Circular RNA, overexpression vector, construction method, detection primer and application

Abstract

The present invention relates to the field of biomedical technology, and in particular to a circular RNA, an overexpression vector, a construction method, a detection primer and an application. The nucleotide sequence of the circular RNA is shown in SEQ ID NO.21. The present invention connects the circular RNA to a vector that can express the circular RNA and constructs a plasmid, and verifies that the circular RNA can be smoothly circularized, and can downregulate 6 types of cancer-promoting miRNAs, and can inhibit the proliferation of glioma cells. And overexpression of the circular RNA can significantly inhibit tumor growth, confirming that the circular RNA plays a key role in the progression of glioma.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a circular RNA, an overexpression vector, a construction method, a detection primer and an application. Background Art

[0002] Glioblastoma is the most common malignant primary glioma in adults. It is highly invasive and heterogeneous, with a high recurrence rate and poor prognosis. Current treatment methods and drugs are still very limited.

[0003] MicroRNA, denoted as microRNA and abbreviated as miRNA, is a type of non-coding RNA that plays a regulatory role after gene transcription. It is denoted as non-coding RNA and abbreviated as ncRNA. Its length is about 21nt. So far, more than 2,000 mature human miRNAs have been discovered. Functionally, most protein-coding genes are regulated by miRNA. Its classic mechanism of action is to bind to the 3′ untranslated region of mRNA, leading to its degradation or translation inhibition. The 3′ untranslated region is abbreviated as 3′UTR. miRNA plays a role in many normal biological processes such as cell proliferation, differentiation and embryonic development, and also plays an important role in the occurrence and development of various tumors. In different types of tumors, miRNA can act as both a tumor promoter and a tumor suppressor.

[0004] Circular RNA, denoted as Circular RNA, abbreviated as circRNA, is produced by reverse splicing of linear transcripts and can come from any region of the genome. Its circular structure makes circRNA more stable than linear RNA. circRNA is usually located in the cytoplasm and also exists in the nucleus. It can interact with miRNA, mRNA or RNA-binding proteins to activate or inhibit gene expression, and can also function by acting as a miRNA or protein sponge. During tumor progression, circRNA plays the role of miRNA sponge on the one hand, indirectly affecting tumors by adsorbing cancer-promoting or cancer-suppressing miRNAs, and on the other hand, it directly affects tumor progression by encoding short peptides and proteins. Although circRNA can specifically adsorb multiple miRNAs to play a targeted regulatory role of multiple miRNAs, circular RNA in the prior art cannot meet the goal of simultaneously targeting multiple cancer-promoting miRNAs to achieve the goal of simultaneously targeting and downregulating cancer-promoting miRNAs. Summary of the invention

[0005] The purpose of the present invention is to design a circRNA and use it as an effector molecule in the treatment of glioblastoma.

[0006] The present invention is achieved through the following technical solutions:

[0007] A circular RNA, the nucleotide sequence of the circular RNA is shown as SEQ ID NO.21.

[0008] A circular RNA overexpression vector contains the circular RNA.

[0009] A method for constructing a circular RNA overexpression vector comprises connecting the circular RNA to an expression vector.

[0010] Preferably, the expression vector is pLO5-ciR.

[0011] Preferably, the circular RNA is ligated between the restriction endonuclease sites EcoRI and BamHI of pLO5-ciR.

[0012] A detection primer for the circular RNA, wherein the detection primer is a primer with a nucleotide sequence as shown in SEQ ID NO.8-10.

[0013] The use of a reagent that overexpresses the circular RNA in the preparation of a drug for inhibiting glioma.

[0014] Preferably, the reagent is an overexpression vector of circular RNA.

[0015] Preferably, the method for constructing the circular RNA overexpression vector is to connect the circular RNA to the expression vector pLO5-ciR.

[0016] Preferably, the drug reduces the volume of glioma.

[0017] In the early stage of the present invention, the whole transcriptome sequencing of glioma clinical specimens found that the expression levels of many miRNAs were significantly different between cancer and adjacent tissues, and the whole transcriptome sequencing was recorded as RNA-Seq. In particular, some miRNAs are significantly highly expressed in glioma cancer tissues. Considering that these miRNAs may be important cancer-promoting miRNAs in the progression of gliomas, cancer-promoting miRNAs are recorded as oncomiRs. Therefore, targeted therapy is planned for this type of miRNA. We focus on miR-21-5p, miR-106b-3p, miR-25-3p, miR-708-5p, miR-28-3p, and miR-15b-5p, which may promote the occurrence and development of gliomas. The circular RNA expression architecture is designed to achieve the goal of simultaneously targeting and downregulating the above six cancer-promoting miRNAs.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] The present invention constructs a circRNA that can target specific key cancer-promoting miRNAs, achieving the goal of simultaneously targeting and downregulating the above six cancer-promoting miRNAs, and greatly improving the functional effect of circular RNA.

[0020] After designing the circRNA, the present invention connected it to a vector that can express circular RNA and constructed a plasmid. In vitro experiments verified that the circRNA can be successfully circularized, can downregulate the above-mentioned 6 cancer-promoting miRNAs, and can inhibit the proliferation of glioma cells. In vivo experiments found that overexpression of the circRNA can significantly inhibit tumor growth. Combined with the above experimental results, it is confirmed that the circRNA plays a key role in the progression of glioma, and can therefore be used as a potential effector molecule for the treatment of glioma. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The drawings described herein are used to provide a further understanding of the embodiments of the present invention, constitute a part of this application, and do not constitute a limitation of the embodiments of the present invention. In the drawings:

[0022] Figure 1 This is a structural design diagram of circRNA in one embodiment of the present invention.

[0023] Figure 2 Figure 2 is a diagram of the circular RNA expression vector used in the present invention.

[0024] Figure 3 This is a sequencing diagram of a circRNA sequence in one embodiment of the present invention, wherein (a) shows the starting point of the target sequence and (b) shows the end point of the target sequence.

[0025] Figure 4 This is a sequencing diagram confirming the circularization of circRNA in one embodiment of the present invention.

[0026] Figure 5 The figure is a graph showing the down-regulation results of circRNA on 6 target miRNAs detected by qPCR in one embodiment of the present invention, wherein (a) is a graph showing the verification of circRNA overexpression, and (b) is a graph showing the verification of target miRNA down-regulation.

[0027] Figure 6 This is a graph showing the effect of CCK8 on tumor proliferation in one embodiment of the present invention.

[0028] Figure 7The figure shows the effect of in situ brain injection of glioma cells overexpressing circRNA into C57 mice on tumor progression in one embodiment of the present invention, wherein (a) is a fluorescence image of in vivo imaging, (b) is a tumor image after removing the mouse brain tissue, and (c) is a fluorescence imaging image of the ex vivo brain tissue, wherein the first rows in (a), (b) and (c) are the results of 3 empty plasmids, and the second rows are the results of 3 overexpressed circular RNA groups. DETAILED DESCRIPTION

[0029] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0030] The present invention uses GraphPad Prism 8.0 software to analyze all statistical results, and reasonably performs Student t test and Wilcoxon signed rank test. The results show that a p value less than 0.05 is statistically significant.

[0031] Example 1

[0032] In this example, the basic architecture of miR-17-92Cluster and the existing circularization method were used to load the complementary sequences of the six target miRNAs into the corresponding positions of miR-17-92Cluster, and further connected to the expression vector to form a complete plasmid structure. The accuracy of the sequence was verified by sequencing and can be used for subsequent in vitro and in vivo experiments. The complementary sequence is recorded as Anti-sense.

[0033] The specific experimental plan is as follows:

[0034] 1. circRNA design

[0035] Based on the natural structure of miR-17-92Cluster, the anti-sense of six miRNAs, miR-21-5p, miR-106b-3p, miR-25-3p, miR-708-5p, miR-28-3p, and miR-15b-5p, were used to replace the miRNA sequences of miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a-1 in the natural structure of miR-17-92Cluster, respectively. Among them, the anti-sense sequence of miR-21-5p was inserted into the position of miR-17, that is, between GACCA and AGCAT; the anti-sense sequence of miR-106b-3p was inserted into the position of miR-18a, that is, between CTTTT and ATAAG; the anti-sense sequence of miR-25-3p was inserted into the position of miR-19a, that is, between TGTTT and ATGGT; the anti-sense sequence of miR-708-5p was inserted into the position of miR-20a, that is, between CTTCT and CTAGC; the anti-sense sequence of miR-28-3p was inserted into the position of miR-19b-1, that is, between CTGAA and AACTG; the anti-sense sequence of miR-15b-5p was inserted into the position of miR-92a-1, that is, between AACCC and GAGTT.

[0036] The natural framework DNA sequence of miR-17-92Cluster is as follows: GAGGTGTTAATTCTAATT ATCTATTTCAAATTTAGCAGGAAAAAAGAGAACATCACCTTGTAAAACTGAAGATTGTGACCA GTCAGAATAATGTCAAAGTGCTTA CAGTGCAGGTAGTGATATGTGCATCTACTGCAGTGAAGGCACTTGT AGCATTATGGTGACAGCTGCCTCGGGAAGCCAAGTTGGGCTTTAAAGTGCAGGGCCTGCTGATGTTGAGTGCTTTT TGTTCTAAGGTGCATCTAGTGCAGATAGTG AAGTAGATTAGCATCTACTGCCCTAAGTGCTCCTTCTGGC ATAAGAAGTTATGTATTCATCCAATAATTCAAGCCAAGCAAGTATATAGGTGTTTTAATAGTTTTTGTTT GCAGTCCTCTGTTAGTTTTGCATAGTTGCACTACAAGAAGAA TGTAGTTGTGCAAATCTATGCAAAACTG ATGGTGGCCTGCTATTTCCTTCAAATGAATGATTTTTACTAATTTTGTGTACTTTTATTGTGTCGATGTAGAATCTGCCTGGTCTATCTGATGTGACAGCTTCT GTAGCACTAAAGTGCTTATA GTGCAGGTAGTGTTTAGTTATCTACTGCATTATGAGCACTTAAAGTACTG CTAGCTGTAGAACTCCAGCTTCGGCCTGTCGCCCAATCAAACTGTCCTGTTACTGAA CACTGTTCTATGGTTAGTTTTGCAGGTTTGCATCCAGCTGTGTG ATATTCTGCTGTGCAAATCCATGCAA AACTGACTGTGGTAGTGAAAAGTCTGTAGAAAAGTAAGGGAAAACTCAAACC CTTTCTACACAGGTTGGGATCGGTTGCAATGCTGTGTTTCTGTATGGTATTGCACTTGTCCCGGCCTGTT GAGTTTGGTGGGGATTGTGACCAGAAGATTTTGAAAATTAAATATTACTGAAGATTTCGACTTCCACTGTTAAATGTACAA, recorded as SEQ ID NO. 1. The underlined sequences are the sequences of miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a-1, respectively.

[0037] Anti-sense of miR-21-5p: TCAACATCAGTCTGATAAGCTA, recorded as SEQ ID NO. 2, replacing miR-17;

[0038] Anti-sense of miR-106b-3p: GCAGCAAGTACCCACAGTGCGG, recorded as SEQ ID NO.3, replacing miR-18a;

[0039] Anti-sense of miR-25-3p: TCAGACCGAGACAAGTGCAATG, recorded as SEQ ID NO. 4, replacing miR-19a;

[0040] Anti-sense of miR-708-5p: CCCAGCTAGATTGTAAGCTCCTT, recorded as SEQ ID NO.5, replacing miR-20a;

[0041] Anti-sense of miR-28-3p: TCCAGGAGCTCACAATCTAGTG, recorded as SEQ ID NO.6, replacing miR-19b-1;

[0042] Anti-sense of miR-15b-5p: TGTAAACCATGATGTGCTGCTA, recorded as SEQ ID NO.7, replacing miR-92a-1;

[0043] The obtained circular RNA sequence is: GAGGTGTTAATTCTAATTATCTATTTCAAAT, recorded as SEQ ID NO.21.

[0044] The circular RNA is then connected to an existing vector for expressing circular RNA, thereby forming a circRNA that can target and adsorb the above six mature miRNAs, such as Figure 1 The sequence was verified by sequencing.

[0045] 2. Expression vector ligation

[0046] The constructed circRNA nucleic acid sequence was connected to the existing circular RNA expression vector pLO5-ciR by molecular cloning using restriction endonuclease sites EcoRI and BamHI to obtain pLO5-Circ plasmid, which was then double-digested and sequenced to verify the accuracy of the plasmid sequence. Figure 2As shown, purchased from Jisai Biotechnology.

[0047] Plasmid sequencing results Figure 3 As shown, the sequence is correct, indicating that the plasmid overexpressing circRNA was successfully constructed.

[0048] Example 2

[0049] In this example, qPCR was used to detect the overexpression of circRNA and the downregulation of miRNA in the glioma cell line transfected with the plasmid. The results showed that circRNA could be successfully circularized and significantly overexpressed, and the six target miRNAs were significantly downregulated. Therefore, a stable transfection cell line was further constructed, and CCK8 was used to verify that overexpression of circRNA could inhibit the proliferation of glioma cells.

[0050] The specific experimental plan is as follows:

[0051] 1. Cell transfection

[0052] (1) One day in advance, the mouse glioma cell line GL261 was plated into a 6-well plate to ensure that the number of cells in each well was consistent, approximately 1*10^5 cells;

[0053] (2) 12 to 24 hours after plating, when the cell confluence is about 50% to 70%, transfection can be performed.

[0054] In this example, transfection was performed when the cell confluence was about 70% 20 hours after plating. The transfection reagent used was PEI40K purchased from Wuhan Saiweier. The transfection was completed according to the operating steps in the PEI 40K reagent manual. The specific operation was as follows:

[0055] a) Before transfection, remove the original cell culture medium, wash once with PBS, and replace with 1.8 mL of serum-free high-glucose DMEM medium;

[0056] b) Place the cells with replaced medium in a cell culture incubator and start preparing transfection complexes.

[0057] c) Prepare Solution A: 100 μL serum-free basal medium and 2 μg plasmid DNA, mix by pipetting; the control plasmid is pLO5 empty plasmid, marked as Con, and the experimental group plasmid is the previously constructed pLO5-Circ plasmid, marked as Circ;

[0058] d) Prepare Solution B: 100 μL serum-free high-glucose DMEM medium and 8 μL PEI 40K, mix thoroughly by pipetting;

[0059] e) Add solution B to solution A, pipette gently to mix, and incubate at room temperature for 15 minutes to form a DNA-PEI transfection complex.

[0060] f) Add the transfection complex obtained in the previous step dropwise into the 6-well plate in a circular manner;

[0061] g) Hold the 6-well plate and draw an “8” shape on the surface to gently shake the 6-well plate to mix thoroughly. Place it at 37°C and 5% CO 2 Incubator;

[0062] (3) After the DNA-PEI transfection complex and cells were incubated for 7 h, the culture medium was removed and 2.5 mL of fresh high-glucose DMEM medium containing 10% serum was added. The cells were continued to be incubated at 37°C and 5% CO. 2 Cultivate in a constant temperature incubator;

[0063] (4) After 48 h of culture, the cells were harvested for subsequent experiments.

[0064] 2. Extraction and quantification of total cellular RNA

[0065] (1) 48 hours after transfection, the cell confluence in the 6-well plate basically exceeded 90%. Then the old culture medium was discarded, and after washing with PBS, 1 mL of TRIzol was added to each well, allowed to stand for 5 minutes, and then transferred to a 1.5 mL Eppendorf tube;

[0066] (2) Add 0.2 mL of chloroform to the Ep tube, shake for about 15 seconds, and then leave at room temperature for 3 minutes;

[0067] (3) Centrifuge at 12,000 rpm and 4°C for 15 min. The solution in the Ep tube is divided into three layers. The bottom layer is red organic matter and the upper layer is colorless aqueous phase. RNA is present in the aqueous phase.

[0068] (4) Transfer 0.5 mL of the upper layer solution to a new EP tube, then add an equal volume of isopropanol, shake well, and leave at room temperature for 10 min;

[0069] (5) Centrifuge at 12,000 rpm and 4°C for 10 min. A white precipitate can be observed at the bottom of the Eppendorf tube, which is RNA.

[0070] (6) Discard the supernatant and wash the RNA precipitate with 75% ethanol solution by centrifugation at 7500 rpm and 4°C for 5 min;

[0071] (7) Discard the supernatant, dry the RNA precipitate, and then add DEPC water to dissolve the RNA;

[0072] (8) The concentration and purity of the extracted total RNA were detected using a NanoDrop 2000 spectrophotometer.

[0073] 3. RNA reverse transcription synthesis of cDNA and qPCR experiments

[0074] (1) Prepare RNA reverse transcription system on ice. The reagents are purchased from TAKARA, catalog number RR036A. The reverse transcription reaction system is shown in Table 1:

[0075] Table 1 Reverse transcription reaction system

[0076]

[0077]

[0078] After gentle mixing, reverse transcription was performed under the following conditions: 15 min at 37°C for reverse transcription, followed by 5 sec at 85°C for reverse transcriptase inactivation. After cooling to 4°C, the cDNA obtained was transferred to ddH 2 O was diluted 5 times and then stored in a -20°C refrigerator for subsequent experiments.

[0079] (2) Prepare the qRT-PCR reaction system on ice, and use the product obtained by the above reverse transcription as the cDNA template. The qRT-PCR reaction system is shown in Table 2:

[0080] Table 2 qRT-PCR reaction system

[0081] Components volume 2×qPCRSYBR Green Master Mix 10μL 10 μM PCR upstream primer 0.8μL 10 μM PCR downstream primer 0.8μL cDNA template 2μL <![CDATA[ddH 2 The]]> To 20 μL

[0082] When PCR was used to detect circular RNA expression, two pairs of primers were used: ① upstream primer circ_Sp6miR-F1 and downstream primer circ_Sp6miR-R1; ② upstream primer circ_Sp6miR-F2 and downstream primer circ_Sp6miR-R1. At the same time, ACTB was used as an internal reference gene, and the primers used were upstream primer ACTB-qF and downstream primer ACTB-qR. The relevant primer sequences are as follows:

[0083] circ_Sp6miR-F1: CCACTGTTAAATGTACAAGAG, recorded as SEQ ID NO.8;

[0084] circ_Sp6miR-F2: TGAAAAGTCTGTAGAAAAGTAAGG, recorded as SEQ ID NO.9;

[0085] circ_Sp6miR-R1: CACCATAATGCTTAGCTTATC, recorded as SEQ ID NO.10;

[0086] ACTB-qF: AGCGAGCATCCCCCAAAGTT, recorded as SEQ ID NO. 11;

[0087] ACTB-qR: GGGCACGAAGGCTCATCATT, recorded as SEQ ID NO. 12;

[0088] (3) The reaction conditions include: the first step: pre-denaturation at 95°C for 5 minutes; the second step: PCR reaction for 45 cycles, 95°C for 10 seconds, 56°C for 15 seconds, and 72°C for 15 seconds; the third step: melting curve analysis at 65°C for 5 seconds and 95°C for 5 seconds.

[0089] (4) Quantitative analysis after PCR amplification.

[0090] The above qPCR experimental results are as follows Figure 5 As shown in a, it can be seen that circRNA is successfully overexpressed in glioma cells.

[0091] 4. Reverse transcription of miRNA into cDNA and qPCR experiments

[0092] (1) Prepare the miRNA reverse transcription system on ice. The reverse transcription reaction system is shown in Table 3:

[0093] Table 3 Reverse transcription reaction system

[0094] Components volume miScriptRTEnzymeMix 1μL 5×HiSpecBuffer 2μL 10×NucleicsMix 1μL Total RNA 500ng <![CDATA[RNase-FreeddH 2 The]]> To 10 μL

[0095] The reverse transcription reaction conditions were as follows: 60 min at 37°C for reverse transcription, followed by 5 min at 95°C for reverse transcriptase inactivation. After cooling to 4°C, the cDNA obtained was purified by ddH 2 O was diluted 5 times and then stored in a -20°C refrigerator for subsequent experiments.

[0096] (2) Prepare the qRT-PCR reaction system on ice, and use the product obtained by the above reverse transcription as the cDNA template. The qRT-PCR reaction system is shown in Table 2:

[0097] Table 4 qRT-PCR reaction system

[0098] Components volume 2×qPCRSYBR Green Master Mix 10μL miRNAPrimer 0.5μL UniversePrimer 0.5μL cDNA template 2μL <![CDATA[ddH 2 The]]> To 20 μL

[0099] When PCR is used to detect miRNA expression, the upstream primer is a primer specific to each miRNA sequence, as shown in SEQ ID NO.13-18, and the downstream primer is the universal primer Universe Primer in the kit, wherein the kit is purchased from QIAGEN, with a catalog number of 218073. At the same time, U6 is used as an internal reference gene, and the primers used are the upstream primer U6-qF and the downstream primer U6-qR. The relevant primer sequences are as follows:

[0100] Upstream primer of miR-21-5p: TAGCTTATCAGACTGATGTTGA, recorded as SEQ ID NO. 13;

[0101] Upstream primer of miR-106b-3p: CCGCACTGTGGGTACTTGCTGC, recorded as SEQ ID NO.14;

[0102] Upstream primer of miR-25-3p: CATTGCACTTGTCTCGGTCTGA, recorded as SEQ ID NO. 15;

[0103] Upstream primer of miR-708-5p: AAGGAGCTTACAATCTAGCTGGG, recorded as SEQ ID NO. 16;

[0104] Upstream primer of miR-28-3p: CACTAGATTGTGAGCTCCTGGA, recorded as SEQ ID NO. 17;

[0105] Upstream primer of miR-15b-5p: TAGCAGCACATCATGGTTTACA, recorded as SEQ ID NO. 18;

[0106] U6-qF: GTGCTCGCTTCGGCAGCACATATAC, recorded as SEQ ID NO. 19;

[0107] U6-qR: AAAAATATGGAACGCTTCACGAATTTG, recorded as SEQ ID NO. 20;

[0108] (3) The reaction conditions include: step 1: pre-denaturation at 95°C for 5 minutes; step 2: PCR reaction for 45 cycles at 95°C for 10 seconds, 56°C for 15 seconds, and 72°C for 15 seconds; step 3: melting curve analysis at 65°C for 5 seconds and 95°C for 5 seconds;

[0109] (4) Quantitative analysis after PCR amplification.

[0110] The above qPCR experimental results are as follows Figure 5 As shown in b, it can be seen that after circRNA is overexpressed in glioma cells, the six miRNAs can be significantly downregulated, indicating that the circRNA successfully plays the role of adsorbing cancer-promoting miRNAs.

[0111] 5. Virus packaging

[0112] (1) One day in advance, plate the 293T cells used for lentiviral packaging into a 6 cm cell culture dish to ensure that the cell number is basically the same;

[0113] (2) During transfection, the procedure is basically the same as that of ordinary transfection, except that multiple plasmids are transfected at the same time. The multiple plasmids are: control plasmid, i.e., pLO5 empty plasmid, as the control group; target plasmid, i.e., circRNA overexpression plasmid, also counted as pLO5-Circ, as the experimental group; auxiliary plasmids, i.e., psPAX2 and pMD2G. The control plasmid and auxiliary plasmid are transfected together, and the target plasmid and auxiliary plasmid are transfected together. The ratio is control plasmid: psPAX2: pMD2.G = 4:3:1, target plasmid: psPAX2: pMD2.G = 4:3:1, 8 μg plasmid per well, using 25 μL PEI 40K transfection reagent, to prepare a transfection complex with a volume of 1.5 mL; the transfection procedure is the same as before, and the solution is changed after 6 hours;

[0114] (3) The cell culture supernatant was collected once at 24 h and 48 h after the medium was replaced, mixed, centrifuged at 2200 rpm for 5 min, filtered with a 0.45 μm filter, and dispensed into 1.5 mL Eppendorf tubes and stored at -80°C to obtain the virus solutions of the control group and the experimental group.

[0115] 6. Construction of stable cell lines

[0116] (1) Take out the virus solution of the control group and the experimental group frozen at -80°C, place it on ice, and wait for it to thaw on its own;

[0117] (2) Prepare a 5 mL Eppendorf tube, add 1 mL of fresh DMEM medium containing 10% serum and 10 μg Polybrene in advance, then add 1 mL of virus solution from the control group and the experimental group respectively, mix well and set aside;

[0118] (3) Take out the GL261 mouse glioma cell line to be infected that has been plated in a 6-well plate. The cell confluency is preferably 40%. Discard the old culture medium and wash once with PBS. Then add the suspension to the corresponding well, shake well and place at 37°C, 5% CO 2 Cultivate in a constant temperature incubator;

[0119] (4) After the cells grow to 60% confluency, add 2.5 μg / mL of puromycin to the normal culture medium to prepare a drug screening medium, use the medium to replace the old culture medium, and then culture for 48 hours, which is considered to be the end of the drug screening; wherein the normal culture medium is high-glucose DMEM containing 10% fetal bovine serum;

[0120] (5) After the drug screening is completed, the culture medium containing puromycin is discarded and replaced with normal culture medium. The successfully constructed stable cell line is then passaged and preserved to obtain a stable cell line of the control group and a stable cell line of the experimental group overexpressing circRNA.

[0121] 7. CCK-8 proliferation assay, CCK-8 is the abbreviation of Cell Counting Kit-8

[0122] CCK-8 Cell Proliferation Kit, based on the water-soluble characteristics of WST-8, is directly added during the culture of living cells, and then interacts with intracellular dehydrogenase to generate yellow formazan, which is recorded as formazan. The amount of formazan generated is proportional to the number of living cells. By measuring the absorbance value, usually at a wavelength of 450nm, cell proliferation can be quantitatively analyzed.

[0123] (1) Stable cell lines of the control group and experimental group were inoculated in 96-well plates, with 1000 cells per well;

[0124] (2) Add 100 μL / well of CCK-8 working solution to the corresponding wells on the 1st, 2nd, and 3rd day after inoculation; the volume ratio of serum DMEM to CCK8 reagent in the CCK-8 working solution is 9:1;

[0125] (3) Place at 37°C, 5% CO 2 The culture time is about 1 hour;

[0126] (4) Finally, the absorbance was measured at 450 nm using an enzyme-labeled instrument.

[0127] The experimental results are shown in Figure 6 The Con group was a control group stably transformed cell line infected with the control virus, and the Circ group was a stable cell line infected with the overexpressed circRNA virus. Figure 6 It can be seen that after circRNA overexpression, the proliferation ability of glioma cells was significantly inhibited.

[0128] Example 3

[0129] In this example, a C57 mouse brain orthotopic tumor model was constructed, and a stable transgenic line overexpressing circRNA was transplanted into the striatum of the mouse brain to observe the effect of circRNA on the progression of glioma.

[0130] In this example, male C57BL / 6J mice with an average age of 7 weeks were used for the experiments. The mice were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.

[0131] Construction of orthotopic transplanted tumor model in mouse brain

[0132] (1) The mouse glioma cell line overexpressing circRNA constructed in Example 2 was amplified, and collected and counted when it was in the logarithmic growth phase. The count requirement was 5*10^5 / 3 μL. After washing with PBS, it was resuspended in serum-free DMEM, and the collected cells were placed on ice to ensure cell viability;

[0133] (2) Preparation of mice: weigh them in order, and calculate the dosage (μL) of 1% sodium pentobarbital according to the formula of body weight (g)*10, that is, inject 200μL 1% sodium pentobarbital into a 20g mouse, then use a 1mL syringe to draw 1% sodium pentobarbital and anesthetize the mouse by intraperitoneal injection. If the mouse loses consciousness but still has a heartbeat, it is considered to be well anesthetized. Then, use an electric shaver to shave the hair on the top of the head to fully expose the surgical area on the top of the head;

[0134] (3) Instrument preparation, use of a brain localizer for injection, startup and debugging of the instrument and setting of the corresponding parameters, adjustment of the mouse fixation device to an appropriate position, and rinsing of the microinjector;

[0135] (4) Use a microsyringe to absorb cells and fix them to the brain locator device; wipe the surgical site with an alcohol cotton ball, cut the skin, find the anterior fontanelle, and press lightly to make the site turn white. Mark the point and record the instrument coordinate parameters at this time.

[0136] (5) Then, using this coordinate as the reference point, move 2 mm to the right and then 1 mm forward to mark the point. This point is the location of the striatum in the mouse skull. Use an electric drill to gently drill a small hole downward. At the same time, the syringe has already sucked up all the cells to a scale of 3 μL.

[0137] (6) According to the coordinate point recorded earlier, gently move the microinjector downward into the hole. After the needle is inserted 3 mm, slowly inject the cells at a speed of 0.5 μL / min, for a total of 3 μL. After the injection is completed, stop the needle for 3 minutes and then slowly withdraw the needle.

[0138] (7) placing the mouse that has undergone step (6) on a constant temperature pad and waiting for it to wake up, and then placing it back into the cage after it wakes up;

[0139] (8) In the following 3 weeks, the mouse brain area was imaged with a small animal in vivo imager to observe the progression of the tumor. Finally, the mice were killed 3 weeks after modeling, and the brain tissue was removed to determine the tumor growth.

[0140] The experimental results are as follows Figure 7As shown in the figure, (a) is a live fluorescence image, from which it can be seen that the growth of glioma in the circRNA overexpression group was significantly inhibited; (b) shows that the size of mouse brain tumors in the two groups was significantly different, and the tumor volume in the circRNA overexpression group was significantly smaller than that in the control group; (c) is a supplementary verification of (b). The above results show that overexpression of circRNA can significantly inhibit tumor progression.

[0141] The design method of the circular RNA constructed by the present invention is not limited to specific cancer types and miRNAs. It only needs to perform bioinformatics analysis on the corresponding tumors, find cancer-promoting miRNAs, and design and optimize circRNAs accordingly. It has a wide range of applications.

[0142] The present invention can be combined with existing tumor treatment plans to further enhance the therapeutic efficacy through combined treatment, thereby gaining a longer survival period for patients.

[0143] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0144] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0145] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A circular RNA, characterized in that The nucleotide sequence of the circular RNA is shown in SEQ ID NO.

21.

2. A circular RNA overexpression vector, characterized in that: Containing the circular RNA according to claim 1.

3. A method for constructing a circular RNA overexpression vector, characterized in that: The circular RNA according to claim 1 is connected to an expression vector.

4. The construction method according to claim 3, characterized in that: The expression vector is pLO5-ciR.

5. The construction method according to claim 4, characterized in that: The circular RNA was ligated between the restriction endonuclease sites EcoRI and BamHI of pLO5-ciR.

6. A detection primer for circular RNA according to claim 1, characterized in that: The detection primers are primers with nucleotide sequences as shown in SEQ ID NO.8-10.

7. Use of a reagent that overexpresses the circular RNA according to claim 1 in the preparation of a drug for inhibiting glioma.

8. The use according to claim 7, characterized in that: The reagent is an overexpression vector of circular RNA.

9. The use according to claim 7, characterized in that: The method for constructing the circular RNA overexpression vector is to connect the circular RNA to the expression vector pLO5-ciR.

10. The use according to claim 7, characterized in that: The drug reduces the size of gliomas.

Images