T7 RNA polymerase mutant with improved thermal stability and transcription performance for preparing mRNA vaccines and preparation method thereof

Abstract

The present application discloses a T7 RNA polymerase mutant with improved thermostability and transcription performance that can be used to prepare an mRNA vaccine and a preparation method thereof, and relates to the field of biotechnology. The present invention specifically discloses a T7 RNA polymerase mutant containing mutation sites K8G, H27K, A70N, K180D, and S192P / S192G relative to the wild-type T7 RNA polymerase; the amino acid sequence of the wild-type T7 RNA polymerase is shown in SEQ ID NO: 1. Compared with the wild-type T7 RNA polymerase, it has higher specific enzyme activity and thermal stability, wherein one mutant has improved heat resistance, and a large amount of transcription products can still be obtained at 45°C, and the transcription byproducts of another mutant are reduced. The mutant T7 RNA polymerase disclosed in the present invention has good application prospects in the fields of RNA vaccines and drugs, in vitro transcription, gene editing, etc.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to T7 RNA polymerase mutants with improved thermal stability and transcription performance that can be used to prepare mRNA vaccines and methods for preparing the same. Background Art

[0002] As a new vaccine platform, mRNA vaccines have been applied in the fields of COVID-19 vaccines due to their rapid design, flexible production and significant immune response. However, the industrial production of mRNA still faces many challenges, especially in terms of transcription efficiency, thermal stability and control of transcription byproducts, which directly affect the yield, quality and production cost of mRNA.

[0003] T7 RNA polymerase is the core enzyme for in vitro transcription of mRNA. However, the enzyme activity of traditional T7 RNA polymerase is low at high temperatures, resulting in decreased transcription efficiency. In addition, the in vitro transcription reaction of T7 RNA is often accompanied by the generation of byproducts, which affects the purity and yield of mRNA. In order to overcome these problems, many researchers have modified T7 RNA polymerase through mutations, aiming to improve its thermal stability and enzyme activity and reduce the generation of byproducts.

[0004] For example, CN202210456084.4 discloses a T7 RNA polymerase mutant with high transcriptional activity and its application. Mass spectrometry identification of the siRNA yield and purity of wild-type T7 RNA polymerase and mutant T7 RNA polymerase found that the product of the mutant T7 RNA polymerase had no other impurities, high purity, and a concentration of up to 6.2e4. However, the enzyme activity and specific enzyme activity of the mutant were not disclosed.

[0005] For example, the T7-RNA polymerase mutant with enhanced thermal stability disclosed in CN202211498759.8 still retains strong transcription activity at 45°C and can be used for RNA production under higher temperature conditions. However, the enzyme activity and specific enzyme activity of the mutant are not disclosed.

[0006] The information disclosed in the background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0007] In response to the above-mentioned technical problems, the present application provides a T7 RNA polymerase mutant with improved thermal stability and transcription performance that can be used to prepare mRNA vaccines and a preparation method thereof. The mutant has higher heat resistance or lower by-products when conducting in vitro transcription experiments, and has higher specific enzyme activity than the wild-type T7 RNA polymerase.

[0008] The invention also provides a recombinant protein.

[0009] The present invention also provides biological materials related to the T7 RNA polymerase mutant or recombinant protein.

[0010] The invention also provides an enzyme preparation.

[0011] The present invention also provides a method for preparing the T7 RNA polymerase mutant.

[0012] The present invention also provides a method for transcribing RNA molecules in vitro.

[0013] The present invention also provides applications related to the T7 RNA polymerase mutant, recombinant protein, biological material or enzyme preparation.

[0014] The present invention also provides a kit for preparing mRNA or RNA drug-related products.

[0015] According to a first aspect of the present invention, a T7 RNA polymerase mutant comprises A1) and / or A2) mutation sites compared to wild-type T7 RNA polymerase:

[0016] A1), K8G, H27K, A70N, S192P;

[0017] A2), K8G, H27K, K180D, S192G;

[0018] The amino acid sequence of the wild-type T7 RNA polymerase is shown in SEQ ID NO:1.

[0019] The T7 RNA polymerase mutant according to the embodiment of the present invention has at least the following beneficial effects:

[0020] Compared with the wild-type T7 RNA polymerase, the T7 RNA polymerase mutant of the embodiment has a higher specific enzyme activity, which is 1.8 to 2.0 times that of the wild-type T7 RNA polymerase; the thermal stability is higher, and the Tm value (melting temperature) detected by differential scanning fluorescence (DSF) is higher than that of the wild type; in the transcription experiment, one of the mutants has improved heat resistance, and a large amount of transcription products can still be obtained at 45°C, while the byproduct (dsRNA) produced by the other mutant is significantly reduced. It has a good application prospect in the preparation of mRNA vaccines or RNA drug-related products.

[0021] According to some embodiments of the present invention, the amino acid sequence of the T7 RNA polymerase mutant is shown in SEQ ID NO:3 or SEQ ID NO:5.

[0022] A recombinant protein according to an embodiment of the second aspect of the present invention comprises a tag and the T7 RNA polymerase mutant described in an embodiment of the first aspect of the present invention.

[0023] According to some embodiments of the present invention, the tag is connected to the middle and / or N-terminus and / or C-terminus of the T7 RNA polymerase mutant.

[0024] According to some embodiments of the present invention, the tag sequence includes at least one of the tag sequences that facilitate the dissolution, purification and detection of the T7 RNA polymerase mutant. It is understandable that the T7 RNA polymerase mutant of the present invention may include one or more tag sequences; multiple tag sequences may include a combination of multiple identical tag sequences, or a combination of multiple different tag sequences. For example: tags that facilitate the dissolution of the T7 RNA polymerase mutant include but are not limited to nus tag sequences or maltose binding protein tag sequences; tags that facilitate the purification of the T7 RNA polymerase mutant include but are not limited to strep tag sequences, His tag sequences, GST tag sequences, pelB signal tag sequences or ompA signal tag sequences; tags that facilitate the detection of T7 RNA polymerase mutants include but are not limited to horseradish peroxidase (HRP) tag sequences, β-galactosidase tag sequences, luciferase tag sequences, green fluorescent protein (GFP) tag sequences, HcRed tag sequences, DsRed tag sequences or cyan fluorescent protein (CFP) tag sequences. The tag can specifically be a His tag sequence.

[0025] According to the third aspect of the present invention, the biological material related to the T7 RNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention is any one of B1) to B4):

[0026] B1), a nucleic acid molecule encoding the T7 RNA polymerase mutant described in the embodiment of the first aspect of the present invention or the recombinant protein described in the embodiment of the second aspect of the present invention;

[0027] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0028] B3), a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2);

[0029] B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

[0030] According to some embodiments of the present invention, the nucleic acid molecule has any one of B11) to B14):

[0031] B11), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO:4;

[0032] B12), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 6;

[0033] B13), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in B11) or B12), and encoding the T7 RNA polymerase mutant;

[0034] B14), a DNA molecule that hybridizes with the nucleotide sequence defined in any one of B11) to B13) under stringent conditions and encodes the T7 RNA polymerase mutant.

[0035] According to some embodiments of the present invention, the stringent conditions can be hybridization in a 2×SSC, 0.1% SDS solution at 68°C and washing the membrane twice, each time for 5 min; or hybridization in a 0.5×SSC, 0.1% SDS solution at 68°C and washing the membrane twice, each time for 15 min.

[0036] According to some embodiments of the present invention, the expression cassette refers to a DNA capable of expressing the T7 RNA polymerase mutant in a host cell. The DNA may include not only a promoter for initiating transcription of the T7 RNA polymerase mutant gene, but also a terminator for terminating transcription of the T7 RNA polymerase mutant gene. Further, the expression cassette may also include an enhancer sequence.

[0037] According to some embodiments of the present invention, the vector may be a plasmid, a cosmid, a phage or a viral vector, for example, a PET-28a vector.

[0038] According to some embodiments of the present invention, the recombinant vector may be a recombinant vector obtained by inserting a DNA molecule encoding the T7 RNA polymerase mutant into the multiple cloning site of the vector.

[0039] According to some embodiments of the present invention, biological cells include prokaryotic cells and eukaryotic cells. The prokaryotic cells include bacteria or algae. The eukaryotic cells include fungi, mammalian cells or insect cells. Among them, the bacteria can be Escherichia coli, such as E. coli DH5α or E. coli BL21. The recombinant biological cells do not contain reproductive materials.

[0040] According to some embodiments of the present invention, the recombinant biological cell is a recombinant biological cell obtained by introducing the nucleic acid molecule B1), the expression cassette B2) or the recombinant vector B3) into a biological cell. Specifically, it can be a recombinant Escherichia coli obtained by introducing the recombinant vector into E. coli DH5α or E. coli BL21.

[0041] An enzyme preparation according to an embodiment of the fourth aspect of the present invention comprises the T7 RNA polymerase mutant described in the embodiment of the first aspect of the present invention or the recombinant protein described in the embodiment of the second aspect of the present invention.

[0042] According to some embodiments of the present invention, the enzyme preparation further includes a reaction premix.

[0043] According to some embodiments of the present invention, the reaction premix includes Tris-HCl, Mg 2+ , DTT, NTPs, spermidine.

[0044] According to some embodiments of the present invention, the Mg 2+ The source includes at least one of magnesium chloride, magnesium acetate and magnesium sulfate.

[0045] According to some embodiments of the present invention, the reaction premix includes 20-50 mmol / L Tris-HCl, 9-12 mmol / L Mg 2+ 、4~6 mmol / L DTT、0.4~1 mmol / L NTPs、1~5 mmol / L spermidine. For example, the reaction premix may include 40 mMTris-HCl, 0.5 mM NTPs, 8 mM MgCl2, 5 mM DTT and 2 mM spermidine.

[0046] According to some embodiments of the present invention, the pH of the reaction premix is ​​7.5-8.5.

[0047] It is understandable that the reaction premix solution should preferably not affect the activity of the T7 RNA polymerase mutant.

[0048] According to a fifth aspect of the present invention, a method for preparing the T7 RNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention comprises:

[0049] The coding gene of the T7 RNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention is introduced into a biological cell to express the coding gene to obtain the T7 RNA polymerase mutant or the recombinant protein.

[0050] According to some embodiments of the present invention, the biological cells include prokaryotic cells and eukaryotic cells.

[0051] According to some embodiments of the present invention, the prokaryotic cell includes bacteria or algae, wherein the bacteria may be Escherichia coli (eg, E. coli BL21).

[0052] According to some embodiments of the present invention, the eukaryotic cells include fungi (such as yeast), mammalian cells (such as HEK293 cells) or insect cells.

[0053] According to a sixth aspect of the present invention, a method for in vitro transcription of RNA molecules comprises the following steps:

[0054] The DNA molecule is transcribed in vitro using the T7 RNA polymerase mutant described in the embodiment of the first aspect of the present invention, the recombinant protein described in the embodiment of the second aspect of the present invention, or the enzyme preparation described in the embodiment of the fourth aspect of the present invention.

[0055] According to some embodiments of the present invention, the following steps may be specifically included:

[0056] The T7 RNA polymerase mutant / recombinant protein / enzyme preparation, the DNA molecule (template DNA), NTPs and a reaction premix are mixed and reacted.

[0057] Use of any one of C1) to C4) according to the seventh aspect of the present invention in the preparation of mRNA vaccines or RNA drug-related products;

[0058] C1), the T7 RNA polymerase mutant described in the embodiment of the first aspect of the present invention;

[0059] C2), the recombinant protein described in the embodiment of the second aspect of the present invention;

[0060] C3), the biomaterial described in the embodiment of the third aspect of the present invention;

[0061] C4), the enzyme preparation described in the embodiment of the fourth aspect of the present invention.

[0062] According to some embodiments of the invention, the product comprises a kit.

[0063] According to the eighth aspect embodiment of the present invention, the use of the T7 RNA polymerase mutant described in the first aspect embodiment of the present invention, the recombinant protein described in the second aspect embodiment of the present invention, or the enzyme preparation described in the third aspect embodiment of the present invention in the preparation of mRNA vaccines or RNA drug related products.

[0064] According to the ninth aspect of the present invention, a kit for preparing mRNA vaccines or RNA drug-related products comprises the above-mentioned T7 RNA polymerase mutant, the above-mentioned recombinant protein or the above-mentioned enzyme preparation.

[0065] The beneficial effects of this application include:

[0066] 1) The T7 RNA polymerase mutants provided in this application can be used to prepare mRNA vaccines with improved thermal stability and transcription performance. The obtained mutants still have relatively obvious product bands at 50°C, indicating that the RNA transcription yield of the obtained mutants remains unchanged at 50°C, and the electrophoresis bands of the mutants, except for the target band, have significantly reduced other miscellaneous bands, indicating that the byproducts of its transcription are reduced; the obtained mutants have higher thermal stability than the existing wild-type T7 RNA polymerase; the specific enzyme activity of T7-E1 and T7-E2 is 1.8 to 2.0 times that of the wild-type T7 RNA, and has a higher specific enzyme activity. These improvements provide technical support for the large-scale production of mRNA vaccines and help promote the popularization and application of mRNA vaccines worldwide.

[0067] 2) The present application provides a method for preparing a T7 RNA polymerase mutant with improved thermal stability and transcription performance that can be used to prepare an mRNA vaccine. The method selects mutation sites S192, K180, A70, K8, and H27 for mutation. The resulting mutant can significantly improve the thermal stability and enzyme activity of the enzyme and maintain a high transcription efficiency under high temperature conditions. At the same time, the improvement of the mutant also effectively reduces the generation of transcription byproducts and improves the quality and yield of mRNA.

[0068] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be apparent from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 This is a three-dimensional modeling structure diagram of the T7 RNA polymerase mutant provided in the present application. The mutation sites of the T7 RNA polymerase mutant are S192, K180, A70, K8, and H27 in the figure.

[0070] Figure 2 The present application provides a graph of the expression and purification results of the T7 RNA polymerase in Example 1; wherein A is T7-wt, B is T7-E1, C is T7-E2, M is a protein marker, and lanes 1 to 6 correspond to samples 1 to 6, respectively.

[0071] Figure 3Provided in this application are unfolding temperature statistics of the wild-type T7 RNA polymerase (T7-wt), T7 RNA polymerase mutants T7-E1 and T7-E2 in Detection Example 2 after detection by differential scanning fluorescence (DSF);

[0072] Figure 4 The present application provides an electrophoresis diagram of the transcription performance test results of the wild-type T7 RNA polymerase, T7 RNA polymerase mutants T7-E1 and T7-E2 in Test Example 2, wherein each lane is numbered 1 to 15, 1 to 4 are the test results after the wild-type T7 RNA polymerase reaction, 5 to 8 are the test results after the T7-E1 reaction, and 9 to 12 are the test results after the T7-E2 reaction; the reaction temperature of lanes 1, 5, and 9 is 37°C, the reaction temperature of lanes 2, 6, and 10 is 42°C, the reaction temperature of lanes 3, 7, and 11 is 45°C, and the reaction temperature of lanes 4, 8, and 12 is 50°C; the amount of DNA template added in lanes 13 and 14 is 2 μL DNase Ⅰ and 1 μL DNase Ⅰ, respectively, the digestion temperature is 37°C, and the digestion time is 20min to obtain the test results, and lane 15 is the DNA template blank control test result. DETAILED DESCRIPTION

[0073] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments, but the present invention is not limited in any way. Any changes or improvements made based on the teachings of the present invention fall within the protection scope of the present invention.

[0074] Example

[0075] Unless otherwise specified, the materials and instruments used in the following examples were obtained from commercial channels; the detection methods used were all existing methods unless otherwise specified.

[0076] In the description of the present invention, the terms "comprises" and "having" and any variations thereof are intended to cover non-exclusive inclusions. For example, a process, method or product comprising a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units not explicitly listed or inherent to these processes, methods or products.

[0077] Unless otherwise defined, all scientific or technical terms in this patent are consistent with the common understanding of most general persons in the field.

[0078] The following amino acid sequences are all in order from N-terminus to C-terminus; the nucleotide sequences are all in order from 5' to 3' end.

[0079] The term "amino acid" refers to the basic unit that constitutes protein, which gives protein a specific molecular structure and makes its molecule have biochemical activity. For example, the "amino acid" used in the present invention includes the following 20 natural amino acids: alanine (Ala or A), glycine (Gly or G), isoleucine (Ile or I), asparagine (Asn or N), arginine (Arg or R), lysine (Lys or K), lysine (Lys or K), cysteine ​​(Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), glutamine (Gln or Q), histidine (His or H), leucine (Leu or L), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), valine (Val or V) and tyrosine (Tyr or Y).

[0080] Example 1 Preparation of T7 RNA polymerase mutants T7-E1 and T7-E2

[0081] In order to obtain a T7 RNA polymerase with good thermal stability and transcription performance, the wild-type T7 RNA polymerase was mutated and screened in large quantities to obtain T7 RNA polymerase mutants T7-E1 and T7-E2.

[0082] The obtained T7 RNA polymerase mutants T7-E1 and T7-E2 were modeled as follows Figure 1 shown.

[0083] The amino acid sequence of the wild-type T7 RNA polymerase T7-wt used is shown in SEQ ID NO: 1: MNTINIAKNDFSDIELAAIP FNTLADHYGE RLAREQLALE HESYEMGEARFRKMFERQLK 60

[0084] AGEVADNAAA KPLITTLLPK MIARINDWFE EVKAKRGKRP TAFQFLQEIK PEAVAYITIK 120

[0085] TTLACLTSAD NTTVQAVASA IGRAIEDEAR FGRIRDLEAK HFKKNVEEQL NKRVGHVYKK 180

[0086] AFMQVVEADM LSKGLLGGEA WSSWHKEDSI HVGVRCIEML IESTGMVSLH RQNAGVVGQD 240

[0087] SETIELAPEY AEAIATRAGA LAGISPMFQP CVVPPKPWTG ITGGGYWANG RRPLALVRTH 300

[0088] SKKALMRYED VYMPEVYKAI NIAQNTAWKI NKKVLAVANV ITKWKHCPVE DIPAIEREEL 360

[0089] PMKPEDIDMN PEALTAWKRA AAAVYRKDKA RKSRRISLEF MLEQANKFAN HKAIWFPYNM 420

[0090] DWRGRVYAVS MFNPQGNDMT KGLLTLAKGK PIGKEGYYWL KIHGANCAGV DKVPFPERIK 480

[0091] FIEENHENIM ACAKSPLENT WWAEQDSPFC FLAFCFEYAG VQHHGLSYNC SLPLAFDGSC 540

[0092] SGIQHFSAML RDEVGGRAVN LLPSETVQDI YGIVAKKVNE ILQADAINGT DNEVVTVTDE 600

[0093] NTGEISEKVK LGTKALAGQW LAYGVTRSVT KRSVMTLAYG SKEFGFRQQV LEDTIQPAID 660

[0094] SGKGLMFTQP NQAAGYMAKL IWESVSVTVV AAVEAMNWLK SAAKLLAAEV KDKKTGEILR 720

[0095] KRCAVHWVTP DGFPVWQEYK KPIQTRLNLM FLGQFRLQPT INTNKDSEID AHKQESGIAP 780

[0096] NFVHSQDGSH LRKTVVWAHE KYGIESFALI HDSFGTIPAD AANLFKAVRE TMVDTYESCD 840

[0097] VLADFYDQFA DQLHESQLDK MPALPAKGNL NLRDILESDF AFA 883

[0098] The nucleotide sequence encoding the amino acid sequence of wild-type T7 RNA polymerase is shown in SEQ ID NO: 2:

[0099] atgaacacca ttaacattgc gaaaaacgat ttttcggata ttgaactggc agcgattccg 60

[0100] tttaacaccc tggcagatca ttatggcgaa cgcctggcgc gtgaacagct ggccctggaa 120

[0101] catgaaagtt acgaaatggg cgaagcgcgc ttccgtaaaa tgttcgaacg ccagctcaaa 180

[0102] gccggcgaag ttgcggataa tgcggcggcc aaaccgctga ttaccaccct gctgcctaaa 240

[0103] atgattgctc gcattaacga ttggtttgaa gaagtgaaag cgaaacgcgg caaacgcccg 300

[0104] accgcgttcc agttcctgca ggaaattaaa ccggaagcgg ttgcctatat taccatcaaa 360

[0105] accaccctgg cgtgtctgac cagcgccgac aataccaccg tgcaggcggt ggcgagcgcc 420

[0106] attggccgtg ccatcgaaga tgaagcgcgc ttcggtcgta ttcgcgatct ggaagcgaaa 480

[0107] catttcaaaa aaaacgttga agaacagctg aacaaacgcg tgggccacgt gtataagaaa 540

[0108] gcgttcatgc aggtggtgga agcggatatg ctgagcaaag gtctgctggg cggcgaagcg 600

[0109] tggagcagct ggcataaaga agatagcatt catgtgggcg tgcgttgcat tgaaatgctg 660

[0110] attgaaagca ccggcatggt gagcctgcac cgtcagaacg cgggtgttgt gggtcaggat 720

[0111] agcgaaacca ttgaactggc cccggaatat gccgaagcga ttgcgacccg tgcgggcgcc 780

[0112] ctggcgggca tcagcccgat gttccagccg tgcgtggtgc cgccgaaacc gtggaccggc 840

[0113] attaccggcg gcggttactg ggcgaacggt cgccgcccgc tggccctggt tcgcacccat 900

[0114] agcaaaaaag cactgatgcg ttacgaagat gtgtatatgc cagaagtgta taaagccatt 960

[0115] aatattgcc aaaataccgc gtggaaaatt aataaaaaag tgctggccgt ggcaaatgtg1020

[0116] attaccaaat ggaaacactg tccggtggaa gatattccgg cgattgaacg cgaagaactg1080

[0117] ccgatgaaac cggaagatat tgatatgaac ccggaagcgc tgaccgcgtg gaaacgtgcc1140

[0118] gcggcggcgg tgtaccgcaa agataaagcc cgtaaaagcc gccgtattag tctggaattt1200

[0119] atgctggaac aggccaacaa atttgcgaac cacaaagcca tctggtttcc gtataatatg1260

[0120] gattggcgcg gccgcgtgta tgccgtaagc atgtttaatc cgcagggcaa tgatatgacc1320

[0121] aaaggcctgc tgaccctggc caaaggcaaa ccgattggca aagaaggtta ttactggctg1380

[0122] aaaattcatg gcgccaattg cgcgggtgtt gataaagtgc cgtttccgga acgcattaaa1440

[0123] tttattgaag agaaccacga aaacattatg gcgtgtgcga aaagcccgct ggaaaacacc1500

[0124] tggtgggcgg aacaggattc tccgttttgt ttcctggcgt tctgtttcga atatgccggc1560

[0125] gtgcagcatc atggcctgag ctacaactgc agcctgcctc tggcttttga tggcagctgc1620

[0126] agcggcattc agcattttag cgcgatgctg cgcgatgaag tgggcggtcg cgcagtgaac1680

[0127] ctgctgccga gcgaaaccgt ccaggatatt tatggcattg tggcgaaaaa agtgaacgaa1740

[0128] attctgcaag cggatgccat taatgggacc gataacgaag tggtgaccgt gaccgatgaa1800

[0129] aacaccggcg aaattagcga aaaagtgaag ctgggcacca aggcactggc gggtcagtgg1860

[0130] ctggcgtatg gtgtgacccg ctcggtgacc aaacgcagcg tgatgaccct ggcgtacggc1920

[0131] agcaaagaat ttggctttcg ccagcaggtc ctggaagaca ccattcagcc ggccattgat1980

[0132] agcggcaaag gcctgatgtt tacccagccg aatcaggccg ccggctacat ggcgaaactg2040

[0133] atttgggaaa gcgtgagcgt gacggtggtg gcggcggtgg aagcgatgaa ctggctgaaa2100

[0134] agcgcggcga aactgctggc ggccgaagtg aaagataaaa aaacgggcga aatcctgcgt2160

[0135] aaacgttgcg ccgttcattg ggtgaccccg gatggctttc cggtgtggca ggaatacaaa2220

[0136] aaaccgattc agacccgcct gaacctgatg tttctgggcc agtttcgcctgcagccgacc 2280

[0137] attaacacca acaaggatag cgaaattgac gcgcacaaac aggaaagcgg cattgcgccg2340

[0138] aactttgtgc atagccagga tggcagccac ctgcgtaaaa ccgtagtgtg ggcccatgaa2400

[0139] aaatatggca ttgaatcatt cgcgctgatt cacgatagct ttggcaccat tccggcggac2460

[0140] gcagcgaacc tgttcaaagc ggtgcgcgaa accatggtgg atacctatga aagctgcgat2520

[0141] gtgctggcgg atttttatga tcagtttgcg gatcagctgc acgaaagcca gctggataaa2580

[0142] atgccggcgc tgccggcgaa gggcaatctg aatctgcgtg atatcctgga aagcgatttt2640

[0143] gcgtttgcct aa 2652

[0144] The T7 RNA polymerase mutant T7-E1 is formed by mutation of the amino acids shown in SEQ ID NO: 1, and the specific amino acid mutations are K8G, H27K, A70N, and S192P. The amino acid sequence of T7-E1 is specifically shown in SEQ ID NO: 3:

[0145] MNTINIAGND FSDIELAAIP FNTLADKYGE RLAREQLALE HESYEMGEAR FRKMFERQLK 60

[0146] AGEVADNAAN KPLITTLLPK MIARINDWFE EVKAKRGKRP TAFQFLQEIK PEAVAYITIK 120

[0147] TTLACLTSAD NTTVQAVASA IGRAIEDEAR FGRIRDLEAK HFKKNVEEQL NKRVGHVYKK 180

[0148] AFMQVVEADM LPKGLLGGEA WSSWHKEDSI HVGVRCIEML IESTGMVSLH RQNAGVVGQD 240

[0149] SETIELAPEY AEAIATRAGA LAGISPMFQP CVVPPKPWTG ITGGGYWANG RRPLALVRTH 300

[0150] SKKALMRYED VYMPEVYKAI NIAQNTAWKI NKKVLAVANV ITKWKHCPVE DIPAIEREEL 360

[0151] PMKPEDIDMN PEALTAWKRA AAAVYRKDKA RKSRRISLEF MLEQANKFAN HKAIWFPYNM 420

[0152] DWRGRVYAVS MFNPQGNDMT KGLLTLAKGK PIGKEGYYWL KIHGANCAGV DKVPFPERIK 480

[0153] FIEENHENIM ACAKSPLENT WWAEQDSPFC FLAFCFEYAG VQHHGLSYNC SLPLAFDGSC 540

[0154] SGIQHFSAML RDEVGGRAVN LLPSETVQDI YGIVAKKVNE ILQADAINGT DNEVVTVTDE 600

[0155] NTGEISEKVK LGTKALAGQW LAYGVTRSVT KRSVMTLAYG SKEFGFRQQV LEDTIQPAID 660

[0156] SGKGLMFTQP NQAAGYMAKL IWESVSVTVV AAVEAMNWLK SAAKLLAAEV KDKKTGEILR 720

[0157] KRCAVHWVTP DGFPVWQEYK KPIQTRLNLM FLGQFRLQPT INTNKDSEID AHKQESGIAP 780

[0158] NFVHSQDGSH LRKTVVWAHE KYGIESFALI HDSFGTIPAD AANLFKAVRE TMVDTYESCD 840

[0159] VLADFYDQFA DQLHESQLDK MPALPAKGNL NLRDILESDF AFA 883

[0160] The coding nucleotide sequence of the amino acid sequence of the T7 RNA polymerase mutant T7-E1 is shown in SEQ ID NO:4:

[0161] atgaatacca ttaacattgc cggcaacgat tttagcgata ttgaactggc cgccattccg 60

[0162] ttcaacacgc tggccgataa atacggcgaa cgcctggcgc gcgaacagct ggcgctggaa 120

[0163] cacgaaagct atgaaatggg cgaagcccgt ttccgtaaaa tgttcgaacg tcagctgaaa 180

[0164] gccggcgaag ttgccgataa tgcagcgaac aaaccgctga ttaccaccct gctgccgaaa 240

[0165] atgattgccc gcattaatga ttggttcgaa gaagtgaaag cgaaacgtgg caaacgcccg 300

[0166] accgcctttc agtttctgca ggaaattaaa ccggaagcgg tggcgtatat taccattaaa 360

[0167] accaccctgg cgtgcctgac ctcggccgat aataccaccg tgcaggcggt ggcaagcgcc 420

[0168] attggccgcg ccattgagga tgaagcgcgc tttggccgta ttcgcgacct ggaagcaaaa 480

[0169] cattttaaaa aaaacgtgga agaacagctg aacaaacgcg ttggtcatgt gtacaaaaaa 540

[0170] gcgttcatgc aggtcgtgga ggccgatatg ctgccgaaag gcctgctggg cggcgaggca 600

[0171] tggagctcat ggcacaaaga agatagcatt cacgtcggcg tgcgttgcat tgagatgctg 660

[0172] attgaaagca ccggtatggt gagcctgcat cgccagaatg cggcgtggt gggccaggat 720

[0173] agcgaaacca ttgagctggc cccggaatat gccgaagcga ttgcaacccg cgccggtgca 780

[0174] ctggccggta ttagtccgat gttccagccg tgcgtgtgc cgccgaaacc gtggaccggc 840

[0175] attacggcg gcggctattg ggggaacggc cgtcgcccgc tggcactggt gcgcaccac 900

[0176] agcaaaaag cgctgatgcg tttagagat gtttacatgc cggaagtgta taagcgatt 960

[0177] aacattgccc agaataccgc ctggaatt aaaaaaag ttctggcggt ggcgaatgtg1020

[0178] attack ggaacattg cccggtggaa gatatcccgg ccattgaacg tgaagactg1080

[0179] ccgatgaaac cggaagatat tgatatgaat ccggaagcgc tgaccgcgtg gaacgtgcg1140

[0180] gcggcggccg tgtaccgcaa agataaagcg cgcaaaagcc gccgcattag cctggaattt1200

[0181] atgctggaac aggcgaataa attcgcgaac cacaaagcca tttggttccc gtataatatg1260

[0182] gattggcgtg gccgcgtata cgcggtgtcg atgttcaatc cgcaaggcaa tgatatgacg1320

[0183] aaaggcctgc tgaccctggc gaaaggcaaa ccgattggca aagaaggcta ctattggctg1380

[0184] aaaatccacg gcgcgaattg cgccggcgtg gataaagttc cgtttccgga acgtattaaa1440

[0185] tttattgaag aaaaccatga aaacattatg gcgtgcgcga aaagcccgct ggaaaacacc1500

[0186] tggtgggcag aacaggatag cccgttttgc ttcctggcgt tctgcttcga atatgcgggc1560

[0187] gtgcagcacc atggcctgag ctataactgc agcctgccgc tggcgtttga tggcagctgc1620

[0188] agcggtattc agcactttag cgccatgctg cgcgatgaag tgggcggccg cgccgtgaac1680

[0189] ctgctgccga gcgaaaccgt gcaggatatt tatggcattg tggcaaaaaa agtgaacgaa1740

[0190] attctgcagg ccgacgcaat taacggtacc gataacgaag tggtgaccgt tacggatgaa1800

[0191] aacacgggcg aaattagcga aaaagtgaag ctgggcacca aagcgctggc gggccagtgg1860

[0192] ctggcgtacg gcgttacccg tagcgtgact aaacgtagcg tgatgaccct ggcctatggt1920

[0193] agcaaagaat ttggcttccg ccagcaggtg ctggaagata ccattcagcc ggcgattgat1980

[0194] agcggcaaag gcctgatgtt tacccagccg aaccaggcgg cgggttatat ggccaaactg2040

[0195] atttgggaaa gcgtaagcgt gaccgttgtg gcggcggtgg aagcgatgaa ctggctgaaa2100

[0196] agcgcggcga aactgctggc ggcggaagtg aaagataaaa aaaccggcga aattctgcgc2160

[0197] aaacgttgcg cagtgcattg ggtgaccccg gatggctttc cggtgtggca ggaatacaaa2220

[0198] aaaccgattc agactcgtct gaatctgatg tttctgggtc agtttcgttt acagccgacg2280

[0199] attaacacca ataaagatag cgaaattgat gcgcataaac aggaaagcgg cattgcgccg2340

[0200] aatttcgtgc atagccagga tggtagccat ctgcgtaaaa ccgtggtgtg ggcccatgaa2400

[0201] aaatatggca tcgaaagctt tgcgctgatc catgattcat ttggcaccat tccggccgat2460

[0202] gcagcgaacc tgttcaaagc ggtgcgcgaa actatggtgg acacctatga atcgtgcgat2520

[0203] gtgctggccg atttttacga tcagtttgcg gatcagctgc atgaaagcca gctggataaa2580

[0204] atgccggcgc tgccggcaaa aggtaacctg aatttacgcg atattctgga aagcgatttt2640

[0205] gcctttgcgt aa 2652

[0206] The T7 RNA polymerase mutant T7-E2 was formed by mutation of the amino acids shown in SEQ ID NO: 1, and the specific amino acid mutations were K8G, H27K, K180D, and S192G. The amino acid sequence of the obtained mutant T7-E2 is specifically shown in SEQ ID NO: 5.

[0207] MNTINIAGND FSDIELAAIP FNTLADKYGE RLAREQLALE HESYEMGEARFRKMFERQLK 60

[0208] AGEVADNAAA KPLITTLLPK MIARINDWFE EVKAKRGKRP TAFQFLQEIK PEAVAYITIK 120

[0209] TTLACLTSAD NTTVQAVASA IGRAIEDEAR FGRIRDLEAK HFKKNVEEQL NKRVGHVYKD 180

[0210] AFMQVVEADM LGKGLLGGEA WSSWHKEDSI HVGVRCIEML IESTGMVSLH RQNAGVVGQD 240

[0211] SETIELAPEY AEAIATRAGA LAGISPMFQP CVVPPKPWTG ITGGGYWANG RRPLALVRTH 300

[0212] SKKALMRYED VYMPEVYKAI NIAQNTAWKI NKKVLAVANV ITKWKHCPVE DIPAIEREEL 360

[0213] PMKPEDIDMN PEALTAWKRA AAAVYRKDKA RKSRRISLEF MLEQANKFAN HKAIWFPYNM 420

[0214] DWRGRVYAVS MFNPQGNDMT KGLLTLAKGK PIGKEGYYWL KIHGANCAGV DKVPFPERIK 480

[0215] FIEENHENIM ACAKSPLENT WWAEQDSPFC FLAFCFEYAG VQHHGLSYNC SLPLAFDGSC 540

[0216] SGIQHFSAML RDEVGGRAVN LLPSETVQDI YGIVAKKVNE ILQADAINGT DNEVVTVTDE 600

[0217] NTGEISEKVK LGTKALAGQW LAYGVTRSVT KRSVMTLAYG SKEFGFRQQV LEDTIQPAID 660

[0218] SGKGLMFTQP NQAAGYMAKL IWESVSVTVV AAVEAMNWLK SAAKLLAAEV KDKKTGEILR 720

[0219] KRCAVHWVTP DGFPVWQEYK KPIQTRLNLM FLGQFRLQPT INTNKDSEID AHKQESGIAP 780

[0220] NFVHSQDGSH LRKTVVWAHE KYGIESFALI HDSFGTIPAD AANLFKAVRE TMVDTYESCD 840

[0221] VLADFYDQFA DQLHESQLDK MPALPAKGNL NLRDILESDF AFA 883

[0222] The coding nucleotide sequence of the amino acid sequence of the T7 RNA polymerase mutant T7-E2 is shown in SEQ ID NO: 6:

[0223] atgaatacca ttaacattgc cggcaacgat tttagcgata ttgaactggc cgccattccg 60

[0224] ttcaacacgc tggccgataa atacggcgaa cgcctggcgc gcgaacagct ggcgctggaa 120

[0225] cacgaaagct atgaaatggg cgaagcccgt ttccgtaaaa tgttcgaacg tcagctgaaa 180

[0226] gccggcgaag ttgccgataa tgcagcggcc aaaccgctga ttaccaccct gctgccgaaa 240

[0227] atgattgccc gcattaatga ttggttcgaa gaagtgaaag cgaaacgtgg caaacgcccg 300

[0228] accgcctttc agtttctgca ggaaattaaa ccggaagcgg tggcgtatat taccattaaa 360

[0229] accaccctgg cgtgcctgac ctcggccgat aataccaccg tgcaggcggt ggcaagcgcc 420

[0230] attggccgcg ccattgagga tgaagcgcgc tttggccgta ttcgcgacct ggaagcaaaa 480

[0231] cattttaaaa aaacgtgga agaacagctg aaaaacgcg tggtcatgt gtacaagat 540

[0232] gcgttcatgc aggtcgtgga ggccgatatg ctgggcaaag gcctgctggg cggcgaggca 600

[0233] tggagctcat ggcacaaaga agatagcatt cacgtcggcg tgcgttgcat tgagatgctg 660

[0234] attgaaagca ccggtatggt gagcctgcat cgccagaatg cggcgtggt gggccaggat 720

[0235] agcgaaacca ttgagctggc cccggaatat gccgaagcga ttgcaacccg cgccggtgca 780

[0236] ctggccggta ttagtccgat gttccagccg tgcgtgtgc cgccgaaacc gtggaccggc 840

[0237] attacggcg gcggctattg ggggaacggc cgtcgcccgc tggcactggt gcgcaccac 900

[0238] agcaaaaag cgctgatgcg tttagagat gtttacatgc cggaagtgta taagcgatt 960

[0239] aacattgccc agaataccgc ctggaatt aaaaaaag ttctggcggt ggcgaatgtg1020

[0240] attack ggaacattg cccggtggaa gatatcccgg ccattgaacg tgaagactg1080

[0241] ccgatgaaac cggaagatat tgatatgaat ccggaagcgc tgaccgcgtg gaaacgtgcg1140

[0242] gcggcggccg tgtaccgcaa agataaagcg cgcaaaagcc gccgcattag cctggaattt1200

[0243] atgctggaac aggcgaataa attcgcgaac cacaaagcca tttggttccc gtataatatg1260

[0244] gattggcgtg gccgcgtata cgcggtgtcg atgttcaatc cgcaaggcaa tgatatgacg1320

[0245] aaaggcctgc tgaccctggc gaaaggcaaa ccgattggca aagaaggcta ctattggctg1380

[0246] aaaatccacg gcgcgaattg cgccggcgtg gataaagttc cgtttccgga acgtattaaa1440

[0247] tttattgaag aaaaccatga aaacattatg gcgtgcgcga aaagcccgct ggaaaacacc1500

[0248] tggtgggcag aacaggatag cccgttttgc ttcctggcgt tctgcttcga atatgcgggc1560

[0249] gtgcagcacc atggcctgag ctataactgc agcctgccgc tggcgtttga tggcagctgc1620

[0250] agcggtattc agcactttag cgccatgctg cgcgatgaag tgggcggccg cgccgtgaac1680

[0251] ctgctgccga gcgaaaccgt gcaggatatt tatggcattg tggcaaaaaa agtgaacgaa1740

[0252] attctgcagg ccgacgcaat taacggtacc gataacgaag tggtgaccgt tacggatgaa1800

[0253] aacacgggcg aaattagcga aaaagtgaag ctgggcacca aagcgctggc gggccagtgg1860

[0254] ctggcgtacg gcgttacccg tagcgtgact aaacgtagcg tgatgaccct ggcctatggt1920

[0255] agcaaagaat ttggcttccg ccagcaggtg ctggaagata ccattcagcc ggcgattgat1980

[0256] agcggcaaag gcctgatgtt tacccagccg aaccaggcgg cgggttatat ggccaaactg2040

[0257] atttgggaaa gcgtaagcgt gaccgttgtg gcggcggtgg aagcgatgaa ctggctgaaa2100

[0258] agcgcggcga aactgctggc ggcggaagtg aaagataaaa aaaccggcga aattctgcgc2160

[0259] aaacgttgcg cagtgcattg ggtgaccccg gatggctttc cggtgtggca ggaatacaaa2220

[0260] aaaccgattc agactcgtct gaatctgatg tttctgggtc agtttcgttt acagccgacg2280

[0261] attaacacca ataaagatag cgaaattgat gcgcataaac aggaaagcgg cattgcgccg2340

[0262] aatttcgtgc atagccagga tggtagccat ctgcgtaaaa ccgtggtgtg ggcccatgaa2400

[0263] aaatatggca tcgaaagctt tgcgctgatc catgattcat ttggcaccat tccggccgat2460

[0264] gcagcgaacc tgttcaaagc ggtgcgcgaa actatggtgg acacctatga atcgtgcgat2520

[0265] gtgctggccg atttttacga tcagtttgcg gatcagctgc atgaaagcca gctggataaa2580

[0266] atgccggcgc tgccggcaaa aggtaacctg aatttacgcg atattctgga aagcgatttt2640

[0267] gcctttgcgt aa 2652

[0268] Example 2 Expression and purification of polymerases obtained from T7-wt, T7-E1 and T7-E2

[0269] Follow steps 1 to 3 for T7-wt, T7-E1, and T7-E2, respectively.

[0270] 1. Construction of expression vector:

[0271] Based on the coding nucleotide sequence information of T7-wt, T7-E1 or T7-E2 in Example 1, a nucleotide sequence encoding a histidine tag (HHHHHHHH) and a connecting peptide (GS), i.e., ATGCATCACCACCATCACCATCACCACGGTAGC (as shown in SEQ ID NO: 7) was designed at its 3' end, and the corresponding DNA molecules were synthesized. The DNA molecules were then connected to the PET-28a vector by overlapping PCR to obtain recombinant expression vectors PET-28a, T7-wt, PET-28a, T7-E1 and PET-28a, T7-E2.

[0272] PCR amplification was performed using the above-mentioned recombinant expression vector as a template, and then the PCR products were purified and recovered using the SteadyPure PCR reaction solution purification kit. The recovered products were transformed into DH5α competent cells, and positive single clones were screened for sequencing verification. After verification, the results were consistent with expectations.

[0273] 2. Expression:

[0274] The recombinant plasmids obtained in step 1 were transformed into host cells E. coli BL21, and single colonies were picked and inoculated into 100 mL LB culture medium containing 50 μg / mL ampicillin. After shaking and culturing overnight in a 37°C shaker, a 5 mm diameter inoculated bacterial block was obtained using a circular cork punch. According to the volume ratio of the inoculated bacterial block to the culture medium of 1:100, 20 ml of the inoculated bacterial block was inoculated into 2 L LB culture medium with an ampicillin concentration of 50 μg / mL, and shaken and cultured in a 37°C shaker until 0 D 600 is 0.6~0.8; add IPTG to a final concentration of 0.5 mmol / L, continue shaking induction at 37℃ for 6 h~10 h to obtain culture medium; centrifuge the culture medium to collect the precipitate, which is the induced bacteria and weigh it, record the wet weight of the bacteria, and store it at -80℃.

[0275] 3. Purification:

[0276] 3.1 Take the cells frozen at -80℃ after induction and resuspend the cells by adding 3 mL of lysis buffer per gram of wet cells. The lysis buffer used is: 50 mM Tris-HCl, 1 mM EDTA, 300 mM NaCl, 50 mM Imidazole, 5% Glycerol, pH 7.8. Use a high-pressure crusher to lyse the resuspended cells. The high-pressure crushing condition is 700 bar, and the crushing cycle is three times. Centrifuge the lysed cells at 4℃ and 12000 rpm for 30 min, take the supernatant A as sample 1, transfer it to a 200 mL sterile beaker, and let it stand and discard the precipitate A as sample 2.

[0277] 3.2 After balancing the chromatography column Ni-NTA Purose 6 Fast Flow with buffer A, load the protein solution to be purified onto the chromatography column, rinse the column with buffer A first, and then use buffer B (50mM Tris-HCl, 1mM EDTA, 300mMNaCl, 700mM imidazole, 5% Glycerol, pH 7.8) for gradient elution from 0% to 100%, and perform SDS-PAGE protein electrophoresis on the eluted components. According to the test results, collect the eluate A containing the target protein (sample 3), and dialyze the eluate A into buffer A to obtain and collect the dialysate A (sample 4).

[0278] 3.3 Perform secondary nickel ion affinity chromatography purification on dialysate A, with the same steps as 3.2, collect eluate B (sample 5) containing the target protein, dialyze eluate B into enzyme storage solution and then dialyze into storage solution (20 mM KPB, 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 50% glycerol, pH 7.9), collect dialysate B (sample 6) for later use.

[0279] Take 30 μL of each sample 1 to sample 6 of T7-wt, T7-E1 and T7-E2, and analyze the purification results by SDS-PAGE electrophoresis. Figure 2 As shown in A, B, and C.

[0280] Test Example 1: Detection of T7-wt, T7-E1 and T7-E2 polymerase protein concentration and enzyme activity

[0281] In this detection example, the protein concentration and enzyme activity of the T7-wt, T7-E1 and T7-E2 polymerases obtained in Example 2 were detected.

[0282] (1) Dilute T7-wt, T7-E1, and T7-E2 polymerases appropriately with enzyme storage solution, and use MicroBCATM Protein Assay Kit (Cat. No. 23235) to determine the protein concentration of each polymerase. For specific concentration determination methods, refer to the instruction manual of the kit.

[0283] (2) Enzyme activity determination:

[0284] 1. Dilute the protein of T7-wt, T7-E1 and T7-E2 polymerase to about 0.5 mg / mL, and then dilute them in a gradient to about 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, and 0.05 mg / mL. Take commercial T7 RNA polymerase (Cat. No. AG12009) and dilute them in a gradient to 100 U / μL, 50 U / μL, 25 U / μL, 10 U / μL, 5 U / μL, 2 U / μL, and 1 U / μL for later use.

[0285] 2. According to the components and reaction conditions in the kit instructions, the above enzymes were used for in vitro transcription reaction. The transcription template preparation method used is as follows:

[0286] Using pUC18 plasmid as template, primers were designed for conventional PCR amplification and purified to obtain a DNA template of about 1.5k bp. The primer sequences are as follows:

[0287] PCR-F: 5'-TAATACGACTCACTATAGGGACTATCGTCTTGAGT-3' (SEQ ID NO. 8);

[0288] PCR-R: 5'-GACGAAAGGGCCTCGTGATA-3' (SEQ ID NO.9);

[0289] 4. The enzyme activity of the above-mentioned T7 RNA polymerase was determined using the kit PhosphoWorks™ Fluorimetric Pyrophosphate Assay Kit *Enhanced Selectivity* (Cat. No. 21614): the commercial T7 RNA polymerase gradient dilution sample and each gradient wild-type T7 RNA polymerase and mutant of the present invention were mixed with the pyrophosphate quantitative working solution, incubated at room temperature for 20 minutes, and the fluorescence value was determined in a microplate reader under the conditions of Ex / Em=316nm / 456nm (Cutoff 420nm). The enzyme activity of the diluted commercial T7 RNA polymerase and the fluorescence signal were plotted against a standard curve, and the enzyme activities of the diluted T7-wt, T7-E1 and T7-E2 polymerases were read in the standard curve according to the measured signal values.

[0290] The results of enzyme activity test of T7-wt, T7-E1 and T7-E2 polymerases are shown in Table 1.

[0291] Table 1

[0292]

[0293] The results showed that at similar protein concentrations, the purified T7 RNA polymerase mutants T7-E1 and T7-E2 had higher specific enzyme activities than the wild-type T7 RNA polymerase, which were 1.8 to 2.0 times.

[0294] Test Example 2 Testing the thermal stability of T7-wt, T7-E1, and T7-E2

[0295] This test example tests the thermal stability of T7-wt, T7-E1, and T7-E2. Differential scanning fluorimetry (DSF) is used to detect the melting temperature (Tm value) of T7 RNA polymerase mutants.

[0296] DSF refers to slowly heating the sample on a fluorescent quantitative PCR instrument, and detecting the amount of fluorescent dye binding to the structurally changed protein during the heating process to evaluate the thermal stability of the protein. DSF can monitor the changes in protein conformation during the heating process through fluorescent dyes or protein endogenous fluorescence signals to calculate its melting temperature Tm (the temperature at which the folded protein is equal to the unfolded protein). When the temperature rises, the protein unfolds, the hydrophobic part is exposed, SYPRO Orange (Cat. No. AG31002) specifically binds to the hydrophobic part of the protein, and the fluorescence is enhanced. The higher the measured Tm value, the stronger the thermal stability of the protein.

[0297] A 20 μL reaction system (20 mmol / L HEPES-KOH, 150 mmol / L KCl, 1 mg enzyme, 20×SYPROOrange fluorescent dye, pH 8.0) was placed in a fluorescent quantitative PCR instrument, the excitation and emission wavelengths were adjusted to the corresponding wavelengths of the fluorescent dye, the heating rate was set to 1°C / 10s, the temperature range was from 25°C to 99°C, and the fluorescence intensity was measured every 1°C to 3°C. After the reaction was completed, the Tm value and related parameters of the protein sample were obtained by the data processing software Protein Thermal Shift Software.

[0298] The above operation was used to test T7-wt, T7-E1, and T7-E2, and the test results were as follows: Figure 3 shown.

[0299] Depend on Figure 3It can be seen that the Tm value of T7-wt is 45.58, the Tm value of T7-E1 is 48.05, and the Tm value of T7-E2 is 48.14. The Tm values ​​of T7 RNA polymerase mutants T7-E1 and T7-E2 are both improved relative to the wild type, indicating that the thermal stability of T7 RNA polymerase mutants T7-E1 and T7-E2 is higher than that of T7-wt. The Tm values ​​of T7-E1 and T7-E2 can reach 48°C, while that of T7-wt is only about 45°C.

[0300] Detection Example 3 Detection of the transcription performance of T7-wt, T7-E1, and T7-E2

[0301] This test example tested the transcription performance of T7-wt, T7-E1, and T7-E2 polymerases at different reaction temperatures (37°C, 42°C, 45°C, and 50°C). The specific methods are as follows:

[0302] T7-wt, T7-E1, and T7-E2 were used as transcriptases to perform in vitro transcription on the transcription template, wherein the transcription template sequence is as follows:

[0303] 5'-TTCTAATACGACTCACTATAGGGAAACATCTTGTTGAGAGCAGTATACAACTC-3' (SEQ ID NO. 10);

[0304] The transcription reaction system is shown in Table 2:

[0305] Table 2:

[0306]

[0307] Among them, the 10× reaction buffer contains 400 mM Tris-HCl (pH 8.0), 80 mM MgCl2, 50 mM DTT and 20 mM spermidine. After the reaction system is prepared, it is placed at 37°C, 42°C, 45°C and 50°C for transcription reaction for 30 minutes, then inactivated at 70°C for 10 minutes, and finally 15% 7M urea gel electrophoresis is performed to detect the product.

[0308] The results are as follows Figure 4As shown. The electrophoresis results showed that the RNA transcription yield of T7-wt (lane numbers 1-4) decreased significantly with the increase of reaction temperature, while the amount of transcription products of T7-E1 (lane numbers 5-8) remained basically unchanged at reaction temperatures of 37°C, 42°C and 45°C, and there were still obvious product bands at 50°C, indicating that it still had strong transcription ability under higher temperature conditions; compared with T7-wt, the transcription products obtained by T7-E2 (lane numbers 9-12) after transcription reaction under the above-mentioned temperature conditions had significantly fewer impurity bands in the electrophoresis bands except the target band, indicating that its transcription byproducts were reduced.

[0309] Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for those skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to make equivalent substitutions for some of the technical features therein. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A T7 RNA polymerase mutant, characterized in that: The mutation site of the T7 RNA polymerase mutant compared to the wild-type T7 RNA polymerase is any one of the groups A1) to A2): A1), K8G, H27K, A70N, S192P; A2), K8G, H27K, K180D, S192G; The amino acid sequence of the wild-type T7 RNA polymerase is shown in SEQ ID NO:

1.

2. A recombinant protein, characterized in that It comprises a tag and the T7 RNA polymerase mutant according to claim 1.

3. A biological material related to the T7 RNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2, characterized in that: The biological material is any one of B1) to B4): B1), a nucleic acid molecule encoding the T7 RNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

4. The biomaterial according to claim 3, characterized in that The nucleic acid molecule has any one of B11) to B14): B11), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO:4; B12), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 6; B13), a DNA molecule having more than 80% homology with the nucleotide sequence shown in B11) or B12), and encoding the T7 RNA polymerase mutant; B14), a DNA molecule that hybridizes with the nucleotide sequence defined in any one of B11) to B13) under stringent conditions and encodes the T7 RNA polymerase mutant.

5. The biomaterial according to claim 4, characterized in that B13), having more than 85% homology with the nucleotide sequence shown in B11) or B12), and encoding a DNA molecule of the T7 RNA polymerase mutant.

6. The biomaterial according to claim 4, characterized in that B13), having more than 90% homology with the nucleotide sequence shown in B11) or B12), and encoding a DNA molecule of the T7 RNA polymerase mutant.

7. An enzyme preparation, characterized in that It comprises the T7 RNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2.

8. A method for preparing the T7 RNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2, characterized in that: include: The coding gene of the T7 RNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2 is introduced into a biological cell to express the coding gene, thereby obtaining the T7 RNA polymerase mutant or the recombinant protein.

9. A method for in vitro transcription of RNA molecules, characterized in that: include: The DNA molecule is transcribed in vitro using the T7 RNA polymerase mutant according to claim 1, the recombinant protein according to claim 2 or the enzyme preparation according to claim 7.

10. Use of any one of C1) to C4) in the preparation of mRNA vaccines or RNA drug-related products; C1), the T7 RNA polymerase mutant according to claim 1; C2), the recombinant protein according to claim 2; C3), the biological material according to claim 3 or 4; C4) and the enzyme preparation according to claim 7.

11. Use of the T7 RNA polymerase mutant according to claim 1, the recombinant protein according to claim 2 or the enzyme preparation according to claim 7 in the preparation of mRNA vaccines or RNA drug-related products.

12. A kit for preparing mRNA vaccines or RNA drugs, characterized in that: It comprises the T7 RNA polymerase mutant according to claim 1, the recombinant protein according to claim 2 or the enzyme preparation according to claim 7.

Images