Mutants regulating maize grain filling and dehydration and their applications

Abstract

The present invention discloses a ZmPHYB1 and ZmPHYB2 The invention relates to a gene mutant and its application in corn seeds, belonging to the field of plant biotechnology breeding. ZmPHYB1 and / or ZmPHYB2 gene, after the plant has a loss-of-function mutation in an endogenous gene, or ZmPHYB1 and / or ZmPHYB2 After gene expression is inhibited, a phenotype with smaller grains, reduced grain weight, shortened corn grain filling time, reduced grain moisture content and / or increased dehydration rate can be obtained. The aforementioned gene resources and their application methods have broad application prospects in the field of corn breeding.

Description

Technical Field

[0001] The present invention belongs to the field of plant biotechnology breeding, and specifically relates to the use of ZmPHYB1 and ZmPHYB2 The gene produces a loss-of-function mutation, and a method for regulating the filling rate of corn kernels, accelerating the dehydration of corn kernels, and regulating the size of kernels and its application are obtained. Background Art

[0002] Corn is one of the most important food crops and feed crops in the world, and is also an important chemical, fuel and pharmaceutical raw material. In recent years, with the increase in corn density, the development of intensive production models, and the increase in labor costs, mechanized harvesting of corn has gradually become an inevitable trend in the development of corn production. However, there is a severe shortage of corn varieties suitable for mechanized harvesting. The main bottleneck restricting mechanized harvesting of corn is the high moisture content of corn kernels during harvesting.

[0003] Analysis of the dynamic changes in water content during grain development shows that the grain dehydration process can be divided into two stages: the developmental dehydration process related to grain filling and the drying and dehydration process after physiological maturity. The first stage is the developmental dehydration of grains, mainly the developmental dehydration of corn grains during the grain filling process. The corn filling period refers to the corn grain formation period, when 90% of the photosynthetic products of the plant leaves and the nutrients absorbed by the roots and substances temporarily stored by other organs are continuously transported to the grains. This is a critical period for determining the yield and quality of corn grains. The second stage is the drying and dehydration after grain maturity. During this period, the grains reach physiological maturity. Due to the formation of the black layer, there is no longer any exchange of water and nutrients between the grains and the mother plant. The water loss after maturity is mainly the loss of water through evaporation on the surface of the grains, which is a physical process.

[0004] Corn kernel dehydration is mainly regulated by external factors and internal genetic factors. External environmental factors mainly include environmental factors such as temperature, light, rainfall or air humidity, as well as morphological and physiological factors: cob posture, bract-related traits (number of layers, length, etc.), grain quality, cob, pericarp, grain characteristics and cob size. Internal genetic regulation is the most critical factor affecting the rate of kernel dehydration. However, the genes that have been cloned to regulate corn kernel filling and dehydration are still very limited. Therefore, providing new genes that regulate the rate of kernel filling and dehydration of corn is of great significance for increasing corn yield and realizing mechanized harvesting. Summary of the invention

[0005] All references mentioned herein are incorporated herein by reference. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Unless otherwise specified, the techniques used or mentioned herein are standard techniques known to one of ordinary skill in the art. Materials, methods, and examples are for illustrative purposes only and are not intended to be limiting.

[0006] The present invention has found through a series of experimental studies that corn plants have endogenous ZmPHYB1 and ZmPHYB2 When a gene produces a loss-of-function mutation, it has unexpected technical effects. The corn loss-of-function double mutant has a phenotype of smaller grains, reduced grain weight, shortened corn grain filling time, reduced grain moisture content and / or increased dehydration rate. The aforementioned gene resources and functions are of great significance to corn breeding.

[0007] The present application provides a method for producing corn plants, wherein the corn plants have a phenotype of smaller kernels, reduced kernel weight, shortened kernel filling time, reduced kernel moisture content, and / or increased dehydration rate, the method comprising the steps of:

[0008] (a) producing one or more corn plants, wherein the corn plants have an endogenous ZmPHYB1 Genes and ZmPHYB2 Each gene contains at least one loss-of-function mutation, or endogenous ZmPHYB1 Genes and ZmPHYB2 Gene expression is suppressed;

[0009] (b) obtaining at least one seed of the corn plant produced in step (a).

[0010] Optionally, the ZmPHYB1 The polynucleotide sequence of the gene is selected from one of the following groups of sequences:

[0011] (a) a polynucleotide sequence as shown in SEQ ID No: 1 or 2;

[0012] (b) a polynucleotide sequence encoding an amino acid sequence as shown in SEQ ID No: 3;

[0013] (c) a polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under stringent hybridization conditions, and a loss-of-function mutation of the polynucleotide sequence endogenous to corn plants has the function of reducing grain size, grain weight, shortening corn grain filling time, reducing grain water content and / or increasing dehydration rate;

[0014] (d) a polynucleotide sequence that is at least 90%, 95%, 98% or more similar to any of the polynucleotide sequences shown in (a) to (c), and a loss-of-function mutation of the polynucleotide sequence endogenous to a corn plant has the function of making the plant's kernels smaller, kernel weight lower, kernel filling time shorter, kernel moisture content lower and / or dehydration rate higher; or

[0015] (e) A polynucleotide sequence complementary to any one of the sequences described in (a) to (d).

[0016] Optionally, the ZmPHYB2 The polynucleotide sequence of the gene is selected from one of the following groups of sequences:

[0017] (a) a polynucleotide sequence as shown in SEQ ID No: 4 or 5;

[0018] (b) a polynucleotide sequence encoding an amino acid sequence as shown in SEQ ID No: 6;

[0019] (c) a polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under stringent hybridization conditions, and a loss-of-function mutation of the polynucleotide sequence endogenous to a corn plant has the function of making the plant's grains smaller, reducing grain weight, shortening the grain filling time of corn, reducing grain moisture content and / or increasing the dehydration rate;

[0020] (d) a polynucleotide sequence that is at least 90%, 95%, 98% or more similar to any of the polynucleotide sequences shown in (a) to (c), and a loss-of-function mutation of the polynucleotide sequence endogenous to a corn plant has the function of making the plant's kernels smaller, kernel weight lower, kernel filling time shorter, kernel moisture content lower and / or dehydration rate higher; or

[0021] (e) A polynucleotide sequence complementary to any one of the sequences described in (a) to (d).

[0022] Optionally, the embodiments of the present application provide ZmPHYB1 or ZmPHYB2 Genes, including homologous genes or the same genes of different varieties with at least 80%, 85%, 90%, 95%, 98% or 99% sequence similarity to their polynucleotide sequences, or homologous genes with at least 80%, 85%, 90%, 95%, 98% or 99% sequence similarity to the polynucleotide sequences disclosed in the embodiments of the present invention. ZmPHYB1 or ZmPHYB2 The amino acid sequence of the gene has at least 90%, 95% or 98% sequence similarity with homologous genes or the same gene in different varieties, and after the endogenous homozygous loss-of-function mutation of the homologous gene, it has the function of making the plant's grains smaller, reducing grain weight, shortening the filling time of corn grains, reducing grain water content and / or increasing the dehydration rate. The homologous gene can be isolated and obtained from any plant.

[0023] Optionally, the method provided in this application can be applied to any ZmPHYB1 or ZmPHYB2 Preferably, the plants include monocots such as corn, millet, wheat, barley, rye, rice and sorghum and dicots such as cotton, corn, peanut, sunflower, sweet potato, potato, apple and tobacco.

[0024] The percentages of sequence similarity described in this application can be obtained by well-known bioinformatics algorithms, including the Myers and Miller algorithm, the Needleman-Wunsch global alignment method, the Smith-Waterman local alignment method, the Pearson and Lipman similarity search method, the Karlin and Altschul algorithm, which are well known to those skilled in the art.

[0025] Those skilled in the art should know that there is single nucleotide polymorphism (SNP) in the same gene between different varieties of the same plant, that is, the nucleotide sequence of the same gene often has differences in individual bases, but there are many varieties of the same crop, and the inventors cannot list them one by one. The examples of this application only provide sequences of representative varieties of corn crops. Therefore, those skilled in the art should know that different varieties from different sources are different from those disclosed in the present invention. ZmPHYB1 or ZmPHYB2 The method and application of genes and their nucleotide sequences containing SNP nucleotide sequences, utilizing their endogenous loss-of-function mutations to obtain traits such as smaller grains, reduced grain weight, shortened corn grain filling time, reduced grain moisture content and / or increased dehydration rate, are also within the protection scope of the present invention.

[0026] Optionally, the loss-of-function mutation described in the present application is obtained by mutation, and the mutation includes substitution, deletion and / or addition of one or more nucleotides in the nucleotide sequence of the gene.

[0027] Optionally, the loss-of-function mutation includes, but is not limited to, being obtained by physical mutagenesis, chemical mutagenesis, gene editing, etc. Physical mutagenesis includes, but is not limited to, radiation mutagenesis, space breeding, etc.; chemical mutagenesis includes mutagenesis caused by treatment with mutagens such as EMS; gene editing includes, but is not limited to, ZFN, TALEN, and / or CRISPR / Cas, etc.

[0028] Those skilled in the art are aware that the main principle of the CRISPR / Cas gene editing system or gene editing method is to find the position to be gene-edited in the host genome through a nucleic acid fragment called guide RNA (gRNA), that is, the target DNA sequence, and then cut the DNA through the Cas protein. In this application, the Cas protein includes but is not limited to proteins such as Cas9, Cas12, Cas12a, Cas12j, Cas12e, Cas13, and / or Cas14.

[0029] Optionally, when the gene editing system used is CRISPR / Cas9, the target sequence used in the CRISPR / Cas9 technology for the gene mutant sequence obtained by the CRISPR / Cas9 method is selected from one of the sequences in the following group:

[0030] (a) A fragment conforming to the 5'-Nx-NGG-3' sequence arrangement rule in the nucleotide sequences shown in SEQ ID No: 1, 2, 4, or 5, where N represents any one of A, G, C, and T, 14 < X < 30, and X is an integer, and Nx represents X consecutive nucleotides; or

[0031] (b) A nucleotide sequence complementary to the polynucleotide sequence described in (a).

[0032] Optionally, the maize plant has ZmPHYB1 and ZmPHYB2 a gene double mutant, and the mutation of the mutant is the insertion of a Mu transposon between the 1377th and 1378th bases of SEQ ID NO: 1, or the insertion of a Mu transposon between the 1034th and 1035th bases of SEQ ID NO: 2, or the sequence between the 44th and 126th bases of SEQ ID NO: 4 is mutated from SEQ ID NO: 7 to SEQ ID NO: 8.

[0033] Optionally, the loss-of-function mutation described in the embodiments of this application can also be obtained by crossing with a maize plant having this loss-of-function mutation.

[0034] Optionally, in the method described in the embodiments of this application, the reduction or inhibition ZmPHYB1 and / or ZmPHYB2Normal expression or protein function of homologous genes, including those obtained by RNA interference (i.e., RNAi) and / or mutation. Those skilled in the art know that RNAi technology is a conventional technology in the art, which specifically binds to the mRNA homologous region expressed by the target gene through a short double-stranded RNA (siRNA: small interfering RNA) of 21-23bp or a long double-stranded RNA (dsRNA: double-strand RNA), thereby degrading the mRNA and achieving the effect of inhibiting gene expression.

[0035] Alternatively, in the present application, RNAi can be used to inhibit endogenous ZmPHYB1 Genes and ZmPHYB2 The expression of the gene affects the activity of the aforementioned gene, inhibits the expression of the gene, and makes the corn plant have a phenotype of smaller grains, reduced grain weight, shortened corn grain filling time, reduced grain moisture content and / or increased dehydration rate.

[0036] Optionally, the present application also provides an application of any of the aforementioned methods in corn breeding. Preferably, the application includes but is not limited to the application in regulating traits such as making corn plant kernels smaller, reducing kernel weight, shortening corn kernel filling time, reducing kernel moisture content and / or increasing dehydration rate.

[0037] Optionally, the present application embodiment also provides a feed, meal, protein or oil product made from corn, wherein the feed, meal, protein or oil product contains ZmPHYB1 Genes and / or ZmPHYB2 Loss-of-function mutants of genes, ZmPHYB1 Genes and / or ZmPHYB2 Each gene contains at least one loss-of-function mutation, or endogenous ZmPHYB1 Genes and / or ZmPHYB2 Gene expression is inhibited. The loss-of-function mutation includes substitution, deletion and / or addition of one or more nucleotides in the nucleotide sequence of the aforementioned gene.

[0038] Optionally, the present application embodiment also provides a gene mutant, wherein the gene mutant is ZmPHYB1 or ZmPHYB2 A loss-of-function mutant of maize, characterized in that the endogenous ZmPHYB1 and / or ZmPHYB2 After the gene mutation, it has the function of making the plant's grains smaller, reducing grain weight, shortening the corn grain filling time, reducing grain moisture content and / or increasing dehydration rate. ZmPHYB1 The polynucleotide sequence of the gene is selected from one of the following groups of sequences:

[0039] (a) a polynucleotide sequence as shown in SEQ ID No: 1 or 2;

[0040] (b) a polynucleotide sequence encoding an amino acid sequence as shown in SEQ ID No: 3;

[0041] (c) a polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under stringent hybridization conditions, wherein a loss-of-function mutation of the polynucleotide sequence endogenous to a corn plant has the function of making the plant's grains smaller, grain weight lower, corn grain filling time shorter, grain moisture content lower, and / or dehydration rate higher;

[0042] (d) a polynucleotide sequence that is at least 90%, 95%, 98% or more similar to any of the polynucleotide sequences shown in (a) to (c), and a loss-of-function mutation of the polynucleotide sequence endogenous to a corn plant has the function of making the plant's kernels smaller, the kernel weight lower, the kernel filling time shorter, the kernel moisture content lower and / or the dehydration rate higher; or

[0043] (e) a polynucleotide sequence complementary to any one of the sequences described in (a) to (d);

[0044] Said ZmPHYB2 The polynucleotide sequence of the gene is selected from one of the following groups of sequences:

[0045] (a) a polynucleotide sequence as shown in SEQ ID No: 4 or 5;

[0046] (b) a polynucleotide sequence encoding an amino acid sequence as shown in SEQ ID No: 6;

[0047] (c) a polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under stringent hybridization conditions, and a loss-of-function mutation of the polynucleotide sequence endogenous to a corn plant has the function of making the plant's grains smaller, reducing grain weight, shortening the grain filling time of corn, reducing grain moisture content and / or increasing the dehydration rate;

[0048] (d) a polynucleotide sequence that is at least 90%, 95%, 98% or more similar to any of the polynucleotide sequences shown in (a) to (c), and a loss-of-function mutation of the polynucleotide sequence endogenous to a corn plant has the function of making the plant's kernels smaller, kernel weight lower, kernel filling time shorter, kernel moisture content lower and / or dehydration rate higher; or

[0049] (e) A polynucleotide sequence complementary to any one of the sequences described in (a) to (d).

[0050] Alternatively, the transfer of nucleotide sequence, vector, construct or expression cassette into plant or introduction into plant or transformation of plant described in the examples of the present application refers to the transfer of target nucleotide sequence, construct, vector or expression cassette into recipient cell or recipient plant by conventional transgenic method or hybridization with target transgenic plant. Any transgenic method known to those skilled in the art can be used to transform the recombinant expression vector into plant cells to produce transgenic plants or mutants of the examples of the present application. The transformation method may include direct or indirect transformation methods. Specifically, the transformation method includes but is not limited to polyethylene glycol-induced DNA uptake, liposome-mediated transformation, introduction using a gene gun, electroporation, microinjection, and Agrobacterium-mediated plant transformation methods, etc.

[0051] Compared with the prior art, this application has the following beneficial effects:

[0052] (1) The present application provides a method for producing corn plants and its application, by making corn endogenous ZmPHYB1 Genes and ZmPHYB2 Each gene contains at least one loss-of-function mutation, or endogenous ZmPHYB1 Genes and ZmPHYB2 Gene expression is inhibited, thereby obtaining plants with excellent agronomic traits such as smaller grains, reduced grain weight, shortened corn grain filling time, reduced grain moisture content and / or increased dehydration rate. The aforementioned genes, methods and their applications provide new germplasm resources and breeding ideas for corn breeding, which are of great significance to global food security and sustainable agricultural development;

[0053] (2) It is clear that ZmPHYB1 Genes and ZmPHYB2 The function of double gene mutation provides new genetic resources for crop species;

[0054] (3) Through the double mutation of two genes, the normal expression or protein function of the aforementioned genes can be reduced or inhibited, thereby obtaining breeding materials with application value, providing new ideas for crop breeding and the study of gene action mechanism networks.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods, devices and materials are now described.

[0056] In the context of this application, the term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.

[0057] The term "homologous genes" in this application refers to two or more gene sequences with a sequence similarity of 80%, including orthologous genes (also known as vertical homologous genes, orthologous genes or directed evolutionary homologous genes), horizontal homologous genes (also known as paralogous genes, parallel homologous genes or parallel evolutionary homologous genes) and / or heterologous genes.

[0058] The term sequence "similarity" refers to the degree of similarity between two sequences. It is a quantitative concept used to compare the degree of similarity between different sequences, so as to discover and analyze the relationship between two sequences. Sequence similarity can be used to compare gene sequences, protein sequences, DNA sequences, etc.

[0059] "Stringent hybridization conditions" as used herein refer to conditions of low ionic strength and high temperature as known in the art. Generally, under stringent conditions, the detectable degree of hybridization of a probe to its target sequence is higher than the detectable degree of hybridization to other sequences (e.g., at least 2 times above background). Stringent hybridization conditions are sequence-dependent and will be different under different environmental conditions, with longer sequences specifically hybridizing at higher temperatures. By controlling the stringency of hybridization or washing conditions, a target sequence that is 100% complementary to the probe can be identified. For detailed guidance on nucleic acid hybridization, reference can be made to the relevant literature (Tijssen, Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays. 1993). More specifically, the stringent conditions are usually selected to be lower than the thermal melting point (T) of the specific sequence at a specified ionic strength pH. m ) about 5-10℃. T m The temperature (under specified ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (because the target sequence is present in excess, the temperature at T mStringent conditions may be those in which the salt concentration is less than about 1.0 M sodium ion concentration, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is at least about 30° C. for short probes (including but not limited to 10 to 50 nucleotides) and at least about 60° C. for long probes (including but not limited to greater than 50 nucleotides). Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal may be at least two times the background hybridization, optionally 10 times the background hybridization. Exemplary stringent hybridization conditions may be as follows: 50% formamide, 5×SSC and 1% SDS, incubated at 42° C.; or 5×SSC, 1% SDS, incubated at 65° C., washed in 0.2×SSC and washed in 0.1% SDS at 65° C. The washing may be performed for 5, 15, 30, 60, 120 minutes or longer.

[0060] The term "recombinant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, together with vectors with helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selection markers engineered to be expressed in plant cells, heterologous DNA sequences to be transcribed, etc.

[0061] The term "hybridization" is a broad term that refers to the process of hybridization produced by the fusion of gametes between individuals of different populations or genotypes. Depending on the different relationships between the parents, it includes close hybridization and distant hybridization.

[0062] "Mutation" as used herein refers to "loss-of-function mutation" or "loss-of-function mutation", which is a mutation in the coding sequence of a gene, which causes the function of the gene product (usually a protein) to be reduced or completely lost. Loss-of-function mutations can be caused, for example, by truncation of a gene product (due to frameshift or nonsense mutations), and the phenotype associated with an allele having a loss-of-function mutation can be recessive or dominant.

[0063] The term "RNA interference" (RNAi) is a gene blocking technology, which is a process in which a double-stranded RNA (dsRNA) molecule blocks the expression of a specific gene or silences it at the mRNA level, namely sequence-specific post-transcriptional gene silencing (PTGS). BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 yes ZmPHYB1 and ZmPHYB2 Schematic diagram of the mutants.

[0065] Figure 2 The wild type and Zmphyb1Zmphyb2 Photographs of grains of the double mutant material at different stages after pollination.

[0066] Figure 3 The wild type and Zmphyb1Zmphyb2 Changes in grain weight and grain filling rate of double mutant materials after pollination.

[0067] Figure 4 The wild type and Zmphyb1Zmphyb2 Changes in grain shape of double mutant materials after pollination.

[0068] Figure 5 The wild type and Zmphyb1Zmphyb2 Changes in grain moisture content of double mutant materials. DETAILED DESCRIPTION

[0069] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0070] The inbred lines and corn varieties used in the following examples can be obtained from the "China Crop Germplasm Information Network" by obtaining relevant information and applying for corresponding seeds.

[0071] Embodiment 1: ZmPHYB1 and ZmPHYB2 Regulating corn kernel size

[0072] For research ZmPHYBs ( ZmPHYB1 and ZmPHYB2 ) plays a role in the development of maize kernels. The inventors obtained the W22 inbred line from Shandong Agricultural University. Zmphyb1 Zmphyb2 Seeds of double mutant (Shi, Q., Xia, Y., Wang, Q., et al. (2024). Phytochrome B interacts with LIGULELESS1 to control plant architecture and density tolerance in maize. Molecular Plant 17: 1255-1271.) and its wild-type control W22.Zmphyb1 The mutation characteristics are ZmPHYB1 CDS( Figure 1 ; CDS is shown in SEQ ID NO: 2) a Mu transposon is inserted between bases 1034 and 1035, or ZmPHYB1 A Mu transposon was inserted between bases 1377 and 1378 of the genomic DNA (SEQ ID NO: 1), causing the premature termination of ZmPHYB1 protein translation; Zmphyb2 The mutation characteristics are ZmPHYB2 A nucleotide sequence near the gene start codon ATG is composed of 5'-GAGCCGACTGACGAGCACAAGACCGGCGGACGGGGCCGCCTAATCCAGTGAGAGCTCCCCCAAGCGCC ATG GCGTCGGACAGT-3' (the sequence is shown in SEQ ID NO: 7, wherein the underlined base represents the start codon ATG) is mutated to 5'-CTGACGACTGACGAGCTCCAGCTCCCCAGCGTCTGACAGT-3' (the sequence is shown in SEQ ID NO: 8), Right now ZmPHYB2 The sequence between bases 44 and 126 of the genomic DNA (SEQ ID NO: 4) mutated from SEQ ID NO: 7 to SEQ ID NO: 8, resulting in the loss of the start codon ATG, which in turn caused the inability to initiate translation of the ZmPHYB2 protein (see Figure 1 ). ZmPHYB1 The nucleotide sequence of the genomic DNA (gDNA) is shown in SEQ ID NO:1, the nucleotide sequence of the coding region (CDS) is shown in SEQ ID NO:2, and the encoded amino acid sequence is shown in SEQ ID NO:3. ZmPHYB2 The nucleotide sequence of the genomic DNA (gDNA) is shown in SEQ ID NO:4, the nucleotide sequence of the coding region (CDS) is shown in SEQ ID NO:5, and the encoded amino acid sequence is shown in SEQ ID NO:6.

[0073] In the winter of 2023, at the Ledong test station in Hainan, the W22 and Zmphyb1 Zmphyb2 The double mutant was planted and strictly self-pollinated. After harvesting, the collected seeds were observed and found that compared with W22 Zmphyb1 Zmphyb2 The seeds of the double mutant were significantly smaller.

[0074] Embodiment 2: ZmPHYB1 and ZmPHYB2 Regulating corn kernel filling

[0075] To parse ZmPHYBs (ZmPHYB1 and ZmPHYB2 ) regulates the size of corn kernels. In the summer of 2024, the W22 and Zmphyb1 Zmphyb2 The double mutants were planted again, strictly self-pollinated, and sampled five times at 15, 25, 35, 45, and 55 days after pollination. At least three ears of each material were sampled each time, and >50 kernels in the middle of the ear were peeled off to record the number and weigh the fresh weight. Then, they were fixed at 105℃ for 1 hour to remove enzyme activity and dried at 65℃ for more than 48 hours to constant weight. Subsequently, the dry weight, length, width, thickness and other traits of the sampled kernels were measured ( Figures 2 - 4 ). Data analysis found that 15 days after pollination, W22 and Zmphyb1 Zmphyb2 The double mutants showed significant differences in grain dry matter weight, but the difference was small ( Figure 2 and Figure 3 ); 25 days Zmphyb1 Zmphyb2 The grain dry weight of the double mutant was still significantly lower than that of the control W22, and the grain dry weight increase rate (i.e., filling rate) during the period of 15-25 days was significantly lower than that of the control W22; in addition, Zmphyb1 Zmphyb2 The dry weight of the double mutant grains basically stopped increasing after 25 days, while the control W22 did not reach its maximum until about 45 days after pollination ( Figure 2 and Figure 3 In addition, the length, width and thickness of corn kernels showed almost the same trend as that of kernel weight, that is, starting from 25 days after pollination, Zmphyb1 Zmphyb2 The double mutant basically stopped increasing, while the control W22 did not reach its maximum value until about 45 days after pollination ( Figure 2 and Figure 4 These results show that ZmPHYBs ( ZmPHYB1 and ZmPHYB2 ) regulates the filling rate of early corn kernels and the size of the "storage capacity" of corn kernels. Through the combined influence of these two aspects, it ultimately regulates the size and weight of corn kernels.

[0076] Embodiment 3: ZmPHYB1 and ZmPHYB2 Regulating corn kernel dehydration

[0077] In 2023 Langfang, W22 and Zmphyb1 Zmphyb2 When the double mutants were sampled on the 15th, 25th, 35th, 45th, and 55th days after pollination, in addition to the dry weight of the kernels, the fresh weight of the kernels just peeled off the ear was also recorded. Based on these two data, the moisture content of different materials at each period can be calculated. Data analysis found that at 15-25 days after pollination, W22 and Zmphyb1 Zmphyb2There was almost no difference in grain moisture content between the double mutants, but from 35 days after pollination to 55 days after pollination (when grains were harvested), Zmphyb1 Zmphyb2 The grain moisture content of the double mutant was significantly lower than that of the control W22 ( Figure 5 A, 5B, and its grain dehydration rate at 25-35 days was significantly higher than that of the control W22 ( Figure 5 C). According to the analysis results of the previous grain filling, 25 days after pollination Zmphyb1 Zmphyb2 The double mutant has completed grain filling, the grain dry matter has reached the maximum, and has entered the natural dehydration process; while the control W22 grains are still growing and have not completed grain filling, indicating that Zmphyb1 Zmphyb2 The double mutation can shorten the time it takes for corn kernels to complete filling, allowing the corn kernels to enter the natural dehydration process as early as possible, thereby accelerating the dehydration of the corn kernels, which is beneficial to reducing the moisture content of the corn kernels during harvest and facilitating mechanical harvesting of corn kernels.

Claims

1. A method for producing a corn plant having a phenotype of reduced kernel size, reduced kernel weight, shortened kernel filling time, reduced kernel moisture content, and / or increased dehydration rate, the method comprising the steps of: (a) producing one or more corn plants, wherein the endogenous ZmPHYB1 gene and ZmPHYB2 gene of the corn plant each contain at least one loss-of-function mutation, or the expression of the endogenous ZmPHYB1 gene and ZmPHYB2 gene is suppressed; (b) obtaining at least one seed of the corn plant produced in step (a).

2. The method according to claim 1, wherein the polynucleotide sequence of the ZmPHYB1 gene is selected from one of the following groups of sequences: (a) a polynucleotide sequence as shown in SEQ ID No: 1 or 2; or (b) The polynucleotide sequence encoding the amino acid sequence is shown in SEQ ID No:

3.

3. The method according to claim 1, wherein the polynucleotide sequence of the ZmPHYB2 gene is selected from one of the following groups of sequences: (a) a polynucleotide sequence as shown in SEQ ID No: 4 or 5; or (b) The polynucleotide sequence encoding the amino acid sequence is shown in SEQ ID No:

6.

4. The method according to any one of claims 1-3, wherein the loss-of-function mutation comprises substitution, deletion and / or addition of one or more nucleotides in the polynucleotide sequence of the gene; wherein the gene expression is inhibited in the form of RNA interference.

5. The method according to claim 4, wherein the loss-of-function mutation is obtained by physical mutagenesis, chemical mutagenesis, ZFN, TALEN and / or CRISPR / Cas gene editing technology, or by hybridization with corn plants having the loss-of-function mutation.

6. The method according to claim 5, wherein the CRISPR / Cas gene editing is CRISPR / Cas9 gene editing technology.

7. The method according to any one of claims 1 to 3, wherein the loss-of-function mutation is the insertion of a Mu transposon between bases 1377 and 1378 of SEQ ID NO:1, or the insertion of a Mu transposon between bases 1034 and 1035 of SEQ ID NO:2, or the sequence between bases 44 and 126 of SEQ ID NO:4 is mutated from SEQ ID NO:7 to SEQ ID NO:

8.

8. Use of the method according to any one of claims 1 to 7 in making corn plant kernels smaller, reducing kernel weight, shortening corn kernel filling time, reducing kernel moisture content and / or increasing dehydration rate.

Images