SiRNA for inhibiting DGAT2 gene expression, siRNA conjugate or prodrug and pharmaceutical composition of siRNA conjugate and application of siRNA conjugate or prodrug and pharmaceutical composition

Abstract

The invention relates to siRNA for inhibiting DGAT2 gene expression, a siRNA conjugate and a prodrug thereof, a pharmaceutical composition containing the siRNA conjugate and the prodrug, and application of the siRNA conjugate and the prodrug. Each nucleotide in the siRNA provided by the invention is independently modified or unmodified nucleotide, and the siRNA contains a positive-sense strand and an antisense strand. The siRNA, the conjugate as well as the prodrug and the pharmaceutical composition of the siRNA can be used for effectively treating and / or preventing diseases related to DGAT2 gene overexpression.

Description

Technical Field

[0001] The present invention relates to siRNA, siRNA conjugate or prodrug thereof for inhibiting DGAT2 gene expression, a pharmaceutical composition containing the same, and a preparation method and use thereof. Background Art

[0002] Diglyceride acyltransferase (or O-acyltransferase) DGAT catalyzes the conversion of diglycerides and acyl coenzyme a (CoA) to triglycerides. The reaction catalyzed by DGAT is considered to be the final and only key step in triglyceride synthesis. In mammals, DGAT enzymes are two isozymes, DGAT1 and DGAT2. Studies have shown that although DGAT1 and DGAT2 catalyze the same reaction, there is no sequence homology between their genes and their structures are not related. The two enzymes play different roles in triglyceride metabolism, with DGAT2 involved in fatty degeneration and DGAT1 involved in very low-density lipoprotein (VLDL) synthesis. DGAT1 is mainly expressed in the small intestine, located in the absorptive enterocytes of the intestine and duodenum, and reconstructs triglycerides that are decomposed by lipolysis during intestinal absorption. DGAT1 reconstructs triglycerides in a defined step, and then they are packaged together with cholesterol and protein to form chylomicrons. DGAT2 is mainly located in fat, liver, and skin cells, promoting the accumulation of triglycerides and the formation of fat. In humans, DGAT1 mutations are associated with congenital diarrhea. The exact cause of diarrhea is still unclear, but it is speculated to be related to abnormal fat absorption and accumulation of DGAT1 substrates in the intestinal mucosa. DGAT2 is key to the formation of adipose tissue and is closely related to triglyceride levels in plasma, skin barrier formation, and fat accumulation in the liver. Since there is no sequence homology and structural unrelatedness between DGAT1 and DGAT2, targeting DGAT2 will not affect the functional inhibition of DGAT1, but can effectively reduce blood lipids and fat accumulation in the liver. It is a potential target for the treatment of hyperlipidemia, fatty liver, obesity, hepatic steatosis and other related diseases.

[0003] Non-alcoholic fatty liver disease (NAFLD), also known as metabolic (dysfunction) associated fatty liver disease (MAFLD), is the accumulation of excess fat in the liver in the absence of other clear causes (such as drinking). NAFLD is the most common liver disease in the world, affecting approximately 25% of the world's population. NAFLD can be divided into two types: non-alcoholic fatty liver disease (NAFL) and non-alcoholic steatohepatitis (NASH). NAFL is less dangerous than NASH and usually does not progress to NASH or cirrhosis; when NAFL progresses to NASH, lobular inflammation, ballooning of hepatocytes, and perisinusoidal fibrosis are observed. Compared with simple steatosis, inflammation is a hallmark of NASH; NASH is a progressive disease that increases hepatocyte death through apoptosis or necrosis, which can severely damage liver function and lead to complications such as cirrhosis, liver failure, liver cancer, or cardiovascular disease. It has now become one of the three major factors for liver transplantation in clinical practice. There is currently no specific treatment for NAFLD, which is mainly achieved through diet changes and exercise to reduce weight. Preliminary studies have shown that pioglitazone and vitamin E have the potential for treatment.

[0004] From NAFL (manifested as simple steatosis) to NASH, these diseases begin with abnormal accumulation of fat in the liver (hepatic steatosis), with the fat mainly in the form of triglycerides, but the mechanism of triglyceride accumulation and why accumulation leads to liver dysfunction are still unclear.

[0005] Studies have shown that overexpression of DGAT2 increases triglyceride synthesis, and reducing the expression level of DGAT2 can reduce triglyceride formation. In the current study, NEETA B. AMIN et al. used a DGAT2 inhibitor (PF-06427878) to significantly reduce triglyceride concentrations in the liver and plasma and reduce the expression of lipogenic genes; in the NASH mouse model, PF-06427878 treatment significantly improved liver steatosis and fibrosis; in two phase 1 clinical trials, liver function markers such as alanine aminotransferase were improved and liver steatosis was reduced (Amin NB, Carvajal-Gonzalez S, Purkal J, et al. Targeting diacylglycerol acyltransferase 2 for the treatment of nonalcoholic steatohepatitis [J]. Sci. Transl. Med., 2019, 11 (520): eaav9701). A drug called IONIS-DGAT2 Rx developed by Ionis Pharmaceuticals for the treatment of NASH works by inhibiting the expression of the DGAT2 gene through antisense nucleic acids (PrlA, Emb B, Lw B, et al. Novel antisense inhibition of diacylglycerol O-acyltransferase 2 for treatment of non-alcoholic fatty liver disease: a multicentre, double-blind, randomised, placebo-controlled phase 2 trial[J]. 2020.). Batuhan Yenilmez et al. showed that in the NASH mouse model, the use of GalNAc-conjugated siRNA targeting DGAT2 can prevent and reverse triglyceride accumulation without increasing diglyceride accumulation, thereby significantly improving the fatty liver phenotype (Batuhan Yenilmez et al., An RNAi therapeutic targeting hepatic DGAT2 in a genetically obese mouse model of nonalcoholicsteatohepatitis, Mol Ther. 2022 Mar 2; 30 (3): 1329-1342). Xing XianYu et al. studied the role of DGAT2 in glucose and lipid metabolism using antisense oligonucleotides.The results showed that by reducing the expression of DGAT2 in the liver and fat of obese mice, the liver triglyceride content in both models can be significantly reduced, liver steatosis can be improved, and hyperlipidemia can be alleviated, thereby improving metabolic syndrome (Xing Xian Yu et al., Antisense oligonucleotide reduction of DGAT2 expression improves hepatic steatosis and hyperlipidemia in bbese mice, Hepatology. 2005 Aug; 42 (2): 362-71). Brandon Pabst et al. used PF-06424439 (1) and 2 as DGAT2 inhibitors to study the detailed mechanism of DGAT2 inhibition, further proving that DGAT2 is an attractive therapeutic target for the treatment of hyperlipidemia and hepatic steatosis (Brandon Pabst et al., Mechanistic characterization of long residence time inhibitors of diacylglycerol acyltransferase 2 (DGAT2), Biochemistry, 2018, 57, 51, 6997-7010). Tinglu Ning et al. identified DGAT2 mutations in 227 young obese subjects and 219 thin controls, and the results showed that the R128* mutation seriously damaged the TG biosynthetic ability of DGAT2, and all other R128* carriers in the family were very thin, indicating the correlation between the gene mutation of DGAT2 and human obesity (Tinglu Ning et al., Genetic interaction of DGAT2 and FAAH in the development of human obesity, Endocrine, Volume 56, pages 366-378, (2017)). The above studies show that DGAT2 is an effective target for the treatment of NAFLD / NASH, obesity, hepatic steatosis, hyperlipidemia, etc., and inhibiting DGAT2 can effectively reduce triglycerides and reduce the accumulation of liver fat. Summary of the invention

[0006] The present invention aims to provide siRNA, siRNA conjugates or prodrugs thereof and pharmaceutical compositions, which can selectively and effectively inhibit the expression of DGAT2 gene to achieve the purpose of disease treatment.

[0007] In a first aspect, the present invention provides an siRNA for inhibiting the expression of DGAT2 gene, wherein the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II, wherein the nucleotide sequence I and the nucleotide sequence II are at least partially reverse-complemented to form a double-stranded region, wherein the nucleotide sequence I and the nucleotide sequence II are selected from the following sequences:

[0008] (1) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 346, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 347:

[0009] 5'-GACUAUUUGCUUU-3'(SEQ ID NO:346)

[0010] 5'-AAAGCAAAUAGUC-3' (SEQ ID NO: 347);

[0011] (2) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 348, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 349:

[0012] 5'-CCAUCCUCAUGUACAUAU-3'(SEQ ID NO:348)

[0013] 5'-AUAUGUACAUGAGGAUGG-3' (SEQ ID NO: 349);

[0014] (3) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 350, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 351:

[0015] 5'-CACCAUAGACUAUU-3'(SEQ ID NO:350)

[0016] 5'-AAUAGUCUAUGGUG-3' (SEQ ID NO: 351);

[0017] (4) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 352, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 353:

[0018] 5'-UUUGCUUUCAAAGAA-3'(SEQ ID NO:352)

[0019] 5'-UUCUUUGAAAGCAAAUA-3' (SEQ ID NO:353);

[0020] (5) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 354, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 355:

[0021] 5'-CUUUCGAGACUA-3'(SEQ ID NO:354)

[0022] 5'-UAGUCUCGAAAGUA-3' (SEQ ID NO:355);

[0023] (6) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 356, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 357:

[0024] 5'-CUCAUGUACAUA-3'(SEQ ID NO:356)

[0025] 5'-UAUGUACAUGAG-3' (SEQ ID NO:357);

[0026] (7) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 358, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 359:

[0027] 5'-GUGGCGCUACUUUCGAGA-3'(SEQ ID NO:358)

[0028] 5'-UCUCGAAAGUAGCGCCAC-3' (SEQ ID NO:359).

[0029] In one embodiment, the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, essentially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there are no more than 3 base mismatches between the two nucleotide sequences; the substantially reverse complementary means that there are no more than 1 base mismatch between the two nucleotide sequences; and the completely reverse complementary means that there are no mismatches between the two nucleotide sequences.

[0030] In one embodiment, the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV, and the lengths of the nucleotide sequence III and the nucleotide sequence IV are each independently 0-11 nucleotides, wherein the nucleotide sequence III is connected to the 5' end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 3' end of the nucleotide sequence II, and the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than one base mismatch between the two nucleotide sequences; and the completely reverse complementary means that there is no mismatch between the two nucleotide sequences; and / or, the nucleotide sequence III is connected to the 3' end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 5' end of the nucleotide sequence II, and the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than one base mismatch between the two nucleotide sequences; and the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.

[0031] In one embodiment, the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains nucleotide sequences I and III, and the antisense strand contains nucleotide sequences II and IV, and the nucleotide sequences I and III are at least partially reverse complementary to the nucleotide sequences II and IV to form a double-stranded region, wherein the nucleotide sequences I and III, the nucleotide sequences II and IV are selected from the following sequences:

[0032] (1) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 251, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 252;

[0033] (2) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 253, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 254;

[0034] (3) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:42, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:128;

[0035] (4) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 23, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 24;

[0036] (5) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:31, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:32;

[0037] (6) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:47, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:48;

[0038] (7) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 255, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 256;

[0039] (8) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:49, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:50;

[0040] (9) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:55, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:56;

[0041] (10) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 257, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 258;

[0042] (11) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:57, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:58;

[0043] (12) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:59, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:60;

[0044] (13) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:61, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:62;

[0045] (14) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 259, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 260;

[0046] (15) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 261, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 262;

[0047] (16) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 75, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 76;

[0048] (17) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 263, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 264;

[0049] (18) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 265, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 266;

[0050] (19) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 267, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 268;

[0051] (20) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 269, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 270;

[0052] (21) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 15, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 271;

[0053] (22) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 272, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 273;

[0054] (23) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 131, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 132;

[0055] (24) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 274, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 275;

[0056] (25) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 276, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 277;

[0057] (26) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 163, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 164;

[0058] (27) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 165, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 166; or

[0059] (28) The nucleotide sequences I and III contain or consist of the nucleotide sequence shown in SEQ ID NO:278, and the nucleotide sequences II and IV contain or consist of the nucleotide sequence shown in SEQ ID NO:279.

[0060] In one embodiment, the sense strand further contains a nucleotide sequence V and / or the antisense strand further contains a nucleotide sequence VI, the length of the nucleotide sequences V and VI is 0-3 nucleotides, the nucleotide sequence V is connected to the 3' end of the sense strand to form the 3' overhang of the sense strand, and / or the nucleotide sequence VI is connected to the 3' end of the antisense strand to form the 3' overhang of the antisense strand. In a preferred embodiment, the length of the nucleotide sequence V or VI is 2 nucleotides. In a preferred embodiment, the nucleotide sequence V or VI is two consecutive thymine deoxyribonucleotides, two consecutive uracil ribonucleotides, or one cytosine deoxyribonucleotide and one adenine deoxyribonucleotide in the direction from 5' to 3'. In a preferred embodiment, the nucleotide sequence V or VI is mismatched or complementary to the nucleotides at the corresponding positions of the target mRNA.

[0061] In one embodiment, the length of the double-stranded region is 15-30 nucleotide pairs; preferably, the length of the double-stranded region is 17-23 nucleotide pairs; more preferably, the length of the double-stranded region is 19-21 nucleotide pairs.

[0062] In one embodiment, the sense strand or antisense strand has 15-30 nucleotides; preferably, the sense strand or antisense strand has 19-25 nucleotides; more preferably, the sense strand or antisense strand has 19-23 nucleotides. In one embodiment, at least one nucleotide in the sense strand or antisense strand is a modified nucleotide, and / or at least one phosphate group is a phosphate group with a modified group; preferably, the phosphate group with a modified group is a thiophosphate group formed by replacing one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom.

[0063] In one embodiment, the siRNA comprises a sense strand without 3' overhanging nucleotides.

[0064] In one embodiment, the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate-derivative group, or the 5' terminal nucleotide of the antisense strand is not linked to a 5' phosphate group or a 5' phosphate-derivative group.

[0065] In one embodiment, the modified nucleotides are selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs or a combination of any two or more thereof.

[0066] In one embodiment, the modified nucleotides are selected from 2'-fluoro modified nucleotides, 2'-methoxy modified nucleotides, 2'-O-CH2-CH2-O-CH3 modified nucleotides, 2'-O-CH2-CH=CH2 modified nucleotides, 2'-CH2-CH2-CH=CH2 modified nucleotides, 2'-deoxy nucleotides, nucleotide analogs or a combination of any two or more thereof.

[0067] In one embodiment, each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide or a non-fluoro-modified nucleotide.

[0068] In a preferred embodiment, in the sense strand, from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at positions 5, 7, 8 and 9, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at positions 9, 10 and 11, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at positions 8, 9 and 10, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at positions 8, 9, 10 and 11. 2'-fluoro-modified nucleotides are located at positions 7 and 9, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 7, 9 and 11, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 7, 11, 13 and 15, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 8, 9, 10 and 12, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 7, 9, 11, 13 and 15, and the remaining positions are non-fluorinated modified nucleotides fluorinated modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 9, 11 and 13, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 7, 9, 11 and 13, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 7, 8 and 9, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 9, 11 and 13, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 7, 9 and 11, and the remaining positions are non-fluorinated modified nucleotides; or or, the 2'-fluoro modified nucleotides are located at positions 7, 11 and 13, and the remaining positions are non-fluorinated modified nucleotides; or, the 2'-fluoro modified nucleotides are located at positions 7, 11, 12 and 13, and the remaining positions are non-fluorinated modified nucleotides; or, the 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 16, and the remaining positions are non-fluorinated modified nucleotides; or, the 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 17, and the remaining positions are non-fluorinated modified nucleotides; or, the 2'-fluoro modified nucleotides are located at positions 3, 7, 11, 16 and 17, and the remaining positions are non-fluorinated modified nucleotides; and / or

[0069] In the antisense strand, from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 8th, 9th, 14th and 16th positions, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at the 2nd, 14th and 16th positions, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th and 14th positions, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at the 2nd, 3rd, 5th, 8th, 10th, 14th, 16th and 18th positions, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at the 2nd, 3rd, 4th, 5th and 6th positions. , 7, 10 and 14, and the remaining positions are non-fluorinated modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 2, 4, 6, 12, 14, 16, 18 and 20, and the remaining positions are non-fluorinated modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 2 and 14, and the remaining positions are non-fluorinated modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, 18 and 20, and the remaining positions are non-fluorinated modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 2, 7, 10 and 14, and the remaining positions are non-fluorinated modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 2, 5, 7 and 14, and the remaining positions are non-fluorinated modified nucleotides.

[0070] In a preferred embodiment, according to the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are non-fluorinated modified nucleotides; according to the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are non-fluorinated modified nucleotides. In a preferred embodiment, according to the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are non-fluorinated modified nucleotides; according to the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 8th, 9th, 14th and 16th positions of the antisense strand, and the remaining positions are non-fluorinated modified nucleotides. In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are non-fluoro-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 14 and 16 of the antisense strand, and the remaining positions are non-fluoro-modified nucleotides.

[0071] In one embodiment, each non-fluorinated modified nucleotide is a 2'-methoxy modified nucleotide, wherein the 2'-methoxy modified nucleotide refers to a nucleotide in which the 2'-hydroxyl group of the ribose group is replaced by a methoxy group.

[0072] In one embodiment, each non-fluorinated modified nucleotide is independently selected from a nucleotide or nucleotide analogue formed by replacing the hydroxyl group at the 2' position of the ribose group of the nucleotide with a non-fluorinated group, and the nucleotide analogue is selected from one of isonucleotides, LNA, ENA, cET-BNA, UNA and GNA.

[0073] In one embodiment, any one nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide or a combination of any two or more thereof.

[0074] In a preferred embodiment, in the sense strand, from 5' to 3' direction, 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11, and the remaining positions are 2'-methoxy-modified nucleotides; alternatively, 2'-fluoro-modified nucleotides are located at positions 5, 7, 8 and 9, and the remaining positions are 2'-methoxy-modified nucleotides; alternatively, 2'-fluoro-modified nucleotides are located at positions 9, 10 and 11, and the remaining positions are 2'-methoxy-modified nucleotides; alternatively, 2'-fluoro-modified nucleotides are located at positions 8, 9 and 10, and the remaining positions are 2'-methoxy-modified nucleotides; alternatively, 2'-fluoro-modified nucleotides are located at positions 8, 9, 10 and 11, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 7 and 9, 2'-deoxy nucleotides are located at position 11, and 2'-methoxy modified nucleotides are located at the remaining positions; or, 2'-fluoro modified nucleotides are located at positions 7, 9 and 11, and 2'-methoxy modified nucleotides are located at the remaining positions; or, 2'-fluoro modified nucleotides are located at positions 7, 11, 13 and 15, and 2'-methoxy modified nucleotides are located at the remaining positions; or, 2'-fluoro modified nucleotides are located at positions 8, 9, 10 and 12, and 2'-methoxy modified nucleotides are located at the remaining positions; or, 2'-fluoro modified nucleotides are located at positions 7, 9, 11, 13 and 15, and 2'-methoxy modified nucleotides are located at the remaining positions 2'-methoxy modified nucleotides are located at positions 9, 11 and 13, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 7, 9, 11 and 13, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 7, 8 and 9, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 9, 11 and 13, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 7, 9 and 11, and the remaining positions are 2'-methoxy modified nucleotides. nucleotides; or, 2'-fluoro modified nucleotides are located at positions 7, 11 and 13, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 7, 11, 12 and 13, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 16, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 17, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 7, 11, 16 and 17, and the remaining positions are 2'-methoxy modified nucleotides; and / or

[0075] In the antisense strand, from 5' to 3' direction, 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16, position 7 is a GNA modified nucleotide, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides Nucleotides at positions 2, 14 and 16, and 2'-methoxy modified nucleotides at the remaining positions; or, 2'-fluoro modified nucleotides at positions 2, 14 and 16, a GNA modified nucleotide at position 6, and 2'-methoxy modified nucleotides at the remaining positions; or, 2'-fluoro modified nucleotides at positions 2, 6 and 14, and 2'-methoxy modified nucleotides at the remaining positions; or, 2'-fluoro modified nucleotides at positions 2, 3, 5, 8, 10, 14, 16 and 18, and 2'-methoxy modified nucleotides at the remaining positions ; Alternatively, 2'-fluoro modified nucleotides are located at positions 2, 3, 4, 5, 7, 10 and 14, and the remaining positions are 2'-methoxy modified nucleotides; Alternatively, 2'-fluoro modified nucleotides are located at positions 2, 3, 4, 5, 7, 10 and 14, position 6 is a GNA modified nucleotide, and the remaining positions are 2'-methoxy modified nucleotides; Alternatively, 2'-fluoro modified nucleotides are located at positions 2, 4, 6, 12, 14, 16, 18 and 20, and the remaining positions are 2'-methoxy modified nucleotides; Alternatively, 2'-fluoro modified The nucleotides are located at the 2nd and 14th positions, and the remaining positions are 2'-methoxy modified nucleotides; alternatively, the 2'-fluoro modified nucleotides are located at the 2nd, 4th, 5th, 6th, 8th, 10th, 12th, 14th, 16th, 18th and 20th positions, and the remaining positions are 2'-methoxy modified nucleotides; alternatively, the 2'-fluoro modified nucleotides are located at the 2nd, 7th, 10th and 14th positions, and the remaining positions are 2'-methoxy modified nucleotides; alternatively, the 2'-fluoro modified nucleotides are located at the 2nd, 5th, 7th and 14th positions, and the remaining positions are 2'-methoxy modified nucleotides.

[0076] In a preferred embodiment, according to the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; according to the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides. In a preferred embodiment, according to the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; according to the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 2nd, 6th, 8th, 9th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides. In a preferred embodiment, according to the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; according to the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, the GNA modified nucleotides are located at the 7th position of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides. In a preferred embodiment, according to the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; according to the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 2nd, 14th and 16th positions of the antisense strand, the GNA modified nucleotides are located at the 6th position of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides.

[0077] In some embodiments, at least one of the following linkages between nucleotides in the siRNA is a phosphorothioate linkage:

[0078] The connection between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0079] The connection between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand;

[0080] The connection between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand;

[0081] The connection between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand;

[0082] The ligation between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand;

[0083] The ligation between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand;

[0084] The connection between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand;

[0085] The linkage starts from the 2nd nucleotide and the 3rd nucleotide at the 3' end of the antisense strand.

[0086] In some embodiments, the siRNA, along the 5' end to the 3' end direction, the sense strand comprises a phosphorothioate group located at the following positions:

[0087] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0088] Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand;

[0089] Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand;

[0090] Between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand;

[0091] or,

[0092] The sense strand contains phosphorothioate groups located at the positions shown below:

[0093] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0094] The positive strand is located between the second nucleotide and the third nucleotide starting from the 5' end.

[0095] In some embodiments, the antisense strand of the siRNA comprises a phosphorothioate group located at the following positions along the 5' end to the 3' end:

[0096] Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand;

[0097] Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand;

[0098] Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand;

[0099] The antisense strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

[0100] In one embodiment, any one nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide or a combination of any two or more thereof.

[0101] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0102] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0103] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0104] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0105] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the GNA-modified nucleotides are located at position 7 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0106] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the GNA-modified nucleotides are located at position 7 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0107] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 14 and 16 of the antisense strand, the GNA-modified nucleotides are located at position 6 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0108] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 14th and 16th positions of the antisense strand, the GNA-modified nucleotides are located at the 6th position of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to the 5' phosphate group.

[0109] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0110] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0111] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0112] In a preferred embodiment, from 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 5'-terminal nucleotide of the antisense strand is connected to a 5'-trans vinyl phosphonate group.

[0113] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0114] In a preferred embodiment, from 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 5'-terminal nucleotide of the antisense strand is connected to a 5'-trans vinyl phosphonate group.

[0115] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6 and 14 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0116] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 5, 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0117] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0118] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 8, 9 and 10 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0119] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 3, 5, 8, 10, 14, 16 and 18 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0120] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 3, 4, 5, 7, 10 and 14 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0121] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 8, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 3, 4, 5, 7, 10 and 14 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0122] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 4, 6, 12, 14, 16, 18 and 20 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0123] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2 and 14 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0124] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7 and 9 of the sense strand, the 11th position is a 2'-deoxy nucleotide, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, 18 and 20 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0125] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7 and 9 of the sense strand, the 11th position is a 2'-deoxy nucleotide, and the remaining positions are 2'-methoxy modified nucleotides; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0126] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0127] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0128] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 11, 13 and 15 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0129] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 8, 9, 10 and 12 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0130] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 11, 13 and 15 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0131] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 11, 13 and 15 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0132] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 9, 11 and 13 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0133] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 11 and 13 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0134] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 11 and 13 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0135] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0136] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 3, 7, 8 and 9 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0137] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 9, 11 and 13 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0138] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 7, 9 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0139] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 3, 7, 9 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0140] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 11 and 13 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0141] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 11, 12 and 13 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0142] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 16 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0143] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 17 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0144] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 7, 11, 16 and 17 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0145] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 3, 4, 5, 7, 10 and 14 of the antisense strand, the 6th position is a GNA modified nucleotide, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0146] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 7, 10 and 14 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0147] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 5, 7 and 14 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0148] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 3, 7, 8 and 9 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 7, 10 and 14 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group;

[0149] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 7th, 9th and 11th positions of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 7th, 10th and 14th positions of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0150] In one embodiment, any one nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide or a combination of any two or more thereof.

[0151] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, between the 1st nucleotide and the 2nd nucleotide at the 5' end, between the 2nd nucleotide and the 3rd nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, between the 1st nucleotide and the 2nd nucleotide at the 5' end, between the 2nd nucleotide and the 3rd nucleotide at the 5' end, between the 1st nucleotide and the 2nd nucleotide at the 3' end, and between the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0152] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st and 2nd nucleotides at the 5' end, the 2nd and 3rd nucleotides at the 5' end, the 1st and 2nd nucleotides at the 3' end, and the 2nd and 3rd nucleotides at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st and 2nd nucleotides at the 5' end, the 2nd and 3rd nucleotides at the 5' end, the 1st and 2nd nucleotides at the 3' end, and the 2nd and 3rd nucleotides at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0153] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, between the 1st nucleotide and the 2nd nucleotide at the 5' end, between the 2nd nucleotide and the 3rd nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 8th, 9th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, between the 1st nucleotide and the 2nd nucleotide at the 5' end, between the 2nd nucleotide and the 3rd nucleotide at the 5' end, between the 1st nucleotide and the 2nd nucleotide at the 3' end, and between the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0154] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st and 2nd nucleotides at the 5' end, the 2nd and 3rd nucleotides at the 5' end, the 1st and 2nd nucleotides at the 3' end, and the 2nd and 3rd nucleotides at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 8th, 9th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st and 2nd nucleotides at the 5' end, the 2nd and 3rd nucleotides at the 5' end, the 1st and 2nd nucleotides at the 3' end, and the 2nd and 3rd nucleotides at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0155] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, between the 1st nucleotide and the 2nd nucleotide at the 5' end, between the 2nd nucleotide and the 3rd nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, the GNA-modified nucleotide is located at the 7th position of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, between the 1st nucleotide and the 2nd nucleotide at the 5' end, between the 2nd nucleotide and the 3rd nucleotide at the 5' end, between the 1st nucleotide and the 2nd nucleotide at the 3' end, and between the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0156] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, the GNA modified nucleotide is located at the 7th position of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0157] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, between the 1st nucleotide and the 2nd nucleotide at the 5' end, between the 2nd nucleotide and the 3rd nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 14th and 16th positions of the antisense strand, the GNA-modified nucleotide is located at the 6th position of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, between the 1st nucleotide and the 2nd nucleotide at the 5' end, between the 2nd nucleotide and the 3rd nucleotide at the 5' end, between the 1st nucleotide and the 2nd nucleotide at the 3' end, and between the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0158] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 2nd, 14th and 16th positions of the antisense strand, the GNA modified nucleotide is located at the 6th position of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group.

[0159] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0160] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, and the second nucleotide and the third nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0161] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 8th, 9th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0162] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is connected to a 5'-trans vinyl phosphonate group.

[0163] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, and the second nucleotide and the third nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 8th, 9th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0164] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 2nd, 6th, 8th, 9th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is connected to a 5'-trans vinyl phosphonate group.

[0165] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th and 14th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0166] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 5th, 7th, 8th and 9th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0167] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st and 2nd nucleotides at the 5' end, the 2nd and 3rd nucleotides at the 5' end, the 1st and 2nd nucleotides at the 3' end, and the 2nd and 3rd nucleotides at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st and 2nd nucleotides at the 5' end, the 2nd and 3rd nucleotides at the 5' end, the 1st and 2nd nucleotides at the 3' end, and the 2nd and 3rd nucleotides at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0168] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 8th, 9th and 10th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0169] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro The nucleotides modified with 2'-methoxy groups are located at the 2nd, 3rd, 5th, 8th, 10th, 14th, 16th and 18th positions of the antisense chain, and the remaining positions are 2'-methoxy-modified nucleotides. The first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense chain is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0170] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 3rd, 4th, 5th, 7th, 10th and 14th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0171] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 8th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 3rd, 4th, 5th, 7th, 10th and 14th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0172] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; The modified nucleotides are located at the 2nd, 4th, 6th, 12th, 14th, 16th, 18th and 20th positions of the antisense chain, and the remaining positions are 2'-methoxy-modified nucleotides. The first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense chain is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0173] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd and 14th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0174] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at the 7th and 9th positions of the sense strand, the 11th position is a 2'-deoxy nucleotide, and the remaining positions are 2'-methoxy modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro The nucleotides modified with 2'-methoxy groups are located at the 2nd, 4th, 5th, 6th, 8th, 10th, 12th, 14th, 16th, 18th and 20th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides. The first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0175] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th and 9th positions of the sense strand, the 11th position is a 2'-deoxynucleotide, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0176] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st and 2nd nucleotides at the 5' end, the 2nd and 3rd nucleotides at the 5' end, the 1st and 2nd nucleotides at the 3' end, and the 2nd and 3rd nucleotides at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st and 2nd nucleotides at the 5' end, the 2nd and 3rd nucleotides at the 5' end, the 1st and 2nd nucleotides at the 3' end, and the 2nd and 3rd nucleotides at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0177] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th and 11th positions of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, the 1st nucleotide and the 2nd nucleotide at the 5' end, and the 2nd nucleotide and the 3rd nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0178] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 11th, 13th and 15th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0179] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 8th, 9th, 10th and 12th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0180] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 11th, 13th and 15th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0181] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 11th, 13th and 15th positions of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, and the second nucleotide and the third nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0182] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 9th, 11th and 13th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0183] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 11th and 13th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0184] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 11th and 13th positions of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, the 1st nucleotide and the 2nd nucleotide at the 5' end, and the 2nd nucleotide and the 3rd nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0185] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 7th, 8th and 9th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0186] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 7th, 8th and 9th positions of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, and the second nucleotide and the third nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0187] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 9th, 11th and 13th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0188] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 7th, 9th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0189] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 7th, 9th and 11th positions of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, and the second nucleotide and the third nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0190] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 11th and 13th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0191] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 11th, 12th and 13th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0192] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 7th, 11th and 16th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0193] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 7th, 11th and 17th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0194] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 7th, 11th, 16th and 17th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, and the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0195] In a preferred embodiment, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups; The nucleotides are located at the 2nd, 3rd, 4th, 5th, 7th, 10th and 14th positions of the antisense chain, the 6th position is a GNA-modified nucleotide, and the remaining positions are 2'-methoxy-modified nucleotides. The first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense chain is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0196] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, the 1st nucleotide and the 2nd nucleotide at the 5' end, and the 2nd nucleotide and the 3rd nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 7th, 10th and 14th positions of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0197] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th, 10th and 11th positions of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, the 1st nucleotide and the 2nd nucleotide at the 5' end, and the 2nd nucleotide and the 3rd nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 5th, 7th and 14th positions of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, the 1st nucleotide and the 2nd nucleotide at the 5' end, the 2nd nucleotide and the 3rd nucleotide at the 5' end, the 1st nucleotide and the 2nd nucleotide at the 3' end, and the 2nd nucleotide and the 3rd nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0198] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 7th, 8th and 9th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, and the second nucleotide and the third nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 7th, 10th and 14th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0199] In a preferred embodiment, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 3rd, 7th, 9th and 11th positions of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, and the second nucleotide and the third nucleotide at the 5' end are connected by thiophosphate groups, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 7th, 10th and 14th positions of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, the first nucleotide and the second nucleotide at the 5' end, the second nucleotide and the third nucleotide at the 5' end, the first nucleotide and the second nucleotide at the 3' end, and the second nucleotide and the third nucleotide at the 3' end are connected by thiophosphate groups, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0200] In a specific embodiment, the present invention provides an siRNA selected from Table 1; preferably, the siRNA is selected from N-FY001003, N-FY001003M2, N-FY001003D2, N-FY001003M2D2, N-FY001003M3, N-FY001003M4, N-FY001003M5, N-FY001003M6, N-FY001003M6D2, N-FY001003M7, N-FY001003M8, N-FY001003M9, N-FY001003M10, N-FY001003M11, N-FY001003M12, N-FY001003M13, N-FY001003M14, N-FY001003M15, N-FY001003M16, N-FY001003M17, N-FY001003M18, N-FY001003M19, N-FY001003M2 01003M7D2, N-FY001003M8, N-FY001003M9, N-FY001003M10, N-FY001003M11, N-FY001003M12, N-FY001003M 13. N-FY001003M14, N-FY001003M15, N-FY001003M16, N-FY001003M17, N-FY001003M18, N-FY001003M19, N-F Y001003M20, N-FY001003M21, N-FY001003M21D2, N-FY001003M22, N-FY001003M23, N-FY001003M24, N-FY00 1003M24D2, N-FY001003M25, N-FY001003M26, N-FY001003M26D2, N-FY001003M27, N-FY001003M27D2, N-FY0 01003M28, N-FY001003M29, N-FY001003M29D2, N-FY001003M30, N-FY001003M31, N-FY001003M32, N-FY0010 03M33, N-FY001003M34, N-FY001003M35, N-FY001003M37, N-FY001003M40, N-FY001003M44, N-FY001003M45.

[0201] In a second aspect, the present invention further provides a siRNA conjugate or a prodrug thereof, wherein the siRNA conjugate contains the siRNA of the present invention, and a conjugated group conjugated to the siRNA (as shown below, the double helix structure represents the siRNA, and the conjugated group is connected to the 3' end of the sense strand of the siRNA):

[0202]

[0203] In the above conjugate structure, X can be selected as O or S. In one embodiment, X is O.

[0204] In one embodiment, the conjugate group comprises a pharmaceutically acceptable targeting group and a linker, and the siRNA, the linker and the targeting group are sequentially covalently or non-covalently linked;

[0205] Preferably, in the siRNA conjugate, the sense strand and the antisense strand of the siRNA are complementary to each other to form a double-stranded region of the siRNA conjugate, and the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region;

[0206] or,

[0207] In the siRNA conjugate, the sense strand and the antisense strand of the siRNA are complementary to each other to form a double-stranded region of the siRNA conjugate, and the 3' end of the sense strand forms a blunt end, while the 3' end of the antisense strand forms a blunt end.

[0208] In one embodiment, the conjugated group is selected from any one of the group consisting of formula (I) to formula (VIII):

[0209]

[0210]

[0211] In a specific embodiment, the siRNA conjugate is a siRNA conjugate selected from Table 2; preferably, the siRNA conjugate is selected from N-FY001003M2L96, N-FY001003M3L96, N-FY001003M6L96, N-FY001003M7L96, N-FY001003M8L96, N-FY001003M9L96, N-FY001003M10L96, N-FY 001003M11L96, N-FY001003M12L96, N-FY001003M13L96, N-FY001003M14L96, N-FY001003M15L96, N-F Y001003M16L96, N-FY001003M17L96, N-FY001003M18L96, N-FY001003M19L96, N-FY001003M20L96, N-F Y001003M21L96, N-FY001003M22L96, N-FY001003M23L96, N-FY001003M24L96, N-FY001003M25L96, N- FY001003M26L96, N-FY001003M27L96, N-FY001003M28L96, N-FY001003M29L96, N-FY001003M30L96, N- FY001003M31L96, N-FY001003M32L96, N-FY001003M33L96, N-FY001003M34L96, N-FY001003M35L96, N- FY001003M37L96, N-FY001003M40L96, N-FY001003M44L96, N-FY001003M45L96, N-FY001003M6L96B-1.

[0212] In a third aspect, the present invention further provides a pharmaceutical composition comprising the siRNA of the present invention, or the siRNA conjugate of the present invention or a prodrug thereof, and a pharmaceutically acceptable carrier.

[0213] In a fourth aspect, the present invention further provides a kit comprising the siRNA of the present invention, or the siRNA conjugate of the present invention or a prodrug thereof, or the pharmaceutical composition of the present invention.

[0214] In a fifth aspect, the present invention further provides use of the siRNA of the present invention, or the siRNA conjugate of the present invention or its prodrug, or the pharmaceutical composition of the present invention for preparing a medicament for inhibiting the expression of the DGAT2 gene.

[0215] In a sixth aspect, the present invention further provides use of the siRNA of the present invention, or the siRNA conjugate of the present invention or its prodrug, or the pharmaceutical composition of the present invention for preparing a medicament for preventing and / or treating diseases associated with overexpression of the DGAT2 gene.

[0216] In a specific embodiment, the disease is selected from the group consisting of non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, alcoholic fatty liver, obesity, hepatic steatosis, fatty liver, hyperlipidemia.

[0217] In a seventh aspect, the present invention also provides a method for inhibiting DGAT2 gene expression, comprising contacting a therapeutically effective amount of the siRNA of the present invention, or the siRNA conjugate of the present invention or its prodrug, or the pharmaceutical composition of the present invention with a cell expressing DGAT2 or administering it to a subject in need thereof.

[0218] In an eighth aspect, the present invention also provides a method for treating and / or preventing diseases associated with DGAT2 gene overexpression, comprising administering a therapeutically effective amount of the siRNA of the present invention, or the siRNA conjugate of the present invention or its prodrug, or the pharmaceutical composition of the present invention to a subject in need.

[0219] In a specific embodiment, the disease is selected from the group consisting of non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, alcoholic fatty liver, obesity, hepatic steatosis, fatty liver, hyperlipidemia.

[0220] In a ninth aspect, the present invention further provides the siRNA of the present invention, or the siRNA conjugate of the present invention or a prodrug thereof, or the pharmaceutical composition of the present invention for use as a drug.

[0221] In a tenth aspect, the present invention further provides the siRNA of the present invention, or the siRNA conjugate of the present invention or its prodrug, or the pharmaceutical composition of the present invention for use in treatment.

[0222] Beneficial Effects

[0223] The siRNA, siRNA conjugate and pharmaceutical composition containing the same provided by the present invention show excellent DGAT2 gene expression inhibition activity in in vitro cell experiments, and have good potential for treating diseases related to DGAT2 gene overexpression. For example, the siRNA and its conjugate provided by the present invention can reduce the expression of DGAT2 mRNA in the liver, have low toxicity and side effects, good plasma stability, and have good clinical application prospects.

[0224] The siRNA provided by the present invention shows a good inhibitory effect on the DGAT2 gene in HepG2 cells. In some specific embodiments, the siRNA of the present invention can significantly inhibit the expression of the DGAT2 gene at 1 nM and 0.01 nM, wherein the 24h inhibition rate at 1 nM is as high as 95.24%, and the 24h inhibition rate at 0.01 nM is as high as 83.65%.

[0225] In some specific embodiments, the siRNA conjugates provided by the present invention have high DGAT2 gene inhibition activity in PHH cells. For example, when the siRNA conjugates enter PHH by transfection, the inhibition rate of 5 nM can be as high as 97.01%; when the siRNA conjugates enter PHH by free uptake, the inhibition rate of 200 nM can be as high as 95.32%. DETAILED DESCRIPTION

[0226] definition

[0227] Throughout the specification, unless otherwise specified, in the technical field, "G", "C", "A", "T" and "U" generally represent the bases of guanine, cytosine, adenine, thymine and uracil, respectively, but it is also generally known in the art that "G", "C", "A", "T" and "U" each generally also represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively, which is a common way to represent deoxyribonucleic acid sequences and / or ribonucleic acid sequences. Therefore, in the context of the present disclosure, the meanings represented by "G", "C", "A", "T" and "U" include the above-mentioned various possible situations, and "nucleotide" and "ribonucleotide" are used interchangeably herein. Lowercase letters a, u, c, g: indicate 2'-methoxy modified nucleotides; Af, Gf, Cf, Uf: indicate 2'-fluoro modified nucleotides; d: indicates that the nucleotide adjacent to the right of the letter d is a 2'-deoxyribonucleotide; lowercase letter s indicates that the two nucleotides adjacent to the left and right of the letter s are connected by thiophosphate groups; P1: indicates that the nucleotide adjacent to the right of P1 is a 5'-phosphate nucleotide; EVP: indicates that the nucleotide adjacent to the right of EVP is a 5'-trans-vinylphosphonate nucleotide; (Underline + Bold + Italic): indicates GNA-modified nucleotides.

[0228] In the above and below, the "2'-fluoro modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by fluorine. "Non-fluorinated modified nucleotide" refers to a nucleotide or nucleotide analog in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by a non-fluorinated group. In some embodiments, each non-fluorinated modified nucleotide is independently selected from one of the nucleotides or nucleotide analogs in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by a non-fluorinated group. The nucleotides in which the hydroxyl group at the 2' position of these ribose groups is replaced by a non-fluorinated group are well known to those skilled in the art, and these nucleotides can be selected from one of 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxy nucleotides.

[0229] "Alkyl" includes straight chain, branched chain or cyclic saturated alkyl. For example, alkyl includes but is not limited to methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl and the like. Exemplary, "C 1-6 The "C" in "alkyl" 1-6 ” refers to a group containing 1, 2, 3, 4, 5 or 6 carbon atoms in a straight chain, branched chain or cyclic form.

[0230] "Alkoxy" refers herein to an alkyl group attached to the remainder of the molecule via an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, and the like.

[0231] "Nucleotide analogs" refer to groups that can replace nucleotides in nucleic acids but have structures different from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides or thymine deoxyribonucleotides, such as isonucleotides, bridged nucleic acids (BNAs) or acyclic nucleotides.

[0232] BNA refers to a constrained or inaccessible nucleotide. BNA may contain a five-membered ring, a six-membered ring, or a seven-membered ring with a "fixed" C3'-endosugar condensed bridge structure. The bridge is usually incorporated into the 2'-, 4'-position of the ribose to provide a 2', 4'-BNA nucleotide, such as LNA, ENA, cET BNA, etc., wherein LNA is shown in formula (1), ENA is shown in formula (2), and cET BNA is shown in formula (3):

[0233]

[0234] Acyclic nucleotides are a type of nucleotides formed by opening the sugar ring of a nucleotide, such as unlocked nucleic acid (UNA) or glycerol nucleic acid (GNA), wherein UNA is shown in formula (4) and GNA is shown in formula (5):

[0235]

[0236] In the above formula (4) and formula (5), R is selected from H, OH or alkoxy (O-alkyl).

[0237] Isonucleotides refer to compounds formed by a change in the position of the base on the ribose ring of a nucleotide, for example, a compound formed by the base moving from the 1'-position to the 2'-position or the 3'-position of the ribose ring, as shown in formula (6) or (7):

[0238]

[0239] In the compounds of formula (6) and formula (7), Base represents a base, such as A, U, G, C or T; and R is selected from H, OH, F or the non-fluorine group as described above.

[0240] In some embodiments, the nucleotide analog is selected from one of isonucleotides, LNA, ENA, cET BNA, UNA and GNA. In some embodiments, each non-fluorinated modified nucleotide is a 2'-methoxy modified nucleotide, a GNA modified nucleotide or a combination of any two or more thereof. In some preferred embodiments, each non-fluorinated modified nucleotide is a 2'-methoxy modified nucleotide, and in the above and below, the 2'-methoxy modified nucleotide refers to a nucleotide formed by replacing the 2'-hydroxyl of the ribose group with a methoxy group.

[0241] The "2'-methoxy modified nucleotide" refers to a nucleotide in which the 2'-hydroxyl group of the ribose group is replaced by a methoxy group. The "phosphorothioate group" refers to a phosphorothioate group in which one oxygen atom in the phosphodiester bond of the phosphate group is replaced by a sulfur atom.

[0242] The "phosphorothioate group" refers to the following formula:

[0243]

[0244] The "5'-phosphate nucleotide" refers to the structure of the following formula:

[0245]

[0246] In the context of this specification, the expressions "complementary" and "reverse complementary" can be used interchangeably and have the meanings known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one chain are each paired with the bases on the other chain in a complementary manner. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (G) is always paired with the pyrimidine base cytosine (C). Each base pair includes a purine and a pyrimidine. When adenine on one chain is always paired with thymine (or uracil) on the other chain, and guanine is always paired with cytosine, the two chains are considered to be complementary to each other, and the sequence of the chain can be inferred from the sequence of its complementary chain. Correspondingly, "mismatch" means in the art that in a double-stranded nucleic acid, the bases at corresponding positions are not paired in a complementary form.

[0247] In the above and below, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that there are no more than 1 base mismatch between the two nucleotide sequences; and "completely reverse complementary" means that there are no base mismatches between the two nucleotide sequences.

[0248] In the above and below, "nucleotide difference" between one nucleotide sequence and another nucleotide sequence means that the base type of the nucleotide at the same position of the former is changed compared with the latter. For example, when a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position of the former is U, C, G or T, it is considered that there is a nucleotide difference at that position between the two nucleotide sequences. In some embodiments, when a nucleotide at the original position is replaced by an abasic nucleotide or its equivalent, it can also be considered that a nucleotide difference occurs at that position.

[0249] In this context, "overhang" refers to one or more unpaired nucleotides that protrude from the duplex structure of the siRNA when a 3' end of one strand of the siRNA extends beyond the 5' end of the other strand, or vice versa. "Blunt end" or "blunt end" means that there are no unpaired nucleotides at that end of the siRNA, i.e., no nucleotide overhang. A "blunt-ended" siRNA is one that is double-stranded throughout its length, i.e., has no nucleotide overhangs at either end of the molecule.

[0250] In the above and below of the present specification, especially when describing the preparation method of the siRNA, pharmaceutical composition or siRNA conjugate of the present invention, unless otherwise specified, the nucleoside monomer refers to the modified or unmodified nucleoside phosphoramidite monomer used in the solid phase phosphoramidite synthesis according to the type and order of nucleotides in the siRNA or siRNA conjugate to be prepared. Solid phase phosphoramidite synthesis is a method used in RNA synthesis known to those skilled in the art. The nucleoside monomers used in the present invention are all commercially available.

[0251] In the context of the present invention, unless otherwise specified, "conjugation" refers to the connection between two or more chemical moieties, each having a specific function, in a covalently linked manner; accordingly, "conjugate" refers to a compound formed by covalently linking the chemical moieties. Further, "siRNA conjugate" means a compound formed by covalently linking one or more chemical moieties having a specific function to siRNA. Depending on the context, siRNA conjugates should be understood as a general term for multiple siRNA conjugates or an siRNA conjugate shown in a certain chemical formula. In the context of the present specification, "conjugated molecule" should be understood as a specific compound that can be conjugated to siRNA through a reaction to ultimately form the siRNA conjugate of the present invention.

[0252] In this context, the term "metabolite" refers to an active product produced by in vivo metabolism of the siRNA conjugate of the present invention. Such a product may be produced, for example, by dephosphorylation of the 5' end of the antisense strand of the administered siRNA conjugate and / or removal of a nucleotide from the 3' end. Therefore, the present invention includes metabolites of the siRNA conjugate of the present invention, including products produced by a method of contacting the siRNA conjugate of the present invention with a mammal for a period of time sufficient to obtain its metabolites.

[0253] The siRNA conjugates provided by the present invention also exist in the form of prodrugs. The prodrugs of the siRNA conjugates described herein are easily chemically changed under physiological conditions to be converted into the siRNA conjugates of the present invention. Any substance that can be converted in vivo to provide a biologically active substance (i.e., the siRNA conjugates provided by the present invention) is a prodrug within the scope and spirit of the present invention. For example, in the present application, the M6 ​​conjugate is a prodrug of the M2 conjugate. The difference in modification between the M2 conjugate and the M6 ​​conjugate is whether there is P1 at the 5' end of the antisense strand. The M6 ​​conjugate without P1 will be phosphorylated in vivo to become an M2 conjugate sequence with P1, thereby exerting its effect. Similarly, the relationship between the M7 conjugate and the M3 conjugate is also the same. Therefore, the present invention includes the prodrug corresponding to the siRNA conjugate.

[0254] Various hydroxyl protecting groups can be used in the present invention. In general, the protecting group makes the chemical functional group insensitive to specific reaction conditions, and can be attached and removed from the functional group in the molecule without substantially damaging the rest of the molecule. In some embodiments, the protecting group is stable under alkaline conditions, but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used in the present invention include monomethoxytrityl, 9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used in the present invention include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl) and TMTr (4,4',4"-trimethoxytrityl).

[0255] As used herein, "optional" or "optionally" means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0256] The term "subject", as used in this specification, refers to any animal, such as a mammal or a marsupial. The subject of the present invention includes, but is not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, rabbits, or any kind of poultry.

[0257] As used herein, "treatment" refers to a method of obtaining a beneficial or desired result, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. In addition, a therapeutic benefit is obtained by eradication or amelioration of one or more physiological symptoms associated with the underlying disorder, thereby observing an improvement in the subject, although the subject may still be afflicted with the underlying disorder.

[0258] As used herein, "prevention" refers to an approach to obtaining beneficial or desired results, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit," siRNA, siRNA conjugates, or pharmaceutical compositions may be administered to a subject at risk for a particular disease, or to a subject reporting one or more physiological symptoms of a disease, even though a diagnosis of the disease may not have been made.

[0259] siRNA

[0260] The present invention relates to a siRNA capable of inhibiting the expression of the DGAT2 gene. The siRNA of the present invention contains a nucleotide group as a basic structural unit, and it is well known to those skilled in the art that the nucleotide group contains a phosphate group, a ribose group and a base. Usually, the length of an active, i.e., functional siRNA is about 12-40 nucleotides, and in some embodiments, about 15-30 nucleotides.

[0261] The siRNA of the present invention contains a sense strand and an antisense strand, and each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleotide sequence I, and the antisense strand contains a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially reverse-complemented to form a double-stranded region. In some embodiments, the length of the double-stranded region is 15-30 nucleotide pairs. In other embodiments, the length of the double-stranded region is 17-23 nucleotide pairs. In other embodiments, the length of the double-stranded region is 19-21 nucleotide pairs. In yet other embodiments, the length of the double-stranded region is 19 or 21 nucleotide pairs.

[0262] In some embodiments, the sense strand further contains nucleotide sequence III, the antisense strand further contains nucleotide sequence IV, the length of nucleotide sequence III and nucleotide sequence IV is independently 0-11 nucleotides, the nucleotide sequence III is connected to the 5' end of nucleotide sequence I, the nucleotide sequence IV is connected to the 3' end of nucleotide sequence II, the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences. In some embodiments, the sense strand further contains nucleotide sequence III, the antisense strand further contains nucleotide sequence IV, the length of nucleotide sequence III and nucleotide sequence IV is independently 0-11 nucleotides, the nucleotide sequence III is connected to the 3' end of nucleotide sequence I, the nucleotide sequence IV is connected to the 5' end of nucleotide sequence II, the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences. In some embodiments, the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV, the lengths of the nucleotide sequence III and the nucleotide sequence IV are each independently 0-11 nucleotides, the nucleotide sequence III is connected to the 5' end of the nucleotide sequence I, the nucleotide sequence IV is connected to the 3' end of the nucleotide sequence II, the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; and the nucleotide sequence III is connected to the 3' end of the nucleotide sequence I, the nucleotide sequence IV is connected to the 5' end of the nucleotide sequence II, the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than one base mismatch between the two nucleotide sequences; and completely reverse complementary means that there is no mismatch between the two nucleotide sequences.

[0263] In some embodiments, the sense strand further contains a nucleotide sequence V and / or the antisense strand further contains a nucleotide sequence VI, the length of the nucleotide sequences V and VI is 0 to 3 nucleotides, the nucleotide sequence V is connected to the 3' end of the sense strand to form the 3' overhang of the sense strand, and / or the nucleotide sequence VI is connected to the 3' end of the antisense strand to form the 3' overhang of the antisense strand. In some embodiments, the length of the nucleotide sequence V or VI is 2 nucleotides. In other embodiments, the nucleotide sequence V or VI is two consecutive thymine deoxyribonucleotides or two consecutive uracil ribonucleotides. In other embodiments, the nucleotide sequence V or VI is mismatched or complementary to the nucleotides at the corresponding positions of the target mRNA.

[0264] The lengths of the sense strand and the antisense strand provided by the present invention are the same or different. In some embodiments, the sense strand or the antisense strand has 15-30 nucleotides. In other embodiments, the sense strand or the antisense strand has 19-25 nucleotides. In other embodiments, the sense strand or the antisense strand has 19-23 nucleotides. The length ratio of the sense strand and the antisense strand of the siRNA provided by the present invention can be 15 / 15, 16 / 16, 17 / 17, 18 / 18, 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 20 / 19, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 21 / 19, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 22 / 19, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 23 / 19, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 24 / 24, 25 / 25, 26 / 26, 27 / 27, 28 / 28, 29 / 29, 30 / 30, 22 / 24, 22 / 25, 22 / 26, 23 / 24, 23 / 25 or 23 / 26, etc. In some embodiments, the length ratio of the siRNA sense strand to the antisense strand is 19 / 19, 21 / 21, 19 / 21, 21 / 23 or 23 / 23. At this time, the siRNA disclosed in the present invention has better cell mRNA silencing activity.

[0265] Studies have found that different modification strategies can have very different effects on siRNA stability, biological activity, cytotoxicity and other indicators. For example, CN102140458B studied various chemical modification strategies for siRNA and confirmed 7 effective modification methods. Compared with unmodified siRNA, one of the modified methods produced siRNA that improved blood stability while maintaining inhibitory activity that was basically equivalent to that of unmodified siRNA.

[0266] The nucleotides in the siRNA of the present invention are each independently a modified or unmodified nucleotide. In some embodiments, each nucleotide in the siRNA of the present invention is an unmodified nucleotide; in some embodiments, some or all of the nucleotides in the siRNA of the present invention are modified nucleotides, and these modifications on the nucleotide groups do not significantly weaken or lose the function of the siRNA of the present invention in inhibiting the expression of the DGAT2 gene.

[0267] In some embodiments, the siRNA of the present invention contains at least one modified nucleotide. In the context of the present invention, the term "modified nucleotide" used refers to a nucleotide or nucleotide analog formed by replacing the 2' hydroxyl group of the ribose group of the nucleotide with other groups, or a nucleotide with a modified base. The modified nucleotide will not cause the function of siRNA to inhibit gene expression to be significantly weakened or lost. For example, the modified nucleotide disclosed in JK Watts, GF Deleavey, and M.J. Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13 (19-20): 842-55 can be selected.

[0268] In some embodiments, at least one nucleotide in the sense strand or the antisense strand of the siRNA provided by the present invention is a modified nucleotide, and / or at least one phosphate group is a phosphate group with a modified group; in other words, at least a portion of the phosphate group and / or ribose group in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand is a phosphate group with a modified group and / or a ribose group with a modified group. In some embodiments, the phosphate group with a modified group is a thiophosphate group formed by replacing one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom.

[0269] In some embodiments, the siRNA includes a sense strand without a 3' overhanging nucleotide; that is, the sense strand of the siRNA may have a 3' overhanging nucleotide, and the 3' overhanging nucleotide of the sense strand is excluded to form a blunt end. In some specific embodiments, the sense strand and antisense strand of the siRNA include the sequences shown in Table 1-1.

[0270] In some embodiments, when the nucleotide sequences of the sense strand and the antisense strand complement each other to form a double-stranded region, if there is no protruding nucleotide at the 3' end of the sense strand, a nucleotide sequence V is added to the 3' end of the sense strand as a protruding nucleotide. Then, after the nucleotide sequence formed by connecting the nucleotide sequence V to the 3' end of the sense strand is chemically modified, the nucleotide sequence V is excluded, and accordingly, the sense strand of the siRNA forms a blunt end.

[0271] In some embodiments, when the nucleotide sequences of the sense strand and the antisense strand are complementary to form a double-stranded region, and the 3' end of the sense strand has protruding nucleotides extending out of the double-stranded region, the protruding nucleotides at the 3' end of the sense strand are excluded and used as the nucleotide sequence of the sense strand, and accordingly, the sense strand of the siRNA forms a blunt end.

[0272] In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate-derived group.

[0273] An exemplary 5' phosphate group has the structure: The structures of the 5' phosphate derivative group include but are not limited to: wait.

[0274] The 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group or a 5' phosphate derivative group to form the following structure:

[0275]

[0276] Wherein, Base represents a base, such as A, U, G, C or T. R' is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, the substituted modified nucleotide can be a 2'-fluoro (2'-F) modified nucleotide, a 2'-alkoxy modified nucleotide, a 2'-substituted alkoxy modified nucleotide, a 2'-alkyl modified nucleotide, a 2'-substituted alkyl modified nucleotide, a 2'-amino modified nucleotide, a 2'-substituted amino modified nucleotide, or a 2'-deoxy nucleotide.

[0277] In some embodiments, the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group, and its structure is shown in Formula (X):

[0278]

[0279] Wherein, Base represents a base, such as A, U, G, C or T. R is hydroxyl or hydrogen or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, 2'-deoxynucleotide.

[0280] Exemplary modified nucleotides have the following structures:

[0281]

[0282] Wherein, Base represents a base, such as A, U, G, C or T. The hydroxyl group at the 2' position of the ribose group is substituted by R. The hydroxyl group at the 2' position of these ribose groups can be substituted by various groups known to those skilled in the art, for example, the substituted modified nucleotides can be 2'-fluoro (2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, 2'-deoxy nucleotides.

[0283] In some embodiments, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe, 2'-O-CH3) modified nucleotide, and the like.

[0284] In some embodiments, the 2'-substituted alkoxy modified nucleotide is a 2'-methoxyethoxy (2'-O-CH2-CH2-O-CH3) modified nucleotide, a 2'-O-CH2-CH=CH2 modified nucleotide, and the like.

[0285] In some embodiments, the 2'-substituted alkyl modified nucleotide is a 2'-CH2-CH2-CH=CH2 modified nucleotide and the like.

[0286] In some embodiments, all nucleotides in the sense strand and / or the antisense strand are modified nucleotides. In some embodiments, each nucleotide in the sense strand and the antisense strand of the siRNA provided by the present invention is independently a 2'-fluoro-modified nucleotide or a non-fluoro-modified nucleotide. In some embodiments, each non-fluoro-modified nucleotide is a 2'-methoxy-modified nucleotide, a 2'-deoxynucleotide or a GNA-modified nucleotide, and the 2'-methoxy-modified nucleotide refers to a nucleotide formed by replacing the 2'-hydroxyl of the ribose group with a methoxy group.

[0287] In some embodiments, at least one of the following linkages between nucleotides in the siRNA is a phosphorothioate linkage:

[0288] The connection between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0289] The connection between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand;

[0290] The connection between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand;

[0291] The connection between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand;

[0292] The ligation between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand;

[0293] The ligation between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand;

[0294] The connection between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand;

[0295] The linkage starts from the 2nd nucleotide and the 3rd nucleotide at the 3' end of the antisense strand.

[0296] In some embodiments, the siRNA, along the 5' end to the 3' end direction, the sense strand comprises a phosphorothioate group located at the following positions:

[0297] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0298] Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand;

[0299] Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand;

[0300] Between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand;

[0301] or,

[0302] The sense strand contains phosphorothioate groups located at the positions shown below:

[0303] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0304] The positive strand is located between the second nucleotide and the third nucleotide starting from the 5' end.

[0305] In some embodiments, the antisense strand of the siRNA comprises a phosphorothioate group located at the following positions along the 5' end to the 3' end:

[0306] Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand;

[0307] Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand;

[0308] Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand;

[0309] The antisense strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

[0310] In one embodiment, any one nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide or a combination of any two or more thereof.

[0311] siRNA conjugate or prodrug thereof

[0312] The present invention relates to an siRNA conjugate or a prodrug thereof, wherein the siRNA conjugate contains the above siRNA and a conjugation group conjugated to the siRNA.

[0313] In the present invention, the sense strand and the antisense strand of the siRNA conjugate form a double-stranded region of the siRNA conjugate, and a blunt end is formed at the 3' end of the sense strand of the siRNA conjugate. In some embodiments, the 3' end of the sense strand of the siRNA conjugate forms a blunt end, and the 3' end of the antisense strand of the siRNA conjugate has 1-3 protruding nucleotides extending out of the double-stranded region. In other embodiments, the 3' end of the sense strand of the siRNA conjugate forms a blunt end, and the 3' end of the antisense strand of the siRNA conjugate forms a blunt end.

[0314] In some preferred embodiments, the siRNA conjugate is obtained by conjugating siRNA with a conjugating group, wherein the sense strand of the siRNA is complementary to the antisense strand to form a double-stranded region of the siRNA, and the 3' end of the sense strand of the siRNA forms a blunt end, and the conjugating group is conjugated with the 3' end of the sense strand having the blunt end to form the siRNA conjugate.

[0315] In some preferred embodiments, the 3' end of the sense strand of the siRNA has a protruding nucleotide extending out of the double-stranded region, and the sequence with a 3' blunt end formed after excluding the protruding nucleotides at the 3' end of the sense strand is used as the nucleotide sequence for connecting the conjugated group, and the conjugated group is connected to the 3' blunt end of the sense strand to form a siRNA conjugate.

[0316] In some more preferred embodiments, when the nucleotide sequences of the sense strand and the antisense strand complement each other to form a double-stranded region, if there is no protruding nucleotide at the 3' end of the sense strand, a nucleotide sequence V is added to the 3' end of the sense strand as a protruding nucleotide. The sequence with a 3' blunt end formed after the protruding nucleotide at the 3' end of the sense strand is excluded is used as a nucleotide sequence for connecting a conjugated group, and a conjugated group is connected to the 3' blunt end of the sense strand to form a siRNA conjugate.

[0317] In some more preferred embodiments, when the nucleotide sequences of the sense strand and the antisense strand are complementary to form a double-stranded region, and the 3' end of the sense strand has protruding nucleotides extending out of the double-stranded region, the sequence with a 3' blunt end formed after excluding the protruding nucleotides at the 3' end of the sense strand is used as the nucleotide sequence for connecting the conjugated group, and the conjugated group is connected to the 3' blunt end of the sense strand to form a siRNA conjugate.

[0318] Exemplarily, the siRNA sequence is as shown in N-FY001003M2, the 3' end of the sense chain of the siRNA has a protruding nucleotide extending out of the double-stranded region, and the ascscauaGfaCfUfAfuuugcuuu blunt-end sequence formed after excluding the protruding -scsa nucleotides at the 3' end of the sense chain is used as the nucleotide sequence for connecting the L96 conjugation group. Therefore, the sequence of the siRNA conjugate formed is: the sense chain is ascscauaGfaCfUfAfuuugcuuuL96, and the antisense chain is P1asAfsagcAfaauagucUfaUfggusgsu.

[0319] In general, the conjugated group includes at least one pharmaceutically acceptable targeting group, or further includes a linker, and the siRNA, the linker and the targeting group are connected in sequence. In some embodiments, the targeting group is 1-6. In some embodiments, the targeting group is 2-4. The siRNA molecule can be non-covalently or covalently conjugated to the conjugated group, for example, it can be covalently conjugated to the conjugated group. The conjugation site of siRNA and conjugated group can be at the 3' end or 5' end of the siRNA sense strand, also at the 5' end of the antisense strand, and can also be in the internal sequence of siRNA. In some embodiments, the conjugation site of siRNA and conjugated group is at the 3' end of the siRNA sense strand.

[0320] In some embodiments, the conjugated group can be connected to the phosphate group, 2'-hydroxyl group or base of the nucleotide. In some embodiments, the conjugated group can also be connected to the 3'-hydroxyl group, in which case the nucleotides are connected by a 2'-5' phosphodiester bond. When the conjugated group is connected to the end of the siRNA chain, the conjugated group is usually connected to the phosphate group of the nucleotide; when the conjugated group is connected to the internal sequence of the siRNA, the conjugated group is usually connected to the ribose sugar ring or the base. Various connection methods can be referred to in the literature: Muthiah Manoharanet.al.siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencingin vivo in hepatocytes.ACS Chemical biology, 2015, 10(5): 1181-7.

[0321] In some embodiments, the siRNA and the conjugated group can be connected by acid-labile or reducible chemical bonds, which can be degraded in the acidic environment of the cell endosome, thereby making the siRNA free. For non-degradable conjugation methods, the conjugated group can be connected to the sense strand of the siRNA, thereby minimizing the effect of conjugation on the activity of the siRNA.

[0322] In some embodiments, the pharmaceutically acceptable targeting group may be a ligand conventionally used in the field of siRNA administration, such as various ligands described in WO2009082607A2, which is incorporated herein by reference in its entirety.

[0323] In some embodiments, the pharmaceutically acceptable targeting group can be selected from one or more of the ligands formed by the following targeting molecules or their derivatives: lipophilic molecules, such as cholesterol, bile acid, vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as membrane-permeable peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); receptor ligands expressed by hepatic parenchymal cells, such as asialoglycoproteins, asialosugar residues, lipoproteins (such as high-density lipoproteins, low-density lipoproteins, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin, etc.

[0324] In some embodiments, each ligand is independently selected from a ligand that can bind to a cell surface receptor. In some embodiments, at least one ligand is a ligand that can bind to a hepatocyte surface receptor. In some embodiments, at least one ligand is a ligand that can bind to a mammalian cell surface receptor. In some embodiments, at least one ligand is a ligand that can bind to a human hepatocyte surface receptor. In some embodiments, at least one ligand is a ligand that can bind to a liver surface asialoglycoprotein receptor (ASGPR). The types of these ligands are well known to those skilled in the art, and their function is generally to bind to a specific receptor on the surface of the target cell, mediating the delivery of the siRNA connected to the ligand to the target cell.

[0325] In some embodiments, the pharmaceutically acceptable targeting group can be any ligand that binds to an asialoglycoprotein receptor (ASGPR) on the surface of a mammalian hepatocyte. In some embodiments, each ligand is independently an asialoglycoprotein, such as asialo serum mucin (ASOR) or asialo fetuin (ASF). In some embodiments, the ligand is a sugar or a derivative of a sugar.

[0326] In some embodiments, at least one ligand is a sugar. In some embodiments, each ligand is a sugar. In some embodiments, at least one ligand is a monosaccharide, a polysaccharide, a modified monosaccharide, a modified polysaccharide or a sugar derivative. In some embodiments, at least one of the ligands may be a monosaccharide, a disaccharide or a trisaccharide. In some embodiments, at least one ligand is a modified sugar. In some embodiments, each ligand is independently selected from a polysaccharide, a modified polysaccharide, a monosaccharide, a modified monosaccharide, a polysaccharide derivative or a monosaccharide derivative. In some embodiments, each or at least one ligand is selected from the group consisting of the following sugars: glucose and its derivatives, mannan and its derivatives, galactose and its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives, fructose and its derivatives and sialic acid.

[0327] In some embodiments, each of the ligands can be independently selected from D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucose, β-D-glucose, Sugar, α-D-glucofuranose, α-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine , 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2, 3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-pyranoglucoside methyl ester, 4-thio-β-D-pyranose galactose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-pyranoglucoside ethyl ester, 2,5-anhydro-D-allose nitrile, ribose, D-ribose, D-4-thioribose, L-ribose or L-4-thioribose. Other selections of the ligand can refer to, for example, the records of CN105378082A, which are incorporated into this specification in full by reference.

[0328] In some embodiments, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent. It should be understood that the monovalent, divalent, trivalent, and tetravalent herein refer to the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate after the siRNA molecule and the conjugated group containing the galactose or N-acetylgalactosamine molecule as the targeting group form the siRNA conjugate, which is 1:1, 1:2, 1:3, or 1:4. In some embodiments, the pharmaceutically acceptable targeting group is N-acetylgalactosamine. In some embodiments, when the siRNA of the present invention is conjugated to a conjugated group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, when the siRNA described herein is conjugated to a conjugation group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0329] The targeting group can be connected to the siRNA molecule via a suitable linker, and those skilled in the art can select a suitable linker according to the specific type of the targeting group. For these linkers, the types of targeting groups and the connection mode with siRNA, please refer to the disclosure of WO2015006740A2, which is incorporated into this specification in its entirety by reference.

[0330] siRNA Synthesis Method

[0331] By the conventional solid phase phosphoramidite method in the art, nucleoside monomers are connected one by one from the 3'-5' direction according to the nucleotide arrangement order. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, oxidation or sulfurization, and capping. Among them, when phosphate is used to connect two nucleotides, when the latter nucleoside monomer is connected, four steps of deprotection, coupling, oxidation, and capping are included. When thiophosphate is used to connect two nucleotides, when the latter nucleoside monomer is connected, four steps of deprotection, coupling, sulfurization, and capping are included. The present invention selects nucleotide monomers according to the synthetic target sequence, and the selected nucleotide monomers are nucleotide monomers commonly used by those skilled in the art. For example, the nucleotide monomers for synthesizing A can be, but are not limited to, adenosine-3-phosphate. It should be understood that these monomers, when present in oligonucleotides, are interconnected by 5'-3' phosphodiester bonds or 5'-3' thiophosphate groups. When, for example, the 3' position of the last nucleotide in the 5' to 3' direction is a hydroxyl group, it is achieved according to conventional means of the art.

[0332] For example, the synthesis conditions of the siRNA of the present invention can be as follows:

[0333] The deprotection conditions include: reaction temperature of 25° C., reaction time of 70 seconds, deprotection reagent selected from dichloroacetic acid in dichloromethane solution (3% V / V), and the molar ratio of deprotection reagent to protecting group on the solid phase carrier is 5:1.

[0334] The coupling reaction conditions include: reaction temperature of 25° C., reaction time of 600 seconds, coupling reagent selected from 0.25 M acetonitrile solution of 5-ethylthio-1H-tetrazole (ETT), and molar ratio of nucleic acid sequence connected to the solid phase carrier to nucleoside monomer is 1:10.

[0335] The oxidation reaction conditions include: reaction temperature of 25° C., reaction time of 15 seconds, an oxidizing agent selected from 0.05M iodine tetrahydrofuran solution, and a molar ratio of the oxidizing agent to the nucleic acid sequence connected to the solid phase carrier in the coupling step of 30:1.

[0336] The sulfurization reaction conditions include: a reaction temperature of 25° C., a reaction time of 300 seconds, a sulfurization reagent selected from hydrogenated xanthan gum, and a molar ratio of the sulfurization reagent to the nucleic acid sequence connected to the solid phase carrier in the coupling step of 120:1.

[0337] The capping reaction conditions include: a reaction temperature of 25°C, a reaction time of 15 seconds, a capping reagent selected from a mixed solution of CapA (10% acetic anhydride acetonitrile solution) and CapB (10% N-methylimidazole pyridine / acetonitrile solution) at a molar ratio of 1:1, and a molar ratio of the capping reagent to the nucleic acid sequence connected to the solid phase carrier is acetic anhydride: N-methylimidazole: The molar ratio of the nucleic acid sequence connected to the solid phase carrier is 1:1:1. After all nucleoside monomers are connected, the nucleic acid sequence connected to the solid phase carrier is cut, deprotected, purified, and desalted in sequence to obtain the siRNA sense chain and antisense chain, and finally the two chains are heated and annealed to obtain the product.

[0338] Methods for cleavage, deprotection, purification, desalting and annealing are well known in the art. For example, cleavage and deprotection are performed by contacting the nucleotide sequence connected to the solid phase carrier with concentrated ammonia; purification is performed by chromatography; desalting is performed by reverse phase chromatography; and mixing the sense strand and the antisense strand in equal molar ratios under different stringent conditions and then gradually cooling.

[0339] Taking L96, whose conjugated group is represented by formula (I), as an example, the synthesis method of the siRNA conjugate is as follows:

[0340]

[0341] In the first step, DMTr-L96 and succinic anhydride are reacted to obtain compound L96-A:

[0342] Preparation process: DMTr-L96, succinic anhydride, 4-dimethylaminopyridine and diisopropylethylamine were added to dichloromethane, stirred at 25°C for 24 hours, and then the reaction solution was washed with 0.5M triethylamine phosphate, the aqueous phase was washed three times with dichloromethane, and the organic phases were combined and evaporated to dryness under reduced pressure to obtain a crude product. Then, column chromatography was used for purification to obtain pure L96-A.

[0343] In the second step, L96-A is reacted with NH2-SPS to obtain L96-B:

[0344]

[0345] Preparation process: L96-A, O-benzotriazole-tetramethyluronium hexafluorophosphate (HBTU) and diisopropylethylamine (DIPEA) are mixed and dissolved in acetonitrile, stirred at room temperature for 5 minutes to obtain a uniform solution, aminomethyl resin (NH2-SPS, 100-200 mesh) is added to the reaction liquid, and the shaking reaction is started at 25°C. After 18 hours of reaction, the filter cake is washed with dichloromethane and acetonitrile in turn to obtain a filter cake. The obtained filter cake is capped with a CapA / CapB mixed solution to obtain L96-B, which is a solid phase carrier containing a conjugate molecule, and then the nucleoside monomer is connected to the conjugate molecule under a coupling reaction, and then the siRNA sense chain connected to the conjugate molecule is synthesized according to the siRNA molecule synthesis method described above, and the siRNA antisense chain is synthesized using the siRNA molecule synthesis method described above, and annealing is performed to generate the siRNA conjugate of the present invention.

[0346] Pharmaceutical composition

[0347] The present invention provides a pharmaceutical composition, which contains the siRNA as described above as an active ingredient and a pharmaceutically acceptable carrier.

[0348] The pharmaceutically acceptable carrier may be a carrier conventionally used in the field of siRNA administration, such as, but not limited to, lipid nanoparticles (LNP), magnetic nanoparticles (e.g., nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethyleneimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethylethylene phosphate ... Phosphate), PPEEA) and poly(methacrylate-N,N-dimethylaminoethyl ester) (poly(2-dimethylaminoethyl methacrylate), PDMAEMA) and one or more of their derivatives.

[0349] There is no special requirement for the content of siRNA and pharmaceutically acceptable carrier in the pharmaceutical composition, and the content of each component can be the conventional content.

[0350] In some embodiments, the pharmaceutical composition may further include other pharmaceutically acceptable excipients, which may be one or more of various preparations or compounds conventionally used in the art. For example, the other pharmaceutically acceptable excipients may include at least one of a pH buffer, a protective agent, and an osmotic pressure regulator.

[0351] The pH buffer may be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH value of 7.5-8.5 and / or a phosphate buffer with a pH value of 5.5-8.5, for example, a phosphate buffer with a pH value of 5.5-8.5.

[0352] The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose. Based on the total weight of the pharmaceutical composition, the content of the protective agent may be 0.01-30% by weight.

[0353] The osmotic pressure regulator can be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator makes the osmotic pressure of the pharmaceutical composition 200-700 milliosmole / kilogram (mOsm / kg). According to the desired osmotic pressure, those skilled in the art can easily determine the content of the osmotic pressure regulator.

[0354] In some embodiments, the pharmaceutical composition can be a liquid preparation, such as an injection; or a lyophilized powder injection, which is mixed with a liquid excipient during administration to prepare a liquid preparation. The liquid preparation can be, but is not limited to, administered subcutaneously, intramuscularly or intravenously, and can also be, but is not limited to, administered to the lungs by spraying, or administered to other organs (such as the liver) through the lungs by spraying. In some embodiments, the pharmaceutical composition is used for intravenous administration.

[0355] In some embodiments, the pharmaceutical composition can be in the form of a liposome formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a helper lipid and / or a pegylated lipid.

[0356] The following examples are used to further illustrate the present invention, but do not impose any limitation on the present invention.

[0357] Example

[0358] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples (although representing specific embodiments of the present disclosure) are given for illustrative purposes only, because after reading the detailed description, various changes and modifications made within the spirit and scope of the present disclosure will become apparent to those skilled in the art.

[0359] The experimental techniques and experimental methods used in this example are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0360] Example 1 Preparation of siRNA

[0361] The siRNA molecules with the following sequences were synthesized by Tianlin Biotechnology (Shanghai) Co., Ltd.

[0362] Table 1 siRNA and its sequence

[0363]

[0364]

[0365]

[0366]

[0367]

[0368]

[0369]

[0370]

[0371]

[0372] Table 1-1

[0373]

[0374]

[0375] Among them, each of the capital letters "G", "C", "A", "T" and "U" generally represents a nucleotide containing guanine, cytosine, adenine, thymine and uracil as a base, respectively; lowercase letters a, u, c, g: represent 2'-methoxy modified nucleotides; Af, Gf, Cf, Uf: represent 2'-fluoro modified nucleotides; d: represents that the nucleotide adjacent to the right of the letter d is a 2'-deoxyribonucleotide; lowercase letter s represents that the two nucleotides adjacent to the left and right of the letter s are connected by a thiophosphate group; P1: represents that the nucleotide adjacent to the right of P1 is a 5'-phosphate nucleotide; EVP: represents that the nucleotide adjacent to the right of EVP is a 5'-trans vinylphosphonate nucleotide; (Underline + Bold + Italic): indicates GNA-modified nucleotides.

[0376] The siRNA conjugate with the following sequence was synthesized by Tianlin Biotechnology (Shanghai) Co., Ltd.:

[0377] Table 2 siRNA conjugates and their sequences:

[0378]

[0379]

[0380]

[0381]

[0382]

[0383]

[0384]

[0385] Table 2-1

[0386]

[0387] The structural formula of L96 is shown in the following formula (I), and L96 is connected to the 3' end of the sense strand in Table 1 or the blunt end formed by the 3' end of the sense strand through a phosphodiester bond:

[0388]

[0389]

[0390] GalXC-DGAT2-0898 is used as a comparative conjugate, which is disclosed in WO2022031850A2. The structural formula of [ademA-GalNAc] is shown in the following formula (IX):

[0391]

[0392] Wherein, the structural formula of MePhosphonate-4O-us is shown in the following formula (XI):

[0393]

[0394] In Table 1, Table 1-1 and Table 2, if the left side of the 5' terminal nucleotide of the sense strand, the modified sense strand and the modified sense strand connected to the conjugated group is not marked with P1 or EVP, it means that the 5' terminal nucleotide is not connected to a 5' phosphate group or a 5' phosphate derivative group, and its structure is shown in Formula X.

[0395] In Table 1, Table 1-1 and Table 2, if the left side of the 5' terminal nucleotide of the antisense strand and the modified antisense strand is not marked with P1 or EVP, it means that the 5' terminal nucleotide is not connected to a 5' phosphate group or a 5' phosphate derivative group, and its structure is also shown in Formula X.

[0396] In Table 1, Table 1-1 and Table 2, the 3' position of the 3' terminal nucleotide of the sense strand and the modified sense strand, and the 3' terminal nucleotide of the antisense strand and the modified antisense strand is a hydroxyl group.

[0397] Example 2 siRNA inhibits DGAT2 gene expression

[0398] 2.1 Experimental Materials:

[0399] HepG2 cells were purchased from the Cell Bank of Type Culture Collection Committee of the Chinese Academy of Sciences, catalog number SCSP-510;

[0400] RNA extraction kit, catalog number QIAGEN-74106;

[0401] RNAiMAX transfection reagent, purchased from Invitrogen, catalog number 13778-150;

[0402] DMEM medium, purchased from Gibco, catalog number 11965118;

[0403] Reverse transcription kit ( Ⅲ1st Strand cDNA Synthesis Kit (+gDNA wiper), purchased from Vazyme, catalog number R312-02;

[0404] TaqMan TM Gene expression master mix, purchased from Applied Biosystems, catalog number 4369016;

[0405] Opti-medium: purchased from Gibco, product number 31985070;

[0406] FBS, purchased from Gibco, catalog number 10099141;

[0407] PBS, purchased from MACGENE, catalog number CC006;

[0408] Pancreatin, purchased from Gibco, catalog number 15400054;

[0409] Target DGAT2 primer set, purchased from Tianlin Biotechnology, forward primer: GGCCTCCCGGAGACTGA (SEQ ID NO: 341); reverse primer: AAGTGATTTGCAGCTGGTTCCT (SEQ ID NO: 342);

[0410] TaqMan Gene Expression Assay (GAPDH) was purchased from Tianlin Biotechnology, forward primer: GCACCGTCAAGGCTGAGAAC (SEQ ID NO: 343); reverse primer: TGGTGAAGACGCCAGTGGA (SEQ ID NO: 344).

[0411] 2.2 Experimental methods:

[0412] 2.2.1 HepG2 cells were plated in fresh DMEM medium in a 96-well plate and cultured for 24 hours. The cultured cells were resuspended in DMEM medium without PS (penicillin-streptomycin mixture) to a density of 1.11×10 5 cells / mL of cell suspension were plated into a 96-well plate, and 90 μL of cell suspension was added to each well, i.e., 10,000 cells / well.

[0413] 2.2.2 The dry powder of the siRNA to be tested (for the convenience of description, the siRNA and siRNA conjugate tested in this example are represented by siRNA) was centrifuged at low temperature and high speed, and then dissolved in ultrapure distilled water (ULtraPure Distilled Water) to prepare a 100 μM siRNA stock solution.

[0414] 2.2.3 Preparation of 0.01 nM siRNA transfection diluent

[0415] (1) Preparation of 10 nM siRNA stock solution:

[0416] a. Take 2 μL of the 100 μM siRNA stock solution prepared in step 2.2.2 above, add 18 μL of ultrapure distilled water to obtain a siRNA dilution solution with a final concentration of 10 μM;

[0417] b. Take 2 μL of the 10 μM siRNA dilution prepared in step a, add 18 μL of ultrapure distilled water to obtain a siRNA dilution with a final concentration of 1 μM;

[0418] c. Take 2 μL of the 1 μM siRNA dilution prepared in step b, add 18 μL of ultrapure distilled water to obtain a siRNA stock solution with a final concentration of 0.1 μM;

[0419] d. Take 2 μL of the 0.1 μM siRNA dilution prepared in step c, add 18 μL of ultrapure distilled water to obtain a siRNA stock solution with a final concentration of 10 nM;

[0420] (2) Take 2 μL of the 10 nM siRNA stock solution prepared in step (1) and add 98 μL of Opti-medium to obtain a 0.2 nM siRNA dilution solution;

[0421] (3) Take 3 μL RNAiMAX transfection reagent, add 97 μL Opti-medium, and obtain RNAiMAX transfection reagent diluent; RNAiMAX transfection reagent diluent and siRNA diluent were mixed at a volume ratio of 1:1, allowed to stand for 5 minutes, and 10 μL of the transfection mixture was added to a 96-well plate to transfect the cultured HepG2 cells (final volume 100 μL, siRNA concentration in this system was 0.01 nM).

[0422] 1 nM siRNA transfection diluent can be prepared by similar procedures as above.

[0423] 2.5 nM, 0.04 nM and 0.0025 nM siRNA transfection dilutions can be prepared according to the similar operation as above.

[0424] 2.2.4 Culture the cells for 24 hours after transfection and set up 2 replicates for each concentration.

[0425] 2.2.5 Extract total RNA according to the instructions of the RNA extraction kit.

[0426] 2.2.6 Reverse transcribe the extracted total RNA into cDNA using a reverse transcription kit, following the steps below: a) Remove gDNA using gDNA enzyme according to the following table:

[0427] Volume / μL 5×gDNABuffer 2 Sample (RNA) 8

[0428] The above reagents were reacted at 42°C for 2 min to obtain a mixed solution;

[0429] b) Perform reverse transcription according to the following table:

[0430] Volume / μL The mixed solution obtained in step a) 10 10×RTMix 2 HiScriptⅢEnzymeMix 2 <![CDATA[Oligo(dT) 20 VN]]> 1 Random hexamers 1 <![CDATA[RNase-freeddH2O]]> 4

[0431] 50℃, 15min, extension; 85℃, 5s, inactivation.

[0432] c) The reverse transcription products were stored at 4°C for real-time PCR analysis.

[0433] 2.2.7 Real-time PCR analysis

[0434] a) Prepare qPCR reaction mixture as shown in the table below. Keep all reagents on ice during the entire operation.

[0435]

[0436] b) Perform qPCR procedure as shown in the following table:

[0437]

[0438] 2.2.8 Results Analysis

[0439] a) Quant Studio 6Flex software was used with default settings to automatically calculate Ct values;

[0440] b) Calculate the relative expression of genes using the following formula:

[0441] ΔCt=Ct(DGAT2 gene)–Ct(GAPDH)

[0442] ΔΔCt=ΔCt(test sample group)-ΔCt(Mock group)

[0443] mRNA expression relative to the Mock group = 2 -ΔΔCt .

[0444] Mock group: Compared with the test sample group, the group without adding siRNA.

[0445] Inhibition rate (%) = (relative expression of mRNA in the Mock group - relative expression of mRNA in the test sample group) / relative expression of mRNA in the Mock group × 100%

[0446] 2.2.9 Experimental results

[0447] siRNA concentrations of 1 nM, 0.01 nM, 2.5 nM, 0.04 nM and 0.0025 nM were selected for testing.

[0448] Table 3 Inhibition rate of siRNA of the present invention

[0449]

[0450]

[0451] Note: “--” results are not shown.

[0452] As can be seen from Table 3, the siRNA of the present invention can significantly inhibit the expression of DGAT2 gene at both 1 nM and 0.01 nM, wherein the 24h inhibition rate is as high as 95.24% at 1 nM and as high as 83.65% at 0.01 nM.

[0453] Table 4 Inhibition rate of siRNA conjugates of the present invention

[0454]

[0455]

[0456]

[0457] Note: “--” results are not shown.

[0458] Example 3 Determination of the inhibition rate of siRNA conjugates in inhibiting DGAT2 gene expression

[0459] 3.1 Test materials:

[0460] Human primary hepatocytes PHH cells were provided by Shanghai WuXi AppTec Pharmaceuticals Co., Ltd.;

[0461] PHH medium: invitroGRO CP Medium serum free BIOVIT, catalog number: S03316;

[0462] RNAiMAX transfection reagent, purchased from Invitrogen, catalog number: 13778-150;

[0463] 96Kit, purchased from QIAGEN, catalog number: QIAGEN-74182;

[0464] FastKing RTKit (containing gDNase), purchased from TianGen, catalog number: KR116-02;

[0465] FastStart Universal Probe master, purchased from Roche, catalog number: 4913918001;

[0466] Primers targeting DGAT2 and GAPDH were provided by Shanghai WuXi AppTec Co., Ltd.

[0467] 3.2 Test methods

[0468] siRNA conjugates (final concentrations of siRNA conjugates were 5 nM and 0.2 nM, respectively, in duplicate) were transfected into PHH cells, and the process was as follows: frozen PHH cells were taken, revived, counted, and the number of cells was adjusted to 6 × 10 5 cells / mL, applied simultaneously RNAiMax transfection reagent was used to transfer siRNA conjugates into cells, and 54,000 cells were seeded into 96-well plates. 100 μL of PHH medium was added to each well. The cells were cultured in a 5% CO2, 37°C incubator. After 48 hours, the medium was removed and the cells were collected for total RNA extraction. Use according to the kit product instructions. Total RNA was extracted using 96Kit.

[0469] siRNA conjugates (final concentrations of siRNA conjugates were 200 nM and 10 nM, respectively, in duplicate) were freely taken up by PHH cells, and the process was as follows: frozen PHH cells were taken, revived, counted, and the number of cells was adjusted to 6 × 105 cells / mL, and siRNA conjugates were added at the same time, and the cells were seeded into 96-well plates at a density of 54,000 cells per well, with 100 μL of culture medium per well. The cells were cultured in a 5% CO2, 37°C incubator. After 48 hours, the culture medium was removed and the cells were collected for total RNA extraction. Use according to the kit product instructions Total RNA was extracted using 96Kit.

[0470] Reverse transcribe the extracted total RNA into cDNA using a reverse transcription kit, following the steps below:

[0471] a) Remove gDNA using gDNAase according to the following table:

[0472] Volume / μL 5×gDNABuffer 2 Sample (RNA) 8

[0473] The above reagents were reacted at 42°C for 2 min to obtain a mixed solution;

[0474] b) Perform reverse transcription according to the following table:

[0475] Volume / μL The mixed solution obtained in step a) 10 FQ-RTPrimerMix 2 FastKingRTEnzymeMix 1 10×KingRTBuffer 1 RNase-FreeWater 5

[0476] 42℃, 15min, extension; 95℃, 3min, inactivation.

[0477] c) The reverse transcription products were stored at 4°C for real-time PCR analysis.

[0478] 3.2.7 Real-time PCR analysis

[0479] a) Prepare qPCR reaction mixture as shown in the table below. Keep all reagents on ice during the entire operation.

[0480]

[0481]

[0482] b) Perform qPCR procedure as shown in the following table:

[0483]

[0484] Result analysis:

[0485] a) Quant Studio 7 software was used with default settings to automatically calculate the Ct value;

[0486] b) Calculate the relative expression of genes using the following formula:

[0487] ΔCt=Ct(DGAT2 gene)–Ct(GAPDH)

[0488] ΔΔCt=ΔCt(test sample group)−ΔCt(Mock group), where the Mock group represents a group without the addition of siRNA conjugates compared with the test sample group;

[0489] mRNA expression relative to the Mock group = 2 -ΔΔCt

[0490] Inhibition rate (%) = (relative expression of mRNA in the Mock group - relative expression of mRNA in the test sample group) / relative expression of mRNA in the Mock group × 100%.

[0491] The experimental results are shown in Table 5.

[0492] Table 5 Inhibition rate of siRNA conjugates in inhibiting DGAT2 gene expression

[0493]

[0494]

[0495] Note: “--” results are not shown.

[0496] As can be seen from Table 5, the siRNA conjugates of the present invention have high DGAT2 gene inhibition activity in PHH cells. In particular, when the siRNA conjugates enter PHH by transfection, the inhibition rate of 5 nM can be as high as 97.01%; when the siRNA conjugates enter PHH by free uptake, the inhibition rate of 200 nM can be as high as 95.32%.

[0497] Example 4 Determination of the inhibition rate of siRNA in inhibiting DGAT2 gene expression

[0498] 4.1 Test materials:

[0499] Human primary hepatocytes PHH cells were provided by Huizhi Heyuan Biotechnology (Suzhou) Co., Ltd.;

[0500] PHH medium: purchased from Huizhiheyuan Biotechnology (Suzhou) Co., Ltd., catalog number: 0193301.32;

[0501] RNA extraction kit, catalog number QIAGEN-74106;

[0502] RNAiMAX transfection reagent, purchased from Invitrogen, catalog number 13778-150;

[0503] DMEM medium, purchased from Gibco, catalog number 11965118;

[0504] Reverse transcription kit ( Ⅲ1st Strand cDNA Synthesis Kit (+gDNA wiper), purchased from Vazyme, catalog number R312-02;

[0505] TaqMan TM Gene expression master mix, purchased from Applied Biosystems, catalog number 4369016;

[0506] Opti-medium: purchased from Gibco, product number 31985070;

[0507] FBS, purchased from Gibco, catalog number 10099141;

[0508] PBS, purchased from MACGENE, catalog number CC006;

[0509] Pancreatin, purchased from Gibco, catalog number 15400054;

[0510] Target DGAT2 primer set, purchased from Tianlin Biotechnology, forward primer: GGCCTCCCGGAGACTGA (SEQ ID NO: 341); reverse primer: AAGTGATTTGCAGCTGGTTCCT (SEQ ID NO: 342);

[0511] GAPDH primer set was purchased from Tianlin Biotechnology, forward primer: GCACCGTCAAGGCTGAGAAC (SEQ ID NO: 343); reverse primer: TGGTGAAGACGCCAGTGGA (SEQ ID NO: 344).

[0512] 4.2 Test methods

[0513] siRNA conjugates (final concentrations of siRNA conjugates were 2.5 nM and 0.625 nM, respectively, in duplicate) were transfected into PHH cells by transfection as follows: frozen PHH cells were taken, revived, counted, and the number of cells was adjusted to 6 × 10 5 cells / mL, applied simultaneously RNAiMax transfection reagent was used to transfer siRNA conjugates into cells, and 54,000 cells were seeded into 96-well plates. 100 μL of PHH medium was added to each well. The cells were cultured in a 5% CO2, 37°C incubator. After 48 hours, the medium was removed and the cells were collected for total RNA extraction. Use according to the kit product instructions. Total RNA was extracted using 96Kit.

[0514] The extracted total RNA was reverse transcribed into cDNA by reverse transcription reaction similar to that in Example 2, and the DGAT2 cDNA obtained by reverse transcription was quantitatively amplified by qPCR. GAPDH cDNA was amplified in parallel as an internal control. The PCR reaction program was: 95°C, 10 minutes, then entered the cycle mode, 95°C, 15 seconds, then 60°C, 60 seconds, for a total of 40 cycles.

[0515] Result analysis:

[0516] a) Quant Studio 7 software was used with default settings to automatically calculate the Ct value;

[0517] b) Calculate the relative expression of genes using the following formula:

[0518] ΔCt=Ct(DGAT2 gene)–Ct(GAPDH)

[0519] ΔΔCt=ΔCt(test sample group)−ΔCt(Mock group), where the Mock group represents a group without the addition of siRNA conjugates compared with the test sample group;

[0520] mRNA expression relative to the Mock group = 2 -ΔΔCt

[0521] Inhibition rate (%) = (relative expression of mRNA in the Mock group - relative expression of mRNA in the test sample group) / relative expression of mRNA in the Mock group × 100%.

[0522] It can be seen from the experimental results that the siRNA conjugates of the present invention have high DGAT2 gene inhibition activity in PHH cells.

[0523] Example 5 Silencing effect of siRNA conjugates in mice expressing human DGAT2 (hDGAT2) gene

[0524] (1) Construction of hDGAT2 gene overexpressing mouse model using AAV

[0525] 6-8 week old C57BL / 6 mice (provided by Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were introduced into the facility. After 3-5 days of adaptive feeding, a single injection of adeno-associated virus AAV (pAAV[Exp]-CBh>{hDGAT2 CDS}:T2A:SEAP(ns):WPRE, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) carrying hDGAT2 gene was performed into the tail vein for target gene overexpression modeling. The administration volume was 100 μL (3*10 11 vg) / head, and then fed with normal feed.

[0526] (2) Investigation of the efficacy of siRNA silencing in hDGAT2 mouse model

[0527] 14 days after AAV virus injection, the mice were divided into groups (6 in each group) and subcutaneously administered a single 3 mg / kg dose of N-FY001001M2L96, N-FY001002M2L96, N-FY001002M3L96, N-FY001003M2L96 and N-FY001004M2L96. SEAP protein expression (i.e., hDGAT2 protein expression) was detected on days 7, 14, 21, 28, 35, 42, 49 and 56 after administration.

[0528] Table 6 Inhibition rate of hDGAT2 by siRNA conjugates

[0529]

[0530] Note: “--” results are not shown.

[0531] As can be seen from Table 6, the siRNA conjugates of the present application have high inhibitory activity on the hDGAT2 gene in vivo and can reduce the hDGAT2 protein level for a long time. Among them, the siRNA conjugate N-FY001003M2L96 can achieve an inhibition rate of 77.16% on hDGAT2 after a single dose of 3 mg / kg for 21 days.

[0532] Example 6 Silencing effect of siRNA conjugates in mice expressing human DGAT2 (hDGAT2) gene

[0533] (1) Construction of hDGAT2 gene overexpressing mouse model using AAV

[0534] 6-8 week old C57BL / 6 mice (provided by Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were introduced into the facility. After 3-5 days of adaptive feeding, a single injection of adeno-associated virus AAV (pAAV[Exp]-CBh>{hDGAT2 CDS}:T2A:SEAP(ns):WPRE, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) carrying hDGAT2 gene was performed into the tail vein for target gene overexpression modeling. The administration volume was 100 μL (3*10 11 vg) / head, and then fed with normal feed.

[0535] (2) Investigation of the efficacy of siRNA silencing in hDGAT2 mouse model

[0536] 14 days after AAV virus injection, the mice were divided into groups (6 mice per group) and subcutaneously administered a single 3 mg / kg dose of N-FY001003M6L96 and N-FY001003M8L96. SEAP protein expression (i.e., hDGAT2 protein expression) was detected on days 7, 14, and 21 after administration.

[0537] Table 7 Inhibition rate of hDGAT2 by siRNA conjugates

[0538]

[0539] As can be seen from Table 7, the siRNA conjugate of the present application has a high inhibitory activity on the hDGAT2 gene in vivo and can reduce the hDGAT2 protein level for a long time. Among them, after 21 days of administration of a single dose of 3 mg / kg, the inhibition rate of hDGAT2 can still reach more than 80%.

[0540] Example 7 Silencing effect of siRNA conjugates in mice expressing human DGAT2 (hDGAT2) gene

[0541] (1) Construction of hDGAT2 gene overexpressing mouse model using AAV

[0542] 6-8 week old C57BL / 6 mice (provided by Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were introduced into the facility. After 3-5 days of adaptive feeding, a single injection of adeno-associated virus AAV (pAAV[Exp]-CBh>{hDGAT2 CDS}:T2A:SEAP(ns):WPRE, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) carrying hDGAT2 gene was performed into the tail vein for target gene overexpression modeling. The administration volume was 100 μL (3*10 11 vg) / head, and then fed with normal feed.

[0543] (2) Investigation of the efficacy of siRNA silencing in hDGAT2 mouse model

[0544] 14 days after AAV virus injection, the mice were divided into groups (6 in each group) and subcutaneously administered a single 3 mg / kg dose of N-FY001003M6L96, N-FY001003M11L96, N-FY001003M14L96, N-FY001003M15L96, GalXC-DGAT2-0898, N-FY001021M11L96, N-FY001021M13L96, N-FY001021M15L96 and N-FY001021M19L96. SEAP protein expression (i.e., hDGAT2 protein expression) was detected on days 7 and 14 after administration.

[0545] Table 8 Inhibition rate of hDGAT2 by siRNA conjugates

[0546]

[0547]

[0548] As can be seen from Table 8, the siRNA conjugate of the present application has a high inhibitory activity on the hDGAT2 gene in vivo. After 28 days of administration of the siRNA conjugate at a single dose of 3 mg / kg, the inhibition rate of N-FY001003M6L96 on hDGAT2 can still reach 80.02%, which is superior to N-FY001003M11L96 (ESC modification) and GalXC-DGAT2-0898 (comparative conjugate).

[0549] Example 8 Silencing effect of siRNA conjugates in mice expressing human DGAT2 (hDGAT2) gene

[0550] (1) Construction of hDGAT2 gene overexpressing mouse model using AAV

[0551] 6-8 week old C57BL / 6 mice (provided by Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were introduced into the facility. After 3-5 days of adaptive feeding, a single injection of adeno-associated virus AAV (pAAV[Exp]-CBh>{hDGAT2 CDS}:T2A:SEAP(ns):WPRE, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) carrying hDGAT2 gene was performed into the tail vein for target gene overexpression modeling. The administration volume was 100 μL (3*10 11 vg) / head, and then fed with normal feed.

[0552] (2) Investigation of the efficacy of siRNA silencing in hDGAT2 mouse model

[0553] Fourteen days after AAV virus injection, the mice were divided into groups (6 mice per group) and subcutaneously administered a single 3 mg / kg dose of N-FY001003M6L96, N-FY001003M21L96, N-FY001003M22L96, N-FY001003M24L96

[0554] , N-FY001003M25L96, N-FY001003M26L96, N-FY001003M27L96, N-FY001003M28L96, N-FY001003M29L96 and N-FY001021M27L96. The SEAP protein expression (i.e., hDGAT2 protein expression) was detected on the 7th, 14th and 21st days after administration.

[0555] Table 9 Inhibition rate of hDGAT2 by siRNA conjugates

[0556]

[0557]

[0558] As can be seen from Table 9, the siRNA conjugates of the present application have a high inhibitory activity on the hDGAT2 gene in vivo. After 14 days of administration of the siRNA conjugates at a single dose of 3 mg / kg, N-FY001003M22L96, N-FY001003M25L96, and N-FY001021M27L96 can all achieve an inhibition rate of about 80%; N-FY001003M6L96, N-FY001003M21L96, N-FY001003M24L96, N-FY001003M26L96, N-FY001003M27L96, and N-FY001003M29L96 can all achieve an inhibition rate of more than about 90%.

[0559] Example 9 Stability Test

[0560] Table 10 Antisense chains of parent drugs and antisense chains of major metabolites

[0561]

[0562] 9.1 In vitro liver homogenate stability test

[0563] Tris-HCl was purchased from Byotime (Biyuntian), product number ST790-500 mL;

[0564] MgCl2 was purchased from MacLean, catalog number C11362865;

[0565] Sterile PBS was purchased from Solebol, 0.01 M, pH 7.2-7.4;

[0566] Ammonium acetate was purchased from Tianjin Fengchuan Chemical Reagent Technology Co., Ltd., catalog number 202101052;

[0567] Ethylenediaminetetraacetic acid diammonium salt (EDTA) was purchased from ALDRICH, product number MKCK0920;

[0568] The internal standard was provided by Sangon Synthetics.

[0569] (1) Preparation of liver homogenate

[0570] The homogenate (mouse liver homogenate, rat liver homogenate or human liver homogenate) is 100 mM Tris, 1 mM MgCl2 (pH=6), and the liver homogenate is prepared at a ratio of 1 g:10 mL.

[0571] (2) Sample incubation

[0572] Preparation of working solution: N-FY001003M6L96 and N-FY001003M11L96 were prepared into 40 μM test substance using sterile PBS.

[0573] Take 975 μL (N=2) of liver homogenate and pre-incubate at 37°C for 5 min, add 25 μL of 40 μM test substance, vortex mix, and divide into portions according to time points, 100 μL each, take the 48h sample and start incubation at 37°C, and the samples at other time points are frozen in liquid nitrogen and stored in a refrigerator at -60 to -90°C, and taken out for incubation according to the time shown in Table 10.

[0574] Table 11

[0575] Time (h) operate 0 Incubate samples for 48 hours 24 Incubate samples for 24 hours 48 Take out the 0h sample and process the 0-48h samples uniformly

[0576] Sample processing

[0577] After the incubation, 100 μL of the sample was added with 200 μL 100 mM ammonium acetate-EDTA solution (pH=10) and 100 μL internal standard working solution, vortexed for 3 min, 200 μL DNA extraction solution and 400 μL dichloromethane were added, vortexed for 3 min, centrifuged at 12000 rpm at room temperature for 10 min, and the supernatant was taken for sampling and analysis.

[0578] Sample testing and analysis

[0579] The LC-MS / MS method was used to semi-quantitatively detect the antisense chain of the parent drug and the antisense chain ratio of the main metabolites. The results are shown in Table 12.

[0580] Table 12 Antisense strand percentages of parent drugs N-FY001003M6L96 and N-FY001003M11L96 and major metabolites in rat liver homogenate (%)

[0581]

[0582] From the experimental data in Table 12, it can be seen that after 48 hours in rat liver homogenate, the stability of the parent drug N-FY001003M6L96 is better than that of N-FY001003M11L96. In addition, N-FY001003M6L96 and N-FY001003M11L96 only differ in the sense chain, but the residual amount of their metabolites is significantly different, indicating that the metabolic result is the result of the synergistic effect of the siRNA double strands.

[0583] 9.2 In vivo stability study in cynomolgus monkeys

[0584] 1. Six animals that met the requirements were selected from a group of 8- to 9-year-old high-fat, high-fructose induced cynomolgus macaques (cynomolgus macaques were obtained from Chengdu WuXi AppTec New Drug Development Co., Ltd.) through biochemical testing and liver biopsy pathological analysis. Two animals that met the experimental requirements of NASH (defined as liver steatosis histopathological score ≥2, inflammatory response ≥2, ballooning ≥1 (if any), and liver fibrosis histopathological score ≥2) were included in the experiment; in addition, two healthy animals were selected as healthy controls.

[0585] 2. Observation period of medication

[0586] The animals will be observed for 12 weeks. The day of drug administration is defined as Day 0 (D0). The specific drug administration design is summarized in the table below:

[0587] Table 13

[0588]

[0589] The injection site is the loose skin area on the scapula / outer neck. The hair around the injection site is shaved cleanly, and the skin is disinfected with iodine and alcohol before subcutaneous administration. D21 after administration, a liver puncture biopsy is performed to detect drug metabolism in the liver.

[0590] Table 14

[0591] name Antisense strand A A-1 A-3 Content (μg / g) <LLOQ 7.64 18.55

[0592] From the experimental data in Table 14, it can be seen that there are mainly two metabolites of antisense chain A in the liver of crab-eating monkeys, among which the metabolite antisense chain A-3 (i.e., the form in which the phosphorylation modification of the 5' end of the AS chain is removed and one nucleotide is removed from the 3' end) has the highest content, followed by the metabolite antisense chain A-1 (i.e., the form in which the phosphorylation modification of the 5' end of the AS chain is removed).

[0593] 9.3 In vitro PHH experiment of conjugates composed of the antisense strand of the main metabolite of the parent drug N-FY001003M6L96 and the sense strand of N-FY001003M6L96

[0594] Table 15

[0595]

[0596] The same experimental method as in Example 3 was used.

[0597] Table 16 Inhibition rate of siRNA conjugates in inhibiting DGAT2 gene expression

[0598]

[0599] As can be seen from Table 16, in vivo, the metabolite of N-FY001003M6L96, N-FY001003M6L96B-1, has comparable activity to its parent drug and has an excellent inhibitory effect on the DGAT2 gene.

[0600] Example 10 Plasma Kinetic Study of siRNA Conjugates in CD-1 Mice

[0601] Experimental animals: CD-1 mice, SPF grade, male, about 30 g, purchased from Sibeifu (Beijing) Biotechnology Co., Ltd.

[0602] Dosage and administration method: siRNA conjugates were administered at a dose of 3 mg / kg (10 mL / kg) and given as a single subcutaneous injection after randomization, with 6 mice in each group.

[0603] Sample collection: Whole blood samples were collected at 0.0833, 0.25, 0.5, 1, 2, 4, 8, 24, 36, and 48 hours after administration, for a total of 10 points. The first 3 samples in each group were collected at 0.0833, 0.5, 2, 8, and 36 hours, and the last 3 samples were collected at 0.25, 1, 4, 24, and 48 hours. The whole blood samples were immediately placed on ice after collection. Within 0.5 hours after collection, the plasma was separated by centrifugation at 4°C and 2000g for 5 minutes. The upper plasma samples were collected into sample tubes. The plasma samples were frozen in a -10 to -30°C refrigerator within 0.5 hours and transferred to a -60 to -90°C refrigerator within 24 hours.

[0604] Sample detection and analysis: LC-MS / MS method was used to detect the concentration of the original drug in plasma samples at each time point, and WinNonlin software was used to calculate the PK parameters: C max , T max , AUC, MRT, t 1 / 2 , the results are shown in Table 17.

[0605] Table 17 Plasma kinetic parameters of siRNA conjugates in mice

[0606]

[0607] As can be seen from Table 17, the siRNA conjugates disclosed in the present invention have a shorter half-life in plasma and are cleared faster.

[0608] Example 11 Tissue distribution test of siRNA conjugates in CD-1 mice

[0609] Experimental animals: CD-1 mice, SPF grade, male, about 30 g, purchased from Sibeifu (Beijing) Biotechnology Co., Ltd.

[0610] Dosage and administration method: siRNA conjugates were administered at a dose of 3 mg / kg (10 mL / kg) and given by a single subcutaneous injection after randomization, with 3 animals at each time point, for a total of 24 mice.

[0611] Sample collection:

[0612] 24 h after administration: plasma, liver, kidney, and spleen were collected;

[0613] 72h after administration: plasma, liver, kidney, and spleen were collected;

[0614] 168 h after administration (1 week): plasma, liver, kidney, spleen, brain, heart, lung, stomach, small intestine, muscle, and testis were collected;

[0615] 336h after administration (2 weeks): plasma, liver, kidney, and spleen were collected;

[0616] 672h after administration (4 weeks): plasma, liver, kidney, spleen, brain, heart, lung, stomach, small intestine, muscle, and testis were collected; 1008h after administration (6 weeks): plasma, liver, kidney, and spleen were collected;

[0617] 1344h after administration (8 weeks): plasma, liver, kidney, and spleen were collected;

[0618] 1680h after administration (10 weeks): plasma, liver, kidney, spleen, brain, heart, lung, stomach, small intestine, muscle, and testis were collected.

[0619] Sample detection and analysis: The concentration of the unchanged drug in plasma and tissue samples at each time point was detected by LC-MS / MS, and the AUC in plasma and tissues was calculated by the trapezoidal area method.

[0620] It can be concluded from this experiment that the siRNA conjugate disclosed in the present invention is mainly enriched in the liver, has a long retention time in the tissue, and has good stability.

[0621] Example 12: MTD test of single subcutaneous injection of siRNA conjugate into C57 mice

[0622] Experimental animals: C57 mice, SPF grade, male, about 25g, purchased from Sibeifu (Beijing) Biotechnology Co., Ltd. Animals were randomly divided into groups according to their body weight on the last day of the adaptation period. The specific dosage design and grouping are shown in the following table:

[0623]

[0624] Detection indicators:

[0625] Clinical observation: Continuous observation for 4 hours on the day of administration, and clinical observation at least once a day during the recovery period.

[0626] Body weight: All surviving animals were weighed twice a week.

[0627] Immunotoxicity: Blood was collected from animals in the MTD dose group at 1h±2min, 4h±5min, 8h±10min, and 24h±20min after administration on D1. Three animals / sex / group were collected at each time point for detection of cytokines (IFN-γ, TNF-α, IL-2 / 6 / 8).

[0628] Toxicokinetics: Blood samples were collected from animals in the MTD dose group at 30min±2min, 1h±2min, 4h±5min, 8h±10min, and 24h±20min before and after administration on D1. Three animals / sex / group were collected at each time point to detect blood drug concentration.

[0629] Blood biochemistry: The animals in the main test group were autopsied on D28, and the animals in the satellite group were autopsied in batches on D7, D14, D21, and D28 to test blood biochemistry.

[0630] Tissue distribution: The animals in the main test group were autopsied on D28, and the animals in the satellite group were autopsied in batches on D7, D14, D21, and D28. Blood and liver were collected to detect tissue drug concentrations.

[0631] Histopathological examination: The animals in the main experimental group were autopsied on D28, and the main organs (heart, liver, spleen, lung, kidney, brain, adrenal gland, thymus, stomach, uterus / testis, ovary / epididymis) and abnormal tissues or organs were collected and fixed for histopathological examination.

[0632] It can be concluded from this experiment that the siRNA conjugate disclosed in the present invention has low toxicity and an excellent safety window for drug use.

[0633] Example 13 Pharmacological efficacy study of siRNA conjugates in cynomolgus monkeys with NASH model

[0634] 1. Six male cynomolgus monkeys (weight > 8 kg) aged 10 years and above with NASH model (liver tissue pathology scores need to meet fatty degeneration ≥ 2, inflammatory response ≥ 1, ballooning ≥ 1, and liver fibrosis score ≥ 1) (provided by Kunming Yaling / Keling Biotechnology Co., Ltd.) were divided into two groups and fed in the breeding facility. MRI scans of liver fat were performed 1 week before administration (D-7).

[0635] 2. Observation period of medication

[0636] The animals will be observed for 12 weeks. The day of drug administration is defined as Day 0 (D0). The specific drug administration design is summarized in the table below:

[0637]

[0638] The injection site was the loose skin area on the scapula / outer neck. The hair around the injection site was shaved cleanly, and the skin was disinfected with iodine and alcohol before subcutaneous administration. MRI scans of liver fat were performed on D28, D56, and D84 after administration; liver puncture biopsy was performed on D56 for mRNA expression analysis, and the results are shown in Tables 18 and 19.

[0639] Table 18 Percentage change of liver fat content

[0640]

[0641] As can be seen from Table 18, the siRNA conjugate of the present application has a significant effect on improving the changes in liver fat content in crab-eating monkeys with a NASH model. D28 reduced the liver fat content by 30.49%, D56 reduced the liver fat content by 36.93%, and D84 reduced the liver fat content by 50.60%.

[0642] Table 19 Remaining percentage of liver mRNA

[0643]

[0644] As can be seen from Table 19, the siRNA conjugate of the present application can significantly reduce the expression of DGAT2 mRNA in the liver of cynomolgus monkeys in the NASH model, and the remaining liver mRNA at D84 is only 2.33%.

Claims

1. An siRNA for inhibiting DGAT2 gene expression, the siRNA comprising a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II, wherein the nucleotide sequence I and the nucleotide sequence II are at least partially reverse-complemented to form a double-stranded region, wherein the nucleotide sequence I and the nucleotide sequence II are selected from the following sequences: (1) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 346, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 347: 5'-GACUAUUUGCUUU-3'(SEQ ID NO:346) 5'-AAAGCAAAUAGUC-3' (SEQ ID NO: 347); (2) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 348, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 349: 5'-CCAUCCUCAUGUACAUAU-3'(SEQ ID NO:348) 5'-AUAUGUACAUGAGGAUGG-3' (SEQ ID NO: 349); (3) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 350, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 351: 5'-CACCAUAGACUAUU-3'(SEQ ID NO:350) 5'-AAUAGUCUAUGGUG-3' (SEQ ID NO: 351); (4) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 352, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 353: 5'-UUUGCUUUCAAAGAA-3'(SEQ ID NO:352) 5'-UUCUUUGAAAGCAAAUA-3' (SEQ ID NO:353); (5) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 354, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 355: 5'-CUUUCGAGACUA-3'(SEQ ID NO:354) 5'-UAGUCUCGAAAGUA-3' (SEQ ID NO:355); (6) The nucleotide sequence I comprises the nucleotide sequence shown in SEQ ID NO: 356, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 357: 5'-CUCAUGUACAUA-3'(SEQ ID NO:356) 5'-UAUGUACAUGAG-3' (SEQ ID NO:357); (7) the nucleoside bases are mismatched; the substantially reversed acid sequence I comprises the nucleotide sequence shown in SEQ ID NO: 358, and the nucleotide sequence II comprises the nucleotide sequence shown in SEQ ID NO: 359: 5'-GUGGCGCUACUUUCGAGA-3'(SEQ ID NO:358) 5'-UCUCGAAAGUAGCGCCAC-3' (SEQ ID NO:359).

2. The siRNA according to claim 1, wherein the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, essentially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there are no more than 3 bases between the two nucleotide sequences; the complementary means that there are no more than 1 base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.

3. The siRNA according to claim 1 or 2, wherein the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV, and the lengths of the nucleotide sequence III and the nucleotide sequence IV are each independently 0-11 nucleotides, wherein the nucleotide sequence III is connected to the 5' end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 3' end of the nucleotide sequence II, and the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than one base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences; and / or The nucleotide sequence III is connected to the 3' end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 5' end of the nucleotide sequence II. The nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complementary means that there is no more than one base mismatch between the two nucleotide sequences; the completely reverse complementary means that there is no mismatch between the two nucleotide sequences.

4. The siRNA according to any one of claims 1 to 3, wherein the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains nucleotide sequences I and III, and the antisense strand contains nucleotide sequences II and IV, and the nucleotide sequences I and III are at least partially reverse complementary to the nucleotide sequences II and IV to form a double-stranded region, wherein the nucleotide sequences I and III, the nucleotide sequences II and IV are selected from the following sequences: (1) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 251, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 252; (2) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 253, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 254; (3) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:42, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:128; (4) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 23, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 24; (5) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:31, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:32; (6) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:47, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:48; (7) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 255, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 256; (8) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:49, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:50; (9) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:55, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:56; (10) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 257, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 258; (11) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:57, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:58; (12) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:59, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:60; (13) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO:61, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO:62; (14) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 259, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 260; (15) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 261, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 262; (16) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 75, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 76; (17) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 263, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 264; (18) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 265, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 266; (19) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 267, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 268; (20) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 269, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 270; (21) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 15, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 271; (22) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 272, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 273; (23) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 131, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 132; (24) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 274, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 275; (25) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 276, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 277; (26) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 163, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 164; (27) the nucleotide sequences I and III comprise or consist of the nucleotide sequence shown in SEQ ID NO: 165, and the nucleotide sequences II and IV comprise or consist of the nucleotide sequence shown in SEQ ID NO: 166; or (28) The nucleotide sequences I and III contain or consist of the nucleotide sequence shown in SEQ ID NO:278, and the nucleotide sequences II and IV contain or consist of the nucleotide sequence shown in SEQ ID NO:

279.

5. The siRNA according to any one of claims 1 to 4, wherein the sense strand further comprises a nucleotide sequence V and / or the antisense strand further comprises a nucleotide sequence VI, the length of the nucleotide sequence V and the nucleotide sequence VI is 0-3 nucleotides, the nucleotide sequence V is connected to the 3' end of the sense strand to form a 3' overhang of the sense strand and / or the nucleotide sequence VI is connected to the 3' end of the antisense strand to form a 3' overhang of the antisense strand; preferably, the length of the nucleotide sequence V or the nucleotide sequence VI is 2 nucleotides; more preferably, the nucleotide sequence V or the nucleotide sequence VI is two consecutive thymine deoxyribonucleotides, two consecutive uracil ribonucleotides, or one cytosine deoxyribonucleotide and one adenine deoxyribonucleotide in the direction from 5' to 3'; Alternatively, the nucleotide sequence V or the nucleotide sequence VI is mismatched or complementary to the nucleotide at the corresponding position of the target mRNA.

6. The siRNA according to any one of claims 1-5, wherein the length of the double-stranded region is 15-30 nucleotide pairs; preferably, the length of the double-stranded region is 17-23 nucleotide pairs; more preferably, the length of the double-stranded region is 19-21 nucleotide pairs.

7. The siRNA according to any one of claims 1-6, wherein the sense strand or the antisense strand has 15-30 nucleotides; preferably, the sense strand or the antisense strand has 19-25 nucleotides; more preferably, the sense strand or the antisense strand has 19-23 nucleotides.

8. The siRNA according to any one of claims 1 to 7, wherein at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and / or at least one phosphate group is a phosphate group having a modified group; preferably, the phosphate group having a modified group is a thiophosphate group formed by replacing one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom; and / or, the siRNA comprises a sense strand without a 3' overhanging nucleotide. 9 . The siRNA according to claim 1 , wherein the 5′ terminal nucleotide of the antisense strand is linked to a 5′ phosphate group or a 5′ phosphate derivative group, or the 5′ terminal nucleotide of the antisense strand is not linked to a 5′ phosphate group or a 5′ phosphate derivative group.

10. The siRNA according to any one of claims 1 to 9, wherein the modified nucleotides are selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs, or a combination of any two or more thereof.

11. The siRNA according to any one of claims 1 to 10, wherein The modified nucleotides are selected from 2'-fluoro modified nucleotides, 2'-methoxy modified nucleotides, 2'-O-CH2-CH2-O-CH3 modified nucleotides, 2'-O-CH2-CH=CH2 modified nucleotides, 2'-CH2-CH2-CH=CH2 modified nucleotides, 2'-deoxynucleotides, nucleotide analogs or a combination of any two or more thereof.

12. The siRNA according to any one of claims 1 to 11, wherein each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide or a non-fluoro-modified nucleotide; Preferably, in the sense strand, from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11, and the remaining positions are non-fluoro-modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 5, 7, 8 and 9, and the remaining positions are non-fluoro-modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 9, 10 and 11, and the remaining positions are non-fluoro-modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 8, 9 and 10, and the remaining positions are non-fluoro-modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 8, 9, 10 and 11, and the remaining positions are non-fluoro-modified nucleotides. or, the 2'-fluoro-modified nucleotides are located at positions 7 and 9, and the remaining positions are non-fluorinated modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at positions 7, 9 and 11, and the remaining positions are non-fluorinated modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at positions 7, 11, 13 and 15, and the remaining positions are non-fluorinated modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at positions 8, 9, 10 and 12, and the remaining positions are non-fluorinated modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 11, 13 and 15, and the remaining positions are non-fluorinated modified nucleotides. nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 9, 11 and 13, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 7, 9, 11 and 13, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 3, 7, 8 and 9, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 3, 9, 11 and 13, and the remaining positions are non-fluorinated modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 3, 7, 9 and 11, and the remaining positions are non-fluorinated modified nucleotides; or, The 2'-fluoro modified nucleotides are located at positions 7, 11 and 13, and the remaining positions are non-fluoro modified nucleotides; or, the 2'-fluoro modified nucleotides are located at positions 7, 11, 12 and 13, and the remaining positions are non-fluoro modified nucleotides; or, the 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 16, and the remaining positions are non-fluoro modified nucleotides; or, the 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 17, and the remaining positions are non-fluoro modified nucleotides; or, the 2'-fluoro modified nucleotides are located at positions 3, 7, 11, 16 and 17, and the remaining positions are non-fluoro modified nucleotides; and / or In the antisense strand, from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 8th, 9th, 14th and 16th positions, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at the 2nd, 14th and 16th positions, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th and 14th positions, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at the 2nd, 3rd, 5th, 8th, 10th, 14th, 16th and 18th positions, and the remaining positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotides are located at the 2nd, 3rd, 4th, 5, 7, 10 and 14, and the remaining positions are non-fluorinated modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 2, 4, 6, 12, 14, 16, 18 and 20, and the remaining positions are non-fluorinated modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 2 and 14, and the remaining positions are non-fluorinated modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, 18 and 20, and the remaining positions are non-fluorinated modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 2, 7, 10 and 14, and the remaining positions are non-fluorinated modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 2, 5, 7 and 14, and the remaining positions are non-fluorinated modified nucleotides.

13. The siRNA according to any one of claims 1 to 12, wherein each nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide or a non-fluoro-modified nucleotide; Each non-fluorinated modified nucleotide is a 2'-methoxy modified nucleotide, and the 2'-methoxy modified nucleotide refers to a nucleotide in which the 2'-hydroxyl group of the ribose group is replaced by a methoxy group.

14. The siRNA according to claim 12 or 13, wherein each non-fluorinated modified nucleotide is independently selected from one of nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribose group of the nucleotide with a non-fluorinated group, and the nucleotide analog is selected from one of isonucleotides, LNA, ENA, cET-BNA, UNA and GNA.

15. The siRNA according to claim 14, wherein any one nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide, or a combination of any two or more thereof; Preferably, in the sense strand, from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9, 10 and 11, and the remaining positions are 2'-methoxy-modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 5, 7, 8 and 9, and the remaining positions are 2'-methoxy-modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 9, 10 and 11, and the remaining positions are 2'-methoxy-modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 8, 9 and 10, and the remaining positions are 2'-methoxy-modified nucleotides; alternatively, the 2'-fluoro-modified nucleotides are located at positions 8, 9, 10 and 11, and the remaining positions are 2'-methoxy-modified nucleotides. Modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 7 and 9, 2'-deoxy nucleotides are located at positions 11, and 2'-methoxy modified nucleotides are located at the remaining positions; or, 2'-fluoro modified nucleotides are located at positions 7, 9 and 11, and 2'-methoxy modified nucleotides are located at the remaining positions; or, 2'-fluoro modified nucleotides are located at positions 7, 11, 13 and 15, and 2'-methoxy modified nucleotides are located at the remaining positions; or, 2'-fluoro modified nucleotides are located at positions 8, 9, 10 and 12, and 2'-methoxy modified nucleotides are located at the remaining positions; or, 2'-fluoro modified nucleotides are located at positions 7, 9, 11, 13 and 15, and 2' -methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 9, 11 and 13, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 7, 9, 11 and 13, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 7, 8 and 9, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 9, 11 and 13, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 3, 7, 9 and 11, and the remaining positions are 2'-methoxy modified nucleotides ; Alternatively, 2'-fluoro modified nucleotides are located at positions 7, 11 and 13, and 2'-methoxy modified nucleotides are located at the remaining positions; Alternatively, 2'-fluoro modified nucleotides are located at positions 7, 11, 12 and 13, and 2'-methoxy modified nucleotides are located at the remaining positions; Alternatively, 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 16, and 2'-methoxy modified nucleotides are located at the remaining positions; Alternatively, 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 17, and 2'-methoxy modified nucleotides are located at the remaining positions; Alternatively, 2'-fluoro modified nucleotides are located at positions 3, 7, 11, 16 and 17, and 2'-methoxy modified nucleotides are located at the remaining positions; and / or In the antisense strand, from 5' to 3' direction, 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16, position 7 is a GNA modified nucleotide, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16, and the remaining positions are 2'-methoxy modified nucleotides; or, 2'-fluoro modified nucleotides Nucleotides at positions 2, 14 and 16, and 2'-methoxy modified nucleotides at the remaining positions; or, 2'-fluoro modified nucleotides at positions 2, 14 and 16, a GNA modified nucleotide at position 6, and 2'-methoxy modified nucleotides at the remaining positions; or, 2'-fluoro modified nucleotides at positions 2, 6 and 14, and 2'-methoxy modified nucleotides at the remaining positions; or, 2'-fluoro modified nucleotides at positions 2, 3, 5, 8, 10, 14, 16 and 18, and 2'-methoxy modified nucleotides at the remaining positions ; Alternatively, 2'-fluoro modified nucleotides are located at positions 2, 3, 4, 5, 7, 10 and 14, and the remaining positions are 2'-methoxy modified nucleotides; Alternatively, 2'-fluoro modified nucleotides are located at positions 2, 3, 4, 5, 7, 10 and 14, position 6 is a GNA modified nucleotide, and the remaining positions are 2'-methoxy modified nucleotides; Alternatively, 2'-fluoro modified nucleotides are located at positions 2, 4, 6, 12, 14, 16, 18 and 20, and the remaining positions are 2'-methoxy modified nucleotides; Alternatively, 2'-fluoro modified The nucleotides are located at the 2nd and 14th positions, and the remaining positions are 2'-methoxy modified nucleotides; alternatively, the 2'-fluoro modified nucleotides are located at the 2nd, 4th, 5th, 6th, 8th, 10th, 12th, 14th, 16th, 18th and 20th positions, and the remaining positions are 2'-methoxy modified nucleotides; alternatively, the 2'-fluoro modified nucleotides are located at the 2nd, 7th, 10th and 14th positions, and the remaining positions are 2'-methoxy modified nucleotides; alternatively, the 2'-fluoro modified nucleotides are located at the 2nd, 5th, 7th and 14th positions, and the remaining positions are 2'-methoxy modified nucleotides.

16. The siRNA according to any one of claims 1 to 15, wherein at least one of the following linkages between nucleotides in the siRNA is a phosphorothioate linkage: The connection between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; The connection between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand; The connection between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand; The connection between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand; The ligation between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand; The ligation between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand; The connection between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand; The linkage starts from the 2nd nucleotide and the 3rd nucleotide at the 3' end of the antisense strand.

17. The siRNA according to any one of claims 1 to 16, wherein, in the 5' to 3' direction, the sense strand comprises a phosphorothioate group located at the following positions: Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand; Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand; Between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand; or, The sense strand contains phosphorothioate groups located at the positions shown below: Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; The positive strand is located between the second nucleotide and the third nucleotide starting from the 5' end.

18. The siRNA according to any one of claims 1 to 17, wherein, in the 5' to 3' direction, the antisense strand comprises a phosphorothioate group located at the following positions: Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand; Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand; Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand; The antisense strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

19. The siRNA according to any one of claims 1 to 18, wherein any one nucleotide in the sense strand and the antisense strand is independently a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a GNA-modified nucleotide, or a combination of any two or more thereof; Preferably, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is free of overhangs; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the GNA modified nucleotide is located at position 7 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 14 and 16 of the antisense strand, the GNA modified nucleotide is located at position 6 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5'-trans vinyl phosphonate group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 8, 9, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is connected to a 5'-trans vinyl phosphonate group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6 and 14 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 5, 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 8, 9 and 10 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 3, 5, 8, 10, 14, 16 and 18 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 3, 4, 5, 7, 10 and 14 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 8, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 3, 4, 5, 7, 10 and 14 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 4, 6, 12, 14, 16, 18 and 20 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2 and 14 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7 and 9 of the sense strand, the 11th position is a 2'-deoxy nucleotide, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, 18 and 20 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7 and 9 of the sense strand, the 11th position is a 2'-deoxy nucleotide, and the remaining positions are 2'-methoxy modified nucleotides; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 11, 13 and 15 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 8, 9, 10 and 12 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 11, 13 and 15 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 11, 13 and 15 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 9, 11 and 13 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 11 and 13 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 11 and 13 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 3, 7, 8 and 9 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 9, 11 and 13 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 7, 9 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 3, 7, 9 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 11 and 13 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 11, 12 and 13 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 16 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 7, 11 and 17 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 3, 7, 11, 16 and 17 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the 2'-fluoro modified nucleotides are located at positions 2, 3, 4, 5, 7, 10 and 14 of the antisense strand, the 6th position is a GNA modified nucleotide, and the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 7, 10 and 14 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 7, 9, 10 and 11 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 5, 7 and 14 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 3, 7, 8 and 9 of the sense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 3' end is removed from the overhang; in the 5' to 3' direction, the 2'-fluoro modified nucleotides are located at positions 2, 7, 10 and 14 of the antisense strand, the remaining positions are 2'-methoxy modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group; Alternatively, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 3, 7, 9 and 11 of the sense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the overhang is removed at the 3' end; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 7, 10 and 14 of the antisense strand, the remaining positions are 2'-methoxy-modified nucleotides, and the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

20. The siRNA according to claim 1, comprising or selected from the group consisting of at least one of the siRNAs in Table 1; preferably, the siRNA is selected from N-FY001003, N-FY001003D2, N-FY001003M2, N-FY001003M2D2, N-FY001003M3, N-FY001003M4, N-FY001003M5, N-FY001003M6, N-FY001003M6D2, N-FY001003M7, N-FY001003M8, N-FY001003M9, N-FY001003M10, N-FY001003M11, N-FY001003M12, N-FY001003M13, N-FY001003M14, N-FY001003M15, N-FY001003M16, N-FY001003M17, N-FY001003M18, N-FY001003M19, N-FY001003M20 01003M7、N-FY001003M7D2、N-FY001003M8、N-FY001003M9、N-FY001003M10、N-FY001003M11、N-FY001003M12、 N-FY001003M13, N-FY001003M14, N-FY001003M15, N-FY001003M16, N-FY001003M17, N-FY001003M18, N-FY0010 03M19, N-FY001003M20, N-FY001003M21, N-FY001003M21D2, N-FY001003M22, N-FY001003M23, N-FY001003M24 , N-FY001003M24D2, N-FY001003M25, N-FY001003M26, N-FY001003M26D2, N-FY001003M27, N-FY001003M27D2, N -FY001003M28, N-FY001003M29, N-FY001003M29D2, N-FY001003M30, N-FY001003M31, N-FY001003M32, N-FY00 1003M33, N-FY001003M34, N-FY001003M35, N-FY001003M37, N-FY001003M40, N-FY001003M44, N-FY001003M45.

21. An siRNA conjugate or a prodrug thereof, wherein the siRNA conjugate comprises the siRNA according to any one of claims 1 to 20, and a conjugation group conjugated to the siRNA.

22. The siRNA conjugate or prodrug thereof according to claim 21, wherein the conjugated group comprises a pharmaceutically acceptable targeting group and a linker, and the siRNA, the linker and the targeting group are sequentially covalently or non-covalently linked; Preferably, in the siRNA conjugate, the sense strand and the antisense strand of the siRNA are complementary to each other to form a double-stranded region of the siRNA conjugate, and the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region; or, In the siRNA conjugate, the sense strand and the antisense strand of the siRNA are complementary to each other to form a double-stranded region of the siRNA conjugate, and the 3' end of the sense strand forms a blunt end, while the 3' end of the antisense strand forms a blunt end.

23. The siRNA conjugate or prodrug thereof according to claim 22, wherein the conjugated group is selected from any one of the group consisting of formula (I) to formula (VIII):

24. The siRNA conjugate or prodrug thereof according to any one of claims 21 to 23, wherein the siRNA conjugate comprises or is selected from the group consisting of at least one of the siRNA conjugates in Table 2; preferably, the siRNA conjugate is selected from N-FY001003M2L96, N-FY001003M3L96, N-FY001003M6L96, N-FY001003M7L96, N-FY001003M8L96, N-FY001003M9L96, 03M9L96, N-FY001003M10L96, N-FY001003M11L96, N-FY001003M12L96, N-FY001003M13L96, N-FY001003M14 L96、N-FY001003M15L96、N-FY001003M16L96、N-FY001003M17L96、N-FY001003M18L96、N-FY001003M19L96、N -FY001003M20L96, N-FY001003M21L96, N-FY001003M22L96, N-FY001003M23L96, N-FY001003M24L96, N-FY0 01003M25L96, N-FY001003M26L96, N-FY001003M27L96, N-FY001003M28L96, N-FY001003M29L96, N-FY001003 M30L96, N-FY001003M31L96, N-FY001003M32L96, N-FY001003M33L96, N-FY001003M34L96, N-FY001003M35L 96. N-FY001003M37L96, N-FY001003M40L96, N-FY001003M44L96, N-FY001003M45L96, N-FY001003M6L96B-1.

25. A pharmaceutical composition comprising the siRNA according to any one of claims 1 to 20, or the siRNA conjugate or a prodrug thereof according to any one of claims 21 to 24, and a pharmaceutically acceptable carrier. 26 . A kit comprising the siRNA according to claim 1 , or the siRNA conjugate or a prodrug thereof according to claim 21 , or the pharmaceutical composition according to claim 25 .

27. Use of the siRNA according to any one of claims 1 to 20, or the siRNA conjugate according to any one of claims 21 to 24, or the pharmaceutical composition according to claim 25 or a prodrug thereof for preparing a medicament for inhibiting DGAT2 gene expression.

28. Use of the siRNA according to any one of claims 1 to 20, or the siRNA conjugate according to any one of claims 21 to 24, or the pharmaceutical composition according to claim 25 for preparing a medicament for preventing and / or treating diseases associated with overexpression of the DGAT2 gene; Preferably, the disease is selected from the group consisting of non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, alcoholic fatty liver, obesity, hepatic steatosis, fatty liver, hyperlipidemia.

29. A method for inhibiting DGAT2 gene expression, comprising contacting a therapeutically effective amount of the siRNA according to any one of claims 1 to 20, or the siRNA conjugate or prodrug thereof according to any one of claims 21 to 24, or the pharmaceutical composition according to claim 25 with a cell expressing DGAT2 or administering it to a subject in need thereof.

30. A method for treating and / or preventing a disease associated with overexpression of the DGAT2 gene, comprising administering a therapeutically effective amount of the siRNA according to any one of claims 1 to 20, or the siRNA conjugate or a prodrug thereof according to any one of claims 21 to 24, or the pharmaceutical composition according to claim 25 to a subject in need thereof.

Images