can be 6:1; the temperature of the second assembly can be 37°C, and the time can be 1 hour. After the second assembly in the embodiment of the present invention, the four-arm tetrahedral DNA walker feed liquid is obtained, and no other treatment is required, and it can be used directly later.

[0069] In the present invention, the nucleotide sequence of the H1 DNA probe in the H1 DNA probe solution with -SH is shown in SEQ ID NO.1, specifically TTTTTTGCCAACAT; the nucleotide sequence of the H1 DNA probe with -SH is specifically SH-(CH2)6-TTTTTTGCCAACAT.

[0070] In the present invention, the nucleotide sequence of HP1 in the Fc-HP1 is shown in SEQ ID NO.2, which is CCGACATCAGAGAGTAGTGAGTTATGTTGACGTTGTTGCTGTCCTTGCACA A, wherein the 12th bold G and the 13th bold A are the specific cleavage sites of the deoxyribozyme (ribonucleotide rA). During the reaction, when the four-arm tetrahedral DNA walker is activated, the three single strands of the four-arm tetrahedral DNA walker can complementarily pair with DNA-Fc. In the presence of metal ions Zn 2+ Under the action of, the rA site can be cut, resulting in the breakage of the DNA-Fc chain, thereby releasing ferrocene (Fc). In the present invention, the nucleotide sequence of the Fc-HP1 is specifically Fc-CCGACATCAGAGrAGTAGTGAGTTATGTTGACGTTGTTGCTGTCCTTGCA CAA-NH2, wherein Fc represents ferrocene.

[0071] In the present invention, the nucleotide sequence of T1 is as shown in SEQ ID NO.3, specifically GCTCACTACAAGCTGGCCGAGCCTTCTGATGTCGTACATTCCTAAGTCTGA AACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA.

[0072] In the present invention, the nucleotide sequence of T2 is shown in SEQ ID NO.4, specifically GCTCACTACAAGCTGGCCGAGCCTTCTGATGTCGTTATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC.

[0073] In the present invention, the nucleotide sequence of T3 is as shown in SEQ ID NO.5, specifically GCTCACTACAAGCTGGCCGAGCCTTCTGATGTCGTTCAACTGCCTGGTGATTAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC.

[0074] In the present invention, the nucleotide sequence of T4 is shown in SEQ ID NO.6, GCTCACTACAAGCTGGCCGAGCCTTCTGATGTCGTTTCAGACTTAGGAATTG CTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT.

[0075] In the present invention, the nucleotide sequence of HP2 is shown in SEQ ID NO.7, specifically TGAGCTCAACATCAGTCTGATAAGCTAGA.

[0076] The present invention provides a method for detecting m6A-RNA and m5C-RNA for non-disease diagnosis purposes using the kit described in the above technical solution, comprising the following steps:

[0077] Using a modified nanocomposite material dispersion to perform a first modification on the surface of a base electrode to obtain a first modified electrode;

[0078] Using a H1 DNA probe solution with -SH to perform a second modification on the surface of the first modified electrode to obtain a second modified electrode;

[0079] Performing a third modification on the surface of the second modified electrode using a hexanethiol solution to obtain a third modified electrode;

[0080] The output DNA-Fc solution is used to perform a fourth modification on the surface of the third modified electrode to obtain a fourth modified electrode; wherein the mA-RNA solution used in preparing the output DNA-Fc solution is the mA-RNA solution to be tested;

[0081] Performing a fifth modification on the surface of the fourth modified electrode using a m5C-RNA solution to be tested to obtain a fifth modified electrode;

[0082] Using a four-arm tetrahedral DNA walker liquid to perform a sixth modification on the surface of the fifth modified electrode to obtain a sixth modified electrode;

[0083] Performing a seventh modification on the surface of the sixth modified electrode using a zinc salt solution to obtain a biosensor;

[0084] The biosensor is used as a working electrode for electrochemiluminescence detection to obtain an electrochemiluminescence intensity, and the m6A-RNA concentration in the m6A-RNA solution to be tested and the m5C-RNA concentration in the m5C-RNA solution to be tested are calculated based on the electrochemiluminescence intensity and the m6A-RNA working curve and the m5C-RNA working curve.

[0085] The present invention first uses the kit described in the above technical solution to prepare a biosensor, and then realizes the detection of m6A-RNA and m5C-RNA through an electrochemiluminescence detection method based on the biosensor, which is described in detail below.

[0086] The present invention uses a modified nanocomposite dispersion to perform a first modification on the surface of a substrate electrode to obtain a first modified electrode. In the embodiment of the present invention, the substrate electrode may be a glassy carbon electrode (GCE, Φ=3 mm); the surface of the substrate electrode is preferably polished with an alumina slurry before use, and ultrasonically cleaned with acetone, ethanol and ultrapure water in sequence. In the embodiment of the present invention, the modified nanocomposite dispersion is specifically added dropwise to the surface of the substrate electrode for the first modification; the volume of the modified nanocomposite dispersion may be 10 μL; the temperature of the first modification may be room temperature, and the time may be 2 hours; after the first modification, a uniform modified film is formed on the surface of the substrate electrode to obtain the first modified electrode.

[0087] After obtaining the first modified electrode, the present invention uses the H1 DNA probe solution with -SH to perform a second modification on the surface of the first modified electrode to obtain the second modified electrode. In the embodiment of the present invention, the H1 DNA probe solution with -SH is specifically added dropwise to the surface of the first modified electrode for the second modification; the volume of the H1 DNA probe solution with -SH can be 10 μL; the temperature of the second modification can be 37° C., and the time can be 2 hours.

[0088] After obtaining the second modified electrode, the present invention uses hexanethiol (HT) solution to perform a third modification on the surface of the second modified electrode to obtain a third modified electrode. In the embodiment of the present invention, the second modified electrode is immersed in the HT solution for the third modification; the temperature of the third modification can be 37° C. and the time can be 30 minutes.

[0089] After obtaining the third modified electrode, the present invention uses the output DNA-Fc feed solution to perform a fourth modification on the surface of the third modified electrode to obtain a fourth modified electrode; wherein the m6A-RNA solution used when preparing the output DNA-Fc feed solution is the m6A-RNA solution to be tested. In the embodiment of the present invention, the output DNA-Fc feed solution is specifically added dropwise to the surface of the third modified electrode for the fourth modification; the volume of the output DNA-Fc feed solution can be 10 μL; the temperature of the fourth modification can be room temperature, and the time can be 1 hour.

[0090] After obtaining the fourth modified electrode, the present invention uses the m5C-RNA solution to be tested to perform the fifth modification on the surface of the fourth modified electrode to obtain the fifth modified electrode. In the embodiment of the present invention, the m5C-RNA solution to be tested is specifically added dropwise to the surface of the fourth modified electrode for the fifth modification; the volume of the m5C-RNA solution to be tested can be 10 μL. In the embodiment of the present invention, the feasibility of the scheme of the present invention is specifically verified with an m5C-RNA solution with a concentration of 10fM to 100nM, and the concentration of the m5C-RNA solution can be specifically 10fM, 100fM, 1pM, 10pM, 100pM, 1nM, 10nM or 100nM. In the embodiment of the present invention, the temperature of the fifth modification can be 37°C and the time can be 2h.

[0091] After obtaining the fifth modified electrode, the present invention uses a four-arm tetrahedral DNA walker liquid to perform a sixth modification on the surface of the fifth modified electrode to obtain a sixth modified electrode. In the embodiment of the present invention, the four-arm tetrahedral DNA walker liquid is specifically added dropwise to the surface of the fifth modified electrode for the sixth modification; the volume of the four-arm tetrahedral DNA walker liquid can be 10 μL; the temperature of the sixth modification can be room temperature, and the time can be 2 hours.

[0092] After obtaining the sixth modified electrode, the present invention uses a zinc salt solution to perform a seventh modification on the surface of the sixth modified electrode to obtain a biosensor. In the embodiment of the present invention, the zinc salt solution is specifically added dropwise to the surface of the sixth modified electrode for the seventh modification; the volume of the zinc salt solution can be 10 μL; the temperature of the seventh modification can be room temperature, and the time can be 30 minutes.

[0093] After obtaining the biosensor, the present invention uses the biosensor as a working electrode to perform electrochemiluminescence detection to obtain the electrochemiluminescence intensity, and calculates the m6A-RNA concentration in the m6A-RNA solution to be tested and the m5C-RNA concentration in the m5C-RNA solution to be tested based on the electrochemiluminescence intensity and the m6A-RNA working curve and the m5C-RNA working curve. In an embodiment of the present invention, the electrochemiluminescence detection can be performed in a PBS buffer solution containing K2S2O8, wherein the concentration of K2S2O8 can be 100mM, the concentration of the PBS buffer solution can be 0.1M, and the pH value can be 7.4; the conditions for the electrochemiluminescence detection can include: a scanning rate of 300mV -1 , the scanning potential was -1 to 1.2 V, and the voltage of the photomultiplier tube used was 800 V.

[0094] The m6A-RNA working curve of the present invention is specifically a linear regression equation between the electrochemiluminescence intensity and the logarithmic value of the m6A-RNA concentration, wherein the electrochemiluminescence intensity is the ordinate and the logarithmic value of the m6A-RNA concentration is the abscissa; the method for obtaining the electrochemiluminescence intensity corresponding to the m6A-RNA working curve is consistent with the method for detecting m6A-RNA in the above technical solution, except that the m6A-RNA solution to be tested is replaced with a standard solution of known m6A-RNA concentration. In the embodiment of the present invention, the test was conducted under the conditions that the m6A-RNA concentrations were 10fM, 100fM, 1pM, 10pM, 100pM, 1nM, 10nM and 100nM, respectively, and the linear regression equation was ΔI1=984.049lgC m6A +19351.57, correlation coefficient (R 2 ) is 0.9934, and LOD is 21.3aM (S / N=3).

[0095] The m5C-RNA working curve of the present invention is specifically a linear regression equation between the electrochemiluminescence intensity and the logarithmic value of the m5C-RNA concentration, wherein the electrochemiluminescence intensity is the ordinate and the logarithmic value of the m5C-RNA concentration is the abscissa; the method for obtaining the electrochemiluminescence intensity corresponding to the m5C-RNA working curve is consistent with the method for detecting m5C-RNA in the above-mentioned technical scheme, except that the m5C-RNA solution to be tested is replaced with a standard solution of known m5C-RNA concentration. In the embodiment of the present invention, the test was conducted under the conditions of m5C-RNA concentrations of 10fM, 100fM, 1pM, 10pM, 100pM, 1nM, 10nM and 100nM, respectively, and the linear regression equation was ΔI2=910.606lgC m5C +14031.372, correlation coefficient (R 2 ) is 0.9903, and LOD is 2.08fM (S / N=3).

[0096] The nucleotide sequence of the m6A-RNA in the embodiment of the present invention is to replace the 11th bold A in the sequence shown in SEQ ID NO.8 with i6MedA, wherein i6MedA specifically refers to m6A, i.e. N6 methyladenine, indicating methylation on the 6th nitrogen atom of the adenine (A) base; the SEQ ID NO.8 is specifically UUGUGCAAGGACAGCAACAAC. In the present invention, the nucleotide sequence of the m6A-RNA is specifically UUGUGCAAGG / i6MedA / CAGCAACAAC.

[0097] The nucleotide sequence of the m5C-RNA in the embodiment of the present invention is that the bold C at position 9 of the sequence shown in SEQ ID NO.9 is replaced with i5MedC, wherein i5MedC specifically refers to m5C, i.e., 5-methylcytosine, indicating methylation at the 5th carbon atom of the cytosine (C) base; the SEQ ID NO.9 is specifically UAGCUUAUCAGACUGAUGUUGA. In the present invention, the nucleotide sequence of the m5C-RNA is specifically UAGCUUAU / i5MedC / AGACUGAUGUUGA.

[0098] All sequences in the present invention were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0099] Figure 1 The flowchart of preparing the biosensor in the embodiment of the present invention, wherein A is a flowchart of preparing the output DNA-Fc, B is a flowchart of preparing the biosensor, and C is a flowchart of preparing the four-arm tetrahedral DNA walker. The method for ultrasensitive detection of m6A-RNA and m5C-RNA provided by the present invention mainly adopts MazF-mediated cleavage reaction to output burst probes through DSN enzyme-assisted amplification to achieve m6A-RNA quantitative analysis; at the same time, the activity of the four-arm tetrahedral DNA walker can be regulated by the strand displacement reaction triggered by m5C-RNA to achieve the target m5C-RNA quantitative detection. Specifically, the present invention uses MazF-mediated cleavage reaction to distinguish m6A-RNA from m6ARNA-free sites, and through DSN-assisted amplification, the unseparated m6A-RNA (target 1) is effectively converted into Fc-DNA to achieve the signal-off state. Subsequently, m5C-RNA (target 2) is added, and anti-m5C recognizes the target target 5mC-RNA. Then, the closed four-arm tetrahedral DNA walker was introduced to make HP2 hybridize with m5C-RNA and activate the four-arm tetrahedral DNA walker. 2+In the presence of, the quenching probe DNA-Fc is continuously cleaved to achieve signal recovery, forming an ECL reaction with the signal "on". The test example results of the present invention demonstrate the effectiveness of the "on-off-on" ECL biosensor, which can quantitatively detect m6A-RNA and m5C-RNA, wherein the detection limit of m6A-RNA is 21.3aM, and the detection limit of m5C-RNA is 2.08fM. The present invention provides a new method for the simultaneous detection of epigenetic modified bases in RNA, and has broad application prospects in the early diagnosis of cancer or other diseases related to epigenetic modifications.

[0100] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0101] Example 1

[0102] (1) Preparation of Ru(bpy)3 2+ @PtNPs@Nafion@AuNPs-Ab-BSA dispersion

[0103] 1 mL of 0.3 M 3-thiophenemalonic acid (TA) solution was added to 100 mL of 0.75 mM H2PtCl6 solution, and the resulting yellow mixed solution was heated to 100 °C under stirring conditions and maintained for 20 min to obtain a dark brown PtNPs colloidal solution; 2 mL of 0.03 M tris(2,2′-bipyridyl)ruthenium(II) chloride hexahydrate (Ru(bpy)3 2+ ) aqueous solution was added to the PtNPs colloidal solution, and a large number of black aggregates appeared and precipitated; 200 μL of 24.28 mM HAuCl4 solution and 1 mL of 10 mM trisodium citrate solution were added to the obtained mixed system, and the obtained mixed system was heated to 80°C, and then 80 μL of 1 wt% NaBH4 solution was added, and kept at 80°C for 20 min to obtain AuNPs@Ru(bpy)3 2+ @PtNPs dispersion; then add 1mL of 5wt% Nafion solution under stirring to obtain Ru(bpy)3 2+ @PtNPs@Nafion@AuNPs dispersion;

[0104] Under stirring conditions, the Ru(bpy)3 2+0.5 mL of activator was added to the @PtNPs@Nafion@AuNPs dispersion, wherein the activator was a mixture of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) in a molar ratio of 4:1, and kept at 37°C for 2 h; then 400 μL of 1 mg / mL anti-m5C antibody (Ab) solution was added dropwise, and 100 μL of 0.5 wt% bovine serum albumin (BSA) solution was added, and kept at 4°C for 2 h to eliminate nonspecific binding, to obtain Ru(bpy)3 2+ @PtNPs@Nafion@AuNPs-Ab-BSA dispersion was stored at 4 °C for further use.

[0105] (2) MazF-mediated cleavage and hybridization reactions

[0106] To 1 mL of 5 mg / mL magnetic bead (MB) suspension, 40 μL of 0.2 M EDC solution was added, and the mixture was stirred at 37°C for 30 min to activate the MB to obtain an activated MB suspension; then 40 μL of 0.05 M NHS solution and 50 μL of 1 μM hairpin probe HP1 (Fc-HP1, the nucleotide sequence of HP1 is shown in SEQ ID NO. 2) solution were added, and the mixture was shaken at 4°C for 12 h to obtain an MB-HP1 suspension;

[0107] 1×MazF reaction buffer (0.01wt% Tween-20, 40mMNa3(PO4)2, pH=7.5; 10μL), 5UMazF, 20U RNase inhibitor and different concentrations (10fM, 100fM, 1pM, 10pM, 100pM, 1nM, 10nM, 100nM) of mA-RNA solution (10μL) were mixed, incubated at 37°C for 40min, and then denatured at 95°C for 10min to obtain a cleavage product solution;

[0108] 10 μL of the MB-HP1 suspension and 4 μL of 10× hybridization buffer (30 mM MgCl2, 100 mM (NH4)2SO4, 1 M Tris-HCl, pH = 8.0) were added to 50 μL of the cleavage product solution and incubated at room temperature for 60 min. During the incubation process, the undigested mA-RNA hybridized with the hairpin probe HP1 to form a DNA-RNA hybrid chain to obtain MB-HP1-m6A solution.

[0109] (3) Double-stranded specific nuclease (DSN) assisted detection of m6A-RNA

[0110] 1.5 μL DSN (0.1U) solution and 1.5 μL 1×DSN main buffer (500 mM Tris-HCl, 50 mM MgCl2, 10 mM DTT) were added to 50 μL of the MB-HP1-m6A solution prepared in step (2), and the reaction was carried out at 60°C for 40 min. During the reaction, DSN can specifically recognize and digest the DNA portion of the DNA-RNA hybrid chain, and the output DNA is released. Then 2 μL DSN stop solution (10 mM EDTA) was added, and the reaction was carried out at room temperature for 1.5 h to denature DSN, and then the output DNA-Fc (output-DNA) solution was obtained by magnetic separation.

[0111] (4) Assembly of the four-arm tetrahedral DNA walker

[0112] A four-arm tetrahedral DNA walker was prepared by a rapid annealing process. Specifically, four single sequences T1 (SEQ ID NO.3), T2 (SEQ ID NO.4), T3 (SEQ ID NO.5) and T4 (SEQ ID NO.6) were dispersed in TM buffer (0.5M Tris-HCl (pH=7.5), 80mM MgSO4, 6μL) in an equimolar ratio, where the concentration of T1 was 100μM. The resulting mixed solution was heated to 95°C and maintained for 2 minutes, and then cooled to 4°C within 30 seconds. The resulting cooled solution was mixed with 1μL of 100μM HP2 (SEQ ID NO.7) solution and maintained at 37°C for 1 hour to obtain a four-arm tetrahedral DNA walker solution.

[0113] (5) Preparation of ECL biosensor

[0114] The surface of the glassy carbon electrode (GCE, Φ = 3 mm) was polished with alumina slurry and ultrasonically cleaned with acetone, ethanol and ultrapure water in sequence to obtain a pretreated GCE; 10 μL of the Ru(bpy)3 prepared in step (1) was added to 2+ The dispersion of @PtNPs@Nafion@AuNPs-Ab-BSA was added dropwise to the transparent pretreated GCE surface and allowed to stand for 2 h at room temperature to form a uniform modified film. The first modified electrode (Ru(bpy)3 2+@PtNPs@Nafion@AuNPs-Ab-BSA / GCE); 10 μL of a 1 μM H1 DNA probe (the nucleotide sequence of the H1 DNA probe is shown in SEQ ID NO.1) solution with -SH was added dropwise to the surface of the first modified electrode and incubated at 37°C for 2 h to obtain a second modified electrode; 10 μL of a 10 mM hexanethiol (HT) solution was added dropwise to the surface of the second modified electrode and treated at 37°C for 30 min to obtain a third modified electrode;

[0115] 10 μL of the output DNA-Fc solution prepared in step (3) was added dropwise to the surface of the third modified electrode, and incubated at room temperature for 1 h to achieve hybridization with H1, thereby obtaining a fourth modified electrode; 10 μL of m5C-RNA solutions of different concentrations (10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM, 100 nM) were added dropwise to the surface of the fourth modified electrode, and incubated at 37° C. for 2 h (to facilitate selective identification of m5C-RNA by anti-m5C antibodies), thereby obtaining a fifth modified electrode;

[0116] 10 μL of the four-arm tetrahedral DNA walker prepared in step (4) was added dropwise to the surface of the fifth modified electrode, and incubated at room temperature for 2 h to obtain the sixth modified electrode; 10 μL of 1 mM zinc chloride solution was added dropwise to the surface of the sixth modified electrode, and incubated at room temperature for 30 min to obtain an ECL biosensor; by modifying the four-arm tetrahedral DNA walker and Zn 2+ HP2 on the four-arm tetrahedral DNA walker hybridizes with the target m5C-RNA to replace the activated four-arm tetrahedral DNA walker, which then walks around the output DNA-Fc track and interacts with Zn 2+ The dependent DNA enzyme forms a catalytic domain, which enables the output DNA-Fc to be efficiently cleaved and release ferrocene (Fc).

[0117] Test Example 1

[0118] Figure 2 Ru(bpy)3 2+ @PtNPs@Nafion@AuNPs scanning electron microscopy images, the results show that platinum nanoparticles (PtNPs) in Ru(bpy)3 2+ The distribution on the formed film layer is consistent, maintaining the same shape and size.

[0119] Figure 3 Ru(bpy)3 2+Transmission electron micrograph of @PtNPs@Nafion@AuNPs, where the nanoparticles on the left correspond to AuNPs, which are highly dispersed in the Nafion membrane with a particle size of 15nm; the nanoparticles on the right correspond to PtNPs, which are smaller in size, about 3nm, and have no obvious aggregation, indicating that Nafion is a very effective dispersant.

[0120] Figure 4 Ru(bpy)3 2+ EDX element mapping diagram of @PtNPs@Nafion@AuNPs, where A is the merge map, B is the Au map, C is the Pt map, and D is the Ru map; the results show that Ru, Pt and Au are in Ru(bpy)3 2+ @PtNPs@Nafion@AuNPs, which proves that Ru(bpy)3 2+ , the presence of AuNPs and PtNPs.

[0121] Test Example 2

[0122] Ru(bpy)3 2+ @PtNPs@Nafion@AuNPs performance test, the specific steps are as follows:

[0123] The surface of the glassy carbon electrode (GCE, Φ = 3 mm) was polished with alumina slurry and ultrasonically cleaned with acetone, ethanol and ultrapure water in sequence to obtain a pretreated GCE; 10 μL of the Ru(bpy)3 prepared in step (1) of Example 1 was added to 2+ @PtNPs@Nafion@AuNPs-Ab-BSA dispersion and 10 μL of Ru(bpy)3 2+ The solution dispersion was added dropwise onto the transparent pretreated GCE surface and allowed to stand for 2 h at room temperature to form a uniform modified film to obtain the modified electrode, namely Ru(bpy)3 2+ @PtNPs@Nafion@AuNPs-Ab-BSA / GCE and Ru(bpy)3 2+ / GCE, and a blank electrode (GCE) without any substance added was used as a control. Then, the ECL intensity of the ECL biosensor was measured in a PBS buffer solution with a concentration of 0.1 M and a pH value of 7.4 containing 100 mM K2S2O8. Specifically, the ECL intensity was measured at 300 mV -1 The potential was scanned from -1 V to 1.2 V at a scan rate of 1.5 , and the voltage of the photomultiplier tube was set to 800 V.

[0124] Figure 5The ECL intensity-potential curves show that the ECL intensity of blank GCE (curve a) is almost non-existent in PBS buffer, but in Ru(bpy)3 2+ / GCE (curve b) reaches an intensity of 9.1k. Surprisingly, Ru(bpy)3 2+ The ECL intensity of @PtNPs@Nafion@AuNPs / GCE (curve c) is 17.9k, which is approximately 2+ twice as strong. In addition, Figure 5 As can be seen from the illustration, Ru(bpy)3 2+ @PtNPs@Nafion@AuNPs / GCE and Ru(bpy)3 2+ / GCE onset potentials are 1.06 V and 0.89 V, respectively, indicating that in Ru(bpy)3 2+ The ECL reaction is more likely to occur in the @PtNPs@Nafion@AuNPs ternary system.

[0125] Test Example 3

[0126] The ECL intensity of the ECL biosensor was measured in a PBS buffer solution containing 100 mM K2S2O8 at a concentration of 0.1 M and a pH of 7.4. -1 The potential was scanned from -1 V to 1.2 V at a scan rate of 1.5 , and the voltage of the photomultiplier tube was set to 800 V.

[0127] Figure 6 The following is a graph showing the detection results of the ECL biosensor under different concentrations of m6A-RNA and m5C-RNA.

[0128] Figure 6 A in the figure is the ECL curve of the ECL biosensor when the concentration of m6A-RNA is 10fM, 100fM, 1pM, 10pM, 100pM, 1nM, 10nM and 100nM (from a to h), and the results show the logarithm of the ECL signal and the concentration of the target m6A-RNA (logC m6A ), and the ECL intensity decreased with the increase of m6A-RNA concentration; Figure 6 B is the linear relationship between the ECL signal intensity and the logarithmic value of different concentrations of m6A-RNA (n = 3), and the results show that the linear regression equation is ΔI1 = 984.049lgC m6A +19351.57, correlation coefficient (R 2) is 0.9934, and LOD is 21.3aM (S / N=3). The ECL response decrease value of ΔI1 corresponding to m6A-RNA can be expressed by the formula ΔI1=Ion1-I1, where Ion1 represents Ru(bpy)3 2+ ECL response of @PtNPs@Nafion@AuNPs (17142 a.u.), I1 is the quenched ECL signal converted into output-DNA using different concentrations of m6A-RNA.

[0129] Figure 6 C in the figure is the ECL curve of the ECL biosensor when the m5C-RNA concentration is 10fM, 100fM, 1pM, 10pM, 100pM, 1nM, 10nM and 100nM (from a to h). The results show that the ECL signal increases significantly with the increase of m5C-RNA concentration, which is attributed to the activated four-arm tetrahedral DNA walker; Figure 6 D is the linear relationship between the ECL signal intensity and the logarithmic value of m5C-RNA at different concentrations (n=3). The results show that the linear regression equation is ΔI2=910.606lgC m5C +14031.372, correlation coefficient (R 2 ) is 0.9903, and LOD is 2.08fM (S / N=3). The m5C-RNA concentration corresponding to the ECL intensity can be expressed by the formula ΔI2=Ion2-Ioff, where Ion2 represents the ECL signal after Fc cleavage, and Ioff is the response of the lowest quenched ECL signal value (3545a.u.).

[0130] Figure 7 The specificity and stability test results of ECL biosensor for m6A-RNA and m5C-RNA are shown below. Figure 7 The M1, M2, M3, Mx, T1, T2, T3 and Tx involved are explained.

[0131] The M1 (one-mismatched m6A-RNA) is obtained by replacing the 11th bold A in the sequence shown in SEQ ID NO.10 with i6MedA, and the specific SEQ ID NO.10 is AUGUGCAAGGACAGCAACAAC.

[0132] The M2 (two-mismatched m6A-RNA) is obtained by replacing the 11th bold A in the sequence shown in SEQ ID NO.11 with i6MedA, and the specific SEQ ID NO.11 is AUGUGCAGGGACAGCAACAAC.

[0133] The M3 (whole-mismatched m6A-RNA) is obtained by replacing the 11th bold A in the sequence shown in SEQ ID NO.12 with i6MedA, and the specific SEQ ID NO.12 is GAAUAGUUCAAUCCGAGCCUU.

[0134] The nucleotide sequence of the Mx (non-m6A-RNA) is shown in SEQ ID NO.8.

[0135] The T1 (one-mismatchaedm5C-RNA) is obtained by replacing the 9th bold C in the sequence shown in SEQ ID NO.13 with i5MedC, and the specific SEQ ID NO.13 is UAGUUUAUCAGACUGAUGUUGA.

[0136] The T2 (two-mismatchaedm5C-RNA) is obtained by replacing the 9th bold C in the sequence shown in SEQ ID NO.14 with i5MedC, and the specific SEQ ID NO.14 is UAGUUUAUCACACUGAUGUUGA.

[0137] The T3 (whole-mismatchaedm5C-RNA) is obtained by replacing the 9th bold C in the sequence shown in SEQ ID NO.15 with i5MedC, and the specific SEQ ID NO.15 is UUUGUAAGCUCGCAGUGCAAGG.

[0138] The nucleotide sequence of the Tx (non-m5C-RNA) is shown in SEQ ID NO.9.

[0139] Figure 7 Figure A is the specific detection result of ECL biosensor for mA-RNA, where "mixture" refers to a mixture of 10pM M1, 10pM M2, 10pM M3, 10pM Mx and 10pM mA-RNA; the results show that the ECL intensity of the target sequence mA-RNA and the mixed sequence is much lower than that of other interfering sequences, confirming the specificity of ECL biosensor for mA-RNA detection. Figure 7Figure B is the specific detection result of ECL biosensor for m5C-RNA, where "mixture" refers to a mixture of 10pM T1, 10pM T2, 10pM T3, 10pM Tx and 10pM m5C-RNA; the results show that the specificity of m5C-RNA detection is verified using one mismatched RNA sequence, two mismatched RNA sequences, the entire mismatched RNA sequence, m6A-RNA sequence and blank samples, indicating that a mixture containing m5C-RNA target sequence and m5C-RNA can produce a strong ECL reaction. The above results show that the ECL biosensor has satisfactory selectivity for both m6A-RNA and m5C-RNA.

[0140] Figure 7 Figure C is the stability test result of ECL biosensor for m6A-RNA. The results show that consistent and stable ECL signals were observed in six consecutive cycles of scanning, among which m6A-RNA at concentrations of 10nM and 10pM both showed stable ECL responses with RSDs of 2.51% and 2.61%, respectively. Figure 7 Figure D is the stability test result of the ECL biosensor for m5C-RNA. The results show that m5C-RNA at concentrations of 100nM and 100pM can also remain stable, with RSD values ​​of 1.55% and 4.25%, respectively. The above results prove that the ECL biosensor constructed by the present invention has excellent stability.

[0141] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A nanocomposite dispersion comprising tris-(2,2′-bipyridine)ruthenium, platinum nanoparticles, gold nanoparticles, perfluorosulfonic acid polytetrafluoroethylene copolymer and water.

2. The nanocomposite dispersion according to claim 1, characterized in that: The particle size of the platinum nanoparticles is 2-5 nm; the particle size of the gold nanoparticles is 15-20 nm.

3. The method for preparing the nanocomposite dispersion according to claim 1 or 2, comprising the following steps: The H2PtCl6 solution is subjected to a first reduction reaction in the presence of 3-thiophenemalonic acid to generate platinum nanoparticles, thereby obtaining a first reduction product solution; The first reduction product solution is mixed with a tri-(2,2′-bipyridine)ruthenium solution, the obtained mixture is mixed with a HAuCl4 solution, a trisodium citrate solution and a NaBH4 solution, and a second reduction reaction is performed to generate gold nanoparticles to obtain a second reduction product solution; The second reduction product solution is mixed with the Nafion solution to obtain the nanocomposite material dispersion.

4. A kit for detecting m6A-RNA and m5C-RNA, comprising a modified nanocomposite dispersion, an H1 DNA probe solution with -SH, a hexanethiol solution, an output DNA-Fc solution, a four-arm tetrahedral DNA walker solution, and a zinc salt solution; The modified nanocomposite dispersion is obtained by modifying anti-m5C antibody and bovine serum albumin after activation treatment of the nanocomposite dispersion, and the nanocomposite dispersion is the nanocomposite dispersion according to claim 1 or 2 or the nanocomposite dispersion prepared by the preparation method according to claim 3; The method for preparing the output DNA-Fc feed solution comprises the following steps: The MB suspension is activated and then modified with Fc-HP1 to obtain an MB-HP1 suspension; the m6A-RNA solution, MazF, RNase inhibitor and MazF reaction buffer are mixed to perform a cleavage reaction to obtain a cleavage product solution; the cleavage product solution, the MB-HP1 suspension and a hybridization buffer are mixed to perform a hybridization reaction to obtain a hybridization product solution; the hybridization product solution, DSN and a DSN main buffer are mixed to perform an output process, and the output DNA-Fc solution is obtained by magnetic separation; The preparation method of the four-arm tetrahedron DNA walker liquid comprises the following steps: dispersing four single sequences T1, T2, T3 and T4 in TM buffer for a first assembly, mixing the obtained liquid with HP2 solution for a second assembly, and obtaining the four-arm tetrahedron DNA walker liquid; The nucleotide sequence of the H1 DNA probe in the H1 DNA probe solution with -SH is shown in SEQ ID NO.1; The nucleotide sequence of HP1 in the Fc-HP1 is shown in SEQ ID NO.2; The nucleotide sequence of T1 is shown in SEQ ID NO.3; The nucleotide sequence of T2 is shown in SEQ ID NO.4; The nucleotide sequence of T3 is shown in SEQ ID NO.5; The nucleotide sequence of T4 is shown in SEQ ID NO.6; The nucleotide sequence of HP2 is shown in SEQ ID NO.

7.

5. The kit according to claim 4, characterized in that The molar ratio of T1, T2, T3 and T4 is 1:1:1:

1.

6. A method for detecting m6A-RNA and m5C-RNA for non-disease diagnosis purposes using the kit according to claim 4 or 5, comprising the following steps: Using a modified nanocomposite material dispersion to perform a first modification on the surface of a base electrode to obtain a first modified electrode; Using a H1 DNA probe solution with -SH to perform a second modification on the surface of the first modified electrode to obtain a second modified electrode; Performing a third modification on the surface of the second modified electrode using a hexanethiol solution to obtain a third modified electrode; The output DNA-Fc solution is used to perform a fourth modification on the surface of the third modified electrode to obtain a fourth modified electrode; wherein the mA-RNA solution used in preparing the output DNA-Fc solution is the mA-RNA solution to be tested; Performing a fifth modification on the surface of the fourth modified electrode using a m5C-RNA solution to be tested to obtain a fifth modified electrode; Performing a sixth modification on the surface of the fifth modified electrode using a four-arm tetrahedral DNA walker solution to obtain a sixth modified electrode; Performing a seventh modification on the surface of the sixth modified electrode using a zinc salt solution to obtain a biosensor; The biosensor is used as a working electrode for electrochemiluminescence detection to obtain an electrochemiluminescence intensity, and the m6A-RNA concentration in the m6A-RNA solution to be tested and the m5C-RNA concentration in the m5C-RNA solution to be tested are calculated based on the electrochemiluminescence intensity and the m6A-RNA working curve and the m5C-RNA working curve.

7. The method according to claim 6, characterized in that The substrate electrode is a glassy carbon electrode.

8. The method according to claim 6, characterized in that The electrochemiluminescence detection was carried out in a PBS buffer solution containing K2S2O8.

9. The method according to claim 8, characterized in that The concentration of K2S2O8 in the PBS buffer solution is 50-120 mM.

10. The method according to claim 6, characterized in that The conditions for the electrochemiluminescence detection include: a scan rate of 250 to 350 mV -1 , the scanning potential is -1~1.2V, and the voltage of the photomultiplier tube is 800V.

Images