Screening method of CREBZF inhibitor and application of bromocriptine as CREBZF inhibitor in disease treatment

Abstract

The invention provides a screening method of a CREBZF inhibitor and application of bromocriptine as the CREBZF inhibitor in treating diseases. The bromocriptine is used for targeting CREBZF, or treating or preventing diseases related to macrophages. The invention also provides a method for screening the CREBZF agonist or inhibitor.

Description

Technical Field

[0001] The present invention belongs to the field of biology, and more specifically, relates to a method for screening a CREBZF inhibitor and application of bromocriptine as a CREBZF inhibitor in treating diseases. Background Art

[0002] CREBZF (also known as ZF, Zhangfei) belongs to the basic leucine transcription factor of the Activation Transcription Factor / cAMPResponse Element-Binding protein (ATF / CREB) family. ATF / CREB family members have transcriptional regulatory functions and respond to a variety of extracellular signals. They play a bridging role in mediating extracellular nutrient signals, growth factor sensing, intracellular glucose and lipid metabolism, and cell proliferation homeostasis. They are involved in liver glucose and lipid metabolism, cell growth, and tumors. Many studies have found that CREBZF has important regulatory functions in non-alcoholic fatty liver, non-alcoholic steatohepatitis (NASH) and liver regeneration. CREBZF promotes de novo lipid synthesis in hepatocytes, thereby promoting the progression of fatty liver. CREBZF is also significantly upregulated in the liver of patients with non-alcoholic fatty liver. CREBZF in hepatocytes can also activate hepatic stellate cells by increasing the expression and secretion of OPN protein in hepatocytes, excessively producing collagen, and exacerbating the occurrence and development of non-alcoholic steatohepatitis. In addition, CREBZF inhibited liver regeneration in both partial hepatectomy and carbon tetrachloride-induced liver injury mouse models, indicating that CREBZF plays a key role in the homeostasis of hepatocyte proliferation. However, the role of CREBZF in metabolic syndrome (MS) represented by obesity, fatty liver, and hyperlipidemia has not been studied in this field.

[0003] Therefore, there is a need in this field to study the relationship between CREBZF and metabolic syndrome, and to develop and find suitable drugs targeting CREBZF. This research will help delay, prevent or treat metabolic syndrome. Summary of the invention

[0004] The object of the present invention is to provide a method for screening a CREBZF inhibitor and the use of bromocriptine as a CREBZF inhibitor in treating diseases. The bromocriptine is used to target CREBZF, or to treat or prevent macrophage-related diseases. The present invention also provides a method for screening a CREBZF agonist or inhibitor.

[0005] In a first aspect of the present invention, a method for screening drugs (including potential drugs) for treating or preventing macrophage-related diseases is provided, comprising: (1) treating a system comprising macrophages expressing CREBZF with a candidate substance; and (2) detecting the expression or activity of macrophage CREBZF in the system; if the candidate substance statistically downregulates (significantly downregulates, such as downregulating by 10% or more, 20% or more, 50% or more, 80% or more, or causing it to be non-expressed or inactive) the expression or activity of macrophage CREBZF, then the candidate substance is a drug (including potential drug) for treating or preventing macrophage-related diseases.

[0006] In one or more preferred embodiments, step (1) comprises: in the test group, adding the candidate substance to the expression system.

[0007] In one or more preferred embodiments, step (2) comprises: detecting the expression or activity of macrophage CREBZF in the system, and comparing it with a control group, wherein the control group is an expression system to which the candidate substance is not added; if the candidate substance statistically down-regulates (significantly down-regulates, such as down-regulating by 10% or more, 20% or more, 50% or more, 80% or more, or making it non-expressed or inactive) the expression or activity of macrophage CREBZF, then the candidate substance is a drug for treating or preventing macrophage-related diseases.

[0008] In one or more preferred embodiments, the system comprising macrophages is selected from: an animal system, a cell system (such as macrophages or cell cultures expressing CREBZF), a subcellular (culture) system, a tissue system or an organ system.

[0009] In one or more preferred embodiments, the system comprising macrophages is an animal system (mammalian system), and the animals include (but are not limited to): rodents, non-human primates; preferably, a high-fat and high-sugar (HFHS) diet is used to induce macrophage-related diseases in the animal system; more preferably, while selecting a candidate substance that downregulates the expression or activity of macrophage CREBZF, the method of downregulation further includes observing an indicator selected from the following group:

[0010] (i) the total proportion of macrophages in adipose tissue (preferably based on the number of F4 / 80+CD11b+ cells); wherein, if the total proportion of macrophages is significantly downregulated (such as by more than 1%, more than 2%, more than 5%, more than 8%, more than 10%, more than 20%, more than 30%, more than 50%, etc.) (the test group vs. the control group is significantly reduced), then the candidate substance is a drug for treating or preventing macrophage-related diseases;

[0011] (ii) the number of pro-inflammatory macrophages CD206-CD11c+ in adipose tissue; wherein, if the number of pro-inflammatory macrophages CD206-CD11c+ is significantly downregulated (e.g., by more than 1%, more than 2%, more than 5%, more than 8%, more than 10%, more than 20%, more than 30%, more than 50%, etc.) (the test group vs. the control group is significantly reduced), then the candidate substance is a drug for treating or preventing macrophage-related diseases;

[0012] (iii) the number of anti-inflammatory macrophages CD206+CD11c- in adipose tissue; wherein, if the anti-inflammatory macrophages CD206+CD11c- are significantly upregulated (e.g., upregulated by more than 1%, more than 2%, more than 5%, more than 8%, more than 10%, more than 20% more than 30%, more than 50%, etc.) (the test group vs. the control group is significantly reduced), then the candidate substance is a drug for treating or preventing macrophage-related diseases.

[0013] In one or more preferred embodiments, the candidate substances include (but are not limited to): regulatory molecules or constructs designed for macrophage CREBZF, its fragments or variants, its encoding genes or its upstream and downstream molecules or signal pathways (such as shRNA, siRNA, gene editing methods, expression vectors, recombinant viruses or non-viral constructs, etc.), chemical small molecules (such as specific inhibitors or antagonists), interactive molecules, etc.

[0014] In one or more preferred embodiments, the method further comprises: performing further cell experiments and / or animal tests on the obtained potential substances to further select and determine substances useful for treating or preventing macrophage-related diseases from the candidate substances.

[0015] In one or more preferred embodiments, the macrophage-related diseases include:

[0016] Adipose tissue inflammation, adipose tissue macrophage infiltration diseases, obesity-related metabolic diseases;

[0017] Preferably, the adipose tissue inflammation includes: chronic inflammation of adipose tissue;

[0018] Preferably, the adipose tissue macrophage infiltration disease includes: adipose tissue macrophage increase disease, adipose tissue pro-inflammatory macrophage increase disease, adipose tissue anti-inflammatory macrophage deficiency disease;

[0019] Preferably, the obesity-related metabolic diseases include: metabolic diseases caused by excessive diet (such as high-fat diet); preferably, the obesity-related metabolic diseases include: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, fatty liver, obesity.

[0020] In one or more preferred embodiments, the "macrophage hyperplasia disease" refers to a state in which there are too many macrophages in tissues (with a statistically significant increase) until a disease (inflammatory response) is formed.

[0021] In one or more embodiments, the "pro-inflammatory macrophage hyperplasia disease" refers to a state in which there are too many pro-inflammatory macrophages in tissues until a disease (inflammatory response) is formed.

[0022] In one or more embodiments, the "anti-inflammatory macrophage deficiency disease" refers to a state in which there are too few (statistically significant decrease) anti-inflammatory macrophages in tissues until a disease (inflammatory response) state is formed.

[0023] In another aspect of the present invention, there is provided a use of bromocriptine or a pharmaceutically acceptable salt thereof in the preparation of a medicament for: (1) targeting CREBZF; preferably, the CREBZF is macrophage CREBZF; or (2) treating or preventing macrophage-related diseases.

[0024] In one or more embodiments, the CREBZF comprises a CREBZF gene and / or protein.

[0025] In one or more preferred embodiments, the drug further contains a pharmaceutically acceptable carrier or excipient.

[0026] In one or more preferred embodiments, the pharmaceutically acceptable salts include acid salts and basic salts.

[0027] In one or more preferred embodiments, the acid salts include: hydrochlorides, hydrobromides, sulfates, nitrates, phosphates, and methanesulfonates; the basic salts include: sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, and aluminum salts.

[0028] In one or more preferred embodiments, the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and obesity-related metabolic diseases.

[0029] In one or more preferred embodiments, the adipose tissue inflammation includes: chronic adipose tissue inflammation.

[0030] In one or more preferred embodiments, the adipose tissue macrophage infiltration disease includes: adipose tissue macrophage increase disease, adipose tissue pro-inflammatory macrophage increase disease, adipose tissue anti-inflammatory macrophage deficiency disease.

[0031] In one or more preferred embodiments, the obesity-related metabolic diseases include: metabolic diseases caused by excessive diet (such as high-fat, high-sugar diet); preferably, the obesity-related metabolic diseases include: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, fatty liver, and obesity.

[0032] In another aspect of the present invention, a drug box or a test kit targeting CREBZF is provided, wherein the drug box or the test kit contains: (1) bromocriptine or a pharmaceutically acceptable salt thereof; or, (2) a pharmaceutical composition, wherein the pharmaceutical composition contains bromocriptine or a pharmaceutically acceptable salt thereof; preferably, the pharmaceutical composition further contains a pharmaceutically acceptable carrier or excipient; more preferably, the drug box or the test kit further contains: a container, and (1) or (2) placed in the container.

[0033] In another aspect of the present invention, a CREBZF promoter-mediated reporter gene system is provided, the system comprising a nucleic acid construct or an expression vector comprising the nucleic acid construct, wherein the nucleic acid construct comprises: a CREBZF promoter and a reporter gene expression cassette.

[0034] In another aspect of the present invention, the CREBZF promoter-mediated reporter gene system is used for screening agents (such as inhibitors or agonists) that target and regulate CREBZF; preferably, the agent is an inhibitor; preferably, the inhibitor is an agent for treating or preventing macrophage-related diseases.

[0035] In another aspect of the present invention, a method for screening an agent that targets and regulates CREBZF is provided, the method comprising:

[0036] (a) providing a CREBZF promoter-mediated reporter gene system;

[0037] (b) adding the candidate substance to the system of (1) and observing its effect on the system;

[0038] If it can specifically inhibit the expression of the reporter gene, the candidate substance is a CREBZF inhibitor; if it can specifically promote the expression of the reporter gene, the candidate substance is a CREBZF agonist;

[0039] Preferably, the inhibitor is an agent for treating or preventing macrophage-related diseases.

[0040] In one or more embodiments, in (a), the system further comprises a control group for comparison with the candidate substance group.

[0041] In one or more embodiments, the reporter gene includes: a fluorescent protein gene, a luciferase reporter gene.

[0042] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 , Schematic diagram of the construction of CREBZF small molecule inhibitor screening vector.

[0044] (AB) Artificially synthesized promoter fragments of CREBZF from ∼2000 bp to ∼733 bp (A) and ∼733 bp to +106 bp (B);

[0045] (C) Results of restriction enzyme digestion test of two artificially synthesized promoter fragments (~2000 bp to ~733 bp, ~733 bp to +106 bp) (left), and a schematic diagram of constructing two artificially synthesized promoter fragments of CREBZF into the pGL3-Luc vector (right);

[0046] (D) The sequence and schematic diagram of the artificially synthesized CREBZF promoter.

[0047] Figure 2 , screening results of CREBZF small molecule inhibitors.

[0048] (A) Composition of FDA-approved small molecule compound library;

[0049] (B) The results of the initial screening of 640 compounds by detecting the fluorescence value of the fluorescein substrate and the cell activity. Plates A-1, A-2, B-1, B2-, C-1, C-2, D-1, and D-2 in the figure are the numbers of the cell culture well plates used for screening;

[0050] (C) The results of 70 compounds were screened by detecting the fluorescence value of the fluorescein substrate and cell activity;

[0051] (D) Venn diagram of 70 compound screening.

[0052] Figure 3 , bromocriptine inhibits CREBZF at the cellular and animal levels.

[0053] (A) Fluorescence values ​​under treatment with different concentrations (2.5 μM, 5 μM, 10 μM, 15 μM, 20 μM, 45 μM) of bromocriptine were detected using PE and Promega fluorescent substrates, with DMSO as the control. Hu7-1, Hu7-2, and Huh7 are all Huh7 stable cell lines, and 293T is a 293T cell line;

[0054] (B) Under normal diet (Chow) conditions, adipose tissue vascular stromal cells were extracted and the mRNA expression levels of CREBZF were detected under different concentrations (0 mg / kg, 5 mg / kg, 10 mg / kg, 20 mg / kg) of bromocriptine (P < 0.05), and the adjuvant group (Vehicle) was used as the control;

[0055] (C) Under normal diet (Chow) conditions, adipose tissue vascular stromal cells were extracted to detect the inhibitory effect of bromocriptine (10 mg / kg) on ​​CREBZF protein. β-actin is used as an internal reference.

[0056] * indicates significant difference compared with the adjuvant group (Vehicle) (P<0.05).

[0057] Figure 4 , CREBZF deficiency blocked the improvement effect of bromocriptine on chronic inflammation in mice fed a HFHS diet.

[0058] (A) Flow cytometry analysis of the proportion and typing of F4 / 80+CD11b+ total macrophages in epididymal adipose tissue (eWAT) (P<0.05);

[0059] (B) qPCR was used to detect the mRNA expression levels of pro-inflammatory factors (IL-1β, IL-6, TNFα, INOS) in adipose tissue.

[0060] * indicates a significant difference (P<0.05) compared with the wild-type (WT) adjuvant group (without bromocriptine), and MKO indicates macrophage-specific knockout of CREBZF.

[0061] Figure 5 , CREBZF deficiency blocked the improvement of hyperlipidemia and fatty liver by bromocriptine in mice fed HFHS diet

[0062] (A) Plasma triglyceride levels in mice;

[0063] (B) Plasma total cholesterol levels in mice;

[0064] (C) Expression levels of genes related to the fatty acid synthesis pathway (FAS, ACC, SCD1) in mouse liver tissue (the horizontal axis is the same as 6AB);

[0065] (D) HE staining results of mouse liver.

[0066] * indicates a significant difference (P<0.05) compared with the wild-type (WT) adjuvant group (without bromocriptine), and MKO indicates macrophage-specific knockout of CREBZF. DETAILED DESCRIPTION

[0067] After in-depth research, the inventors used the CREBZF promoter-mediated luciferase reporter gene system to screen CREBZF inhibitors or agonists, and successfully screened the CREBZF inhibitor bromocriptine. It has been verified that bromocriptine can achieve pharmacological regulation of CREBZF in vivo and in vitro, and improve macrophage-related diseases. Therefore, the present invention finds a screening method for CREBZF inhibitors and the use of bromocriptine as a CREBZF inhibitor in treating diseases. The bromocriptine is used to target CREBZF, or treat or prevent macrophage-related diseases. The present invention also provides a method for screening CREBZF agonists or inhibitors.

[0068] CREZ

[0069] In this article, "CREBZF", also known as "Zhangfei", ZF or "HCF-binding transcriptionfactor Zhangfei", belongs to the basic leucine zipper (bZIP) transcription factor of the Activation Transcription Factor / cAMP Response Element-Binding protein (ATF / CREB) family. ATF / CREB family members have transcriptional regulatory functions and respond to a variety of extracellular signals. They play a bridging role in mediating extracellular nutrient signals, growth factor sensing, intracellular glucose and lipid metabolism, and cell proliferation homeostasis, and are involved in liver glucose and lipid metabolism, cell growth, and tumor diseases.

[0070] The CREBZF gene or the CREBZF protein encoded by the present invention includes CREBZF genes and CREBZF proteins from different species, especially CREBZF genes and CREBZF proteins from mammals (such as humans and mice, etc.). The human CREBZF gene can refer to Gene ID: 58487, and the human CREBZF protein can refer to NCBI accession number: NM_001039618. The mouse CREBZF gene can refer to Gene ID: 233490, and the mouse CREBZF protein can refer to NCBI accession number: NM_145151. It should be understood that the CREBZF gene and CREBZF protein described in the present invention include mutants known in the art. These mutants are usually naturally produced and carried by the animal body itself. That is, such genes or proteins that can be referred to as "CREBZF" and "CREBZF" in the art are included in the scope of the present invention. CREBZF is widely expressed in a variety of tissues, including adipose tissue, liver, immune system, muscle, brain, etc.

[0071] Screening of CREBZF agonists or inhibitors

[0072] The present invention provides a CREBZF promoter-mediated reporter gene system, which comprises a nucleic acid construct or an expression vector comprising the nucleic acid construct, wherein the nucleic acid construct comprises: a CREBZF promoter and a reporter gene expression box.

[0073] In the present invention, the CREBZF promoter may be any nucleic acid sequence having the activity of promoting CREBZF transcription in the host cell, including mutant, truncated and hybrid CREBZF promoters.

[0074] The "reporter gene" of the present invention is a gene that is expressed in cells, tissues / organs or individuals under specific conditions and produces a trait that is easy to detect and that the experimental material would not otherwise produce. As used in the present invention, the reporter gene is for example, but not limited to: fluorescent protein gene, luciferase reporter gene.

[0075] In the present invention, the expression vector comprises the nucleic acid construct, therefore, the expression vector comprising the nucleic acid construct and the host cell produced by genetic engineering using the expression vector or nucleic acid construct are also included in the present invention.

[0076] The CREBZF promoter-mediated reporter gene system was operated as follows:

[0077] The CREBZF promoter can start the expression of the reporter gene, and the expression of the reporter gene can reflect the change of the promoter transcriptional activity. For example, when the reporter gene is a luciferase reporter gene, by detecting fluorescence, the level of the promoter transcriptional activity can be known. As used in the present invention, the expression of the reporter gene should be understood to include but not limited to transcription, post-transcriptional modification, translation, and post-translational modification.

[0078] The method of "detecting fluorescence" described in the present invention includes but is not limited to: directly observing fluorescence and detecting fluorescence intensity. In some specific embodiments of the present invention, the detection is by adding a luciferase substrate to detect the fluorescent signal. More specifically, the strength of the fluorescent signal is represented by the intensity value of the fluorescent signal, for example, the average intensity value of the fluorescent signal. Therefore, the intensity value of the fluorescent signal (such as the average intensity value) can quantitatively reflect the transcriptional activity of the CREBZF promoter.

[0079] Based on the relationship between the promoter and the expression of the reporter gene, the present invention provides a method for screening a CREBZF agonist or inhibitor, the method comprising:

[0080] (a) providing a CREBZF promoter-mediated reporter gene system;

[0081] (b) adding the candidate substance to the system of (1) and observing its effect on the system;

[0082] If it can specifically promote the expression of the reporter gene, the candidate substance is a CREBZF agonist; if it can specifically inhibit the expression of the reporter gene, the candidate substance is a CREBZF inhibitor; preferably, the inhibitor is an agent for treating or preventing macrophage-related diseases.

[0083] In one or more embodiments, in (a), the system further comprises a control group for comparison with the candidate substance group.

[0084] In one or more embodiments, the reporter gene includes, but is not limited to, fluorescent protein gene, luciferase reporter gene, etc.

[0085] It can also be said that the present invention provides a use of a CREBZF promoter-mediated reporter gene system for screening agents (such as inhibitors or agonists) that target and regulate CREBZF.

[0086] In one or more embodiments, the agent is an inhibitor. In one or more embodiments, the inhibitor is an agent for treating or preventing a macrophage-related disease.

[0087] As used in the present invention, the "agonist" refers to an agent that targets CREBZF and promotes the expression or activity of CREBZF; the "inhibitor" refers to an agent that targets CREBZF and inhibits the expression or activity of CREBZF. The "expression or activity" includes expression or activity at the gene level and also includes expression or activity at the protein level.

[0088] In the present invention, the "promotion" or "inhibition" is relative. For example, a control group without adding the candidate substance can be set up. If the expression of the reporter gene in the group with the added candidate substance is upregulated compared with the control group, it is "promotion"; otherwise, it is "inhibition".

[0089] The “promotion” or “inhibition” mentioned in the present invention includes “promotion” or “inhibition” by 5%, 10%, 15%, 20%, 30% or higher or lower.

[0090] Drug screening for the treatment / prevention of macrophage-related diseases

[0091] The present invention also provides a method for screening drugs (including potential drugs) for treating or preventing macrophage-related diseases, comprising:

[0092] (1) treating a system comprising macrophages expressing CREBZF with a candidate substance; and,

[0093] (2) detecting the expression or activity of CREBZF in macrophages in the system;

[0094] If the candidate substance statistically downregulates (significantly downregulates, such as downregulating by more than 10%, more than 20%, more than 50%, more than 80%, etc., or making it non-expressed or inactive) the expression or activity of macrophage CREBZF, then the candidate substance is a drug (including potential drug) for treating or preventing macrophage-related diseases.

[0095] In one or more embodiments, step (1) comprises: in a test group, adding a candidate substance to the expression system; and / or, step (2) comprises: detecting the expression or activity of macrophage CREBZF in the system, and comparing it with a control group, wherein the control group is an expression system to which the candidate substance is not added; if the candidate substance statistically down-regulates (significantly down-regulates, such as down-regulating by more than 10%, more than 20%, more than 50%, more than 80%, etc., or making it non-expressed or inactive) the expression or activity of macrophage CREBZF, then the candidate substance is a drug for treating or preventing macrophage-related diseases.

[0096] In one or more embodiments, the system comprising macrophages is selected from: an animal system, a cell system (such as a macrophage or cell culture expressing CREBZF), a subcellular (culture) system, a tissue system or an organ system.

[0097] In one or more embodiments, the system comprising macrophages is an animal system (mammalian system), and the animals include (but are not limited to): rodents, non-human primates; preferably, a high-fat and high-sugar (HFHS) diet is used to induce macrophage-related diseases in the animal system; more preferably, while selecting a candidate substance that downregulates the expression or activity of macrophage CREBZF, the method of downregulation further includes observing an indicator selected from the following group:

[0098] (i) the total proportion of macrophages in adipose tissue (preferably based on the number of F4 / 80+CD11b+ cells); wherein, if the total proportion of macrophages is significantly downregulated (such as by more than 1%, more than 2%, more than 5%, more than 8%, more than 10%, more than 20%, more than 30%, more than 50%, etc.) (the test group vs. the control group is significantly reduced), then the candidate substance is a drug for treating or preventing macrophage-related diseases;

[0099] (ii) the number of pro-inflammatory macrophages CD206-CD11c+ in adipose tissue; wherein, if the number of pro-inflammatory macrophages CD206-CD11c+ is significantly downregulated (e.g., by more than 1%, more than 2%, more than 5%, more than 8%, more than 10%, more than 20%, more than 30%, more than 50%, etc.) (the test group vs. the control group is significantly reduced), then the candidate substance is a drug for treating or preventing macrophage-related diseases;

[0100] (iii) the number of anti-inflammatory macrophages CD206+CD11c- in adipose tissue; wherein, if the anti-inflammatory macrophages CD206+CD11c- are significantly upregulated (e.g., upregulated by more than 1%, more than 2%, more than 5%, more than 8%, more than 10%, more than 20% more than 30%, more than 50%, etc.) (the test group vs. the control group is significantly reduced), then the candidate substance is a drug for treating or preventing macrophage-related diseases.

[0101] In one or more embodiments, the candidate substances include (but are not limited to): regulatory molecules or constructs designed for macrophage CREBZF, its fragments or variants, its encoding genes or its upstream and downstream molecules or signal pathways (such as shRNA, siRNA, gene editing methods, expression vectors, recombinant viruses or non-viral constructs, etc.), chemical small molecules (such as specific inhibitors or antagonists), interactive molecules, etc.

[0102] In another preferred embodiment, the method further comprises: performing further cell experiments and / or animal experiments on the obtained potential substances to further select and determine substances useful for treating or preventing macrophage-related diseases from the candidate substances.

[0103] In one or more embodiments, the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and obesity-related metabolic diseases.

[0104] In one or more embodiments, the adipose tissue inflammation comprises: chronic inflammation of adipose tissue;

[0105] In one or more embodiments, the adipose tissue macrophage infiltration disease includes: adipose tissue macrophage increase disease, adipose tissue pro-inflammatory macrophage increase disease, adipose tissue anti-inflammatory macrophage deficiency disease.

[0106] In one or more embodiments, the obesity-related metabolic diseases include: metabolic diseases caused by excessive diet (such as high-fat diet); preferably, the obesity-related metabolic diseases include: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, fatty liver, and obesity.

[0107] In one or more embodiments, the "macrophage hyperplasia disease" refers to an excessive number of macrophages in tissues until a disease (inflammatory response) state is formed. Personnel with certain skills in the field (such as physicians) can determine such disease states.

[0108] In one or more embodiments, the "pro-inflammatory macrophage hyperplasia disease" refers to an excessive number of pro-inflammatory macrophages in tissues until a disease (inflammatory response) state is formed. Personnel with certain skills in this field (such as physicians) can determine such disease states.

[0109] In one or more embodiments, the "anti-inflammatory macrophage deficiency disease" refers to a state in which there are too few anti-inflammatory macrophages in a tissue until a disease (inflammatory response) is formed. Personnel with certain skills in this field (such as physicians) can determine such disease states.

[0110] Bromocriptine and its application

[0111] After large-scale screening, the inventors obtained inhibitors that specifically act on CREBZF. After further screening of cell activity, the inventors found that bromocriptine has the best inhibitory effect on CREBZF.

[0112] Bromocriptine, molecular formula C 32 H 40 BrN5O5, CAS No. 25614-03-3, is a dopamine receptor agonist used to treat hyperprolactinemia, Parkinson's disease and acromegaly.

[0113] In the present invention, the "bromocriptine" also includes pharmaceutically acceptable salts, esters, isomers, solvates or prodrugs of bromocriptine, as long as they also have the same or substantially the same function as bromocriptine. In the present invention, "pharmaceutically acceptable" ingredients are substances that are suitable for humans and / or animals without excessive adverse side effects (such as toxicity, irritation and allergic reactions), that is, substances with a reasonable benefit / risk ratio. The "pharmaceutically acceptable salt" can be an acid salt and a basic salt of bromocriptine.

[0114] "Pharmaceutically acceptable acid salts" refer to salts that retain the biological activity and properties of the free base without undesirable changes in biological activity or other aspects. Such salts can be formed from inorganic acids such as, but not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid and similar acids.

[0115] "Pharmaceutically acceptable basic salts" refer to salts that retain the biological activity and properties of the free acid without undesirable changes in biological activity or other aspects. These salts are made by adding an inorganic base or an organic base to the free acid. Salts obtained with inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, and the like.

[0116] Those skilled in the art should understand that, after knowing the structure of bromocriptine of the present invention, bromocriptine of the present invention can be obtained by various methods well known in the art, using known raw materials, such as chemical synthesis or extraction from organisms (such as microorganisms), and these methods are all included in the present invention. In addition, bromocriptine is also a commercial drug, so its finished product is easily available to those skilled in the art.

[0117] As confirmed by the embodiments of the present invention, in the obesity model induced by high-fat and high-sugar (HFHS) diet, bromocriptine is given or CREBZF is specifically knocked out in macrophages, which can significantly reduce blood lipids and relieve inflammation (e.g., inhibiting the upregulation of proinflammatory factors). However, this effect no longer exists when bromocriptine is given in mice lacking CREBZF, indicating that bromocriptine inhibits CREBZF, thereby exerting a metabolic improvement function and treating macrophage-related diseases. The method for treating macrophage-related diseases, for example, can utilize CAR-modified macrophages (CAR-Macrophage, i.e., CAR-M) technology, and macrophages are edited in vitro and then re-infused to achieve treatment. CAR-M is centered on macrophages, extracts macrophages from the patient himself, introduces CAR into macrophages by genetic engineering methods, and finally achieves targeted therapy of diseases.

[0118] The macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and obesity-related metabolic diseases.

[0119] In one or more embodiments, the adipose tissue inflammation comprises: chronic inflammation of adipose tissue.

[0120] In one or more embodiments, the adipose tissue macrophage infiltration disease includes: adipose tissue macrophage increase disease, adipose tissue pro-inflammatory macrophage increase disease, adipose tissue anti-inflammatory macrophage deficiency disease.

[0121] In one or more embodiments, the obesity-related metabolic diseases include: excessive diet (e.g., high-fat diet), hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, fatty liver, obesity.

[0122] In the present invention, the "up-regulation" or "down-regulation" includes the "up-regulation" or "down-regulation" of gene or protein activity, as well as the "increase" or "decrease" of gene or protein expression. The pro-inflammatory factors include but are not limited to: IL6, IL-1β, TNFα, INOS.

[0123] Therefore, the present invention includes the use of bromocriptine or a pharmaceutically acceptable salt thereof in the preparation of a drug targeting CREBZF. As used herein, the term "targeting CREBZF" generally refers to specifically or selectively acting on CREBZF, including, for example, targeting CREBZF in macrophages.

[0124] Herein, a "pharmaceutical composition" is a composition containing bromocriptine or a pharmaceutically acceptable salt thereof as described herein and a physiologically / pharmaceutically acceptable carrier and excipient. "Physiologically / pharmaceutically acceptable carrier" refers to those carriers and diluents that have no significant irritation to the organism and do not impair the biological activity and performance of the indolinone derivative or its pharmaceutically acceptable salt taken. "Physiologically / pharmaceutically acceptable excipient" refers to an inert substance added to the pharmaceutical composition that further facilitates the administration of the indolinone derivative or its pharmaceutically acceptable salt. Non-limiting examples of excipients include calcium carbonate, calcium phosphate, various sugars and various types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycol.

[0125] The bromocriptine described in the pharmaceutical composition is present in a therapeutically effective amount or a prophylactically effective amount. An effective amount is an amount sufficient to improve or alleviate in some way the symptoms associated with the disease. The dosage is an amount that effectively improves or eliminates one or more symptoms, and can be determined by a person of ordinary skill in the art based on the age, sex, physical condition, etc. of the subject. The dosage may cure the disease, but the administration is usually to improve the symptoms of the disease. Repeated administration is generally required to achieve the desired symptom improvement. Herein, the subject is a mammal, particularly a human.

[0126] The pharmaceutical composition of the present invention can be made into any conventional formulation form by conventional methods. The dosage form can be various, as long as it is a dosage form that can effectively allow the active ingredient to reach the mammalian body. For example, it can be selected from: injection, infusion, tablet, capsule, pill. The active ingredient (bromocriptine) can be present in a suitable solid or liquid carrier or diluent. The pharmaceutical composition of the active ingredient of the present invention can also be stored in a sterilizing apparatus suitable for injection or instillation. The effective dose of the active ingredient (e.g. bromocriptine) in the pharmaceutical composition can vary with the mode of administration and the severity of the disease to be treated, which can be based on the experience and advice of the clinician.

[0127] In a specific embodiment of the present invention, a series of dosing regimens of bromocriptine according to different molar ratios or mass ratios are proposed. For example, when mice are used as experimental animals, the dosage of bromocriptine can be 0.1 to 50 mg / ml. It is known to those skilled in the art that the dosage of mice can be converted into a dosage suitable for humans, for example, it can be calculated according to the Meeh-Rubner formula:

[0128] A=k×(W2 / 3) / 10000.

[0129] Where A is the body surface area, calculated in m2; W is the body weight, calculated in g; k is a constant, which varies with the animal species, 9.1 for mice and rats, 9.8 for guinea pigs, 10.1 for rabbits, 9.9 for cats, 11.2 for dogs, 11.8 for monkeys, and 10.6 for humans. It should be understood that the dosage conversion can vary depending on the drug and clinical situation, based on the evaluation of an experienced pharmacist.

[0130] Bromocriptine or pharmaceutical composition can be administered orally as well as intravenously, intramuscularly or subcutaneously. Preferably, it can be administered orally. The drug forms adapted for oral administration include, but are not limited to, tablets, powders, capsules, sustained-release agents, etc. The drug forms adapted for injection include: sterile aqueous solutions or dispersions and sterile powders. In all cases, these forms must be sterile and must be fluids to facilitate the discharge of fluids from syringes. When necessary, bromocriptine can also be administered in combination with other active ingredients or drugs.

[0131] The present invention also provides a CREBZF-targeting drug box or test kit, wherein the drug box or test kit contains the bromocriptine of the present invention. Alternatively, the drug box or test kit contains the pharmaceutical composition or mixture of bromocriptine of the present invention. Alternatively, the drug box or test kit contains: a container, and the bromocriptine of the present invention placed in the container.

[0132] The medicine box or test kit may also contain some auxiliary medication materials, such as measuring tools and containers such as syringes required for using or applying the composition in various dosage forms. The medicine box or test kit may also contain instructions for use.

[0133] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd Edition, Science Press, or according to the conditions recommended by the manufacturer.

[0134] Materials and methods

[0135] 1. Experimental Animals

[0136] (1) Generation of mice carrying the CREBZF allele at the Flox locus

[0137] The CREBZF allele mouse with Flox site was provided by Cyagen, China. That is, an open reading frame (ORF) containing CREBZF exon, a LoxP site and a LoxP-Neo site with a total length of 1062 bp was constructed in vitro, and then constructed into the target plasmid. The plasmid was linearized by restriction endonuclease Swal, and then the sequence containing the target gene fragment constructed in vitro was introduced into mouse embryonic stem cells (ES cells) (AB1, 129 / SvEv) by electroporation. ES cell clones were screened by drug resistance, and Neo probe (as shown in SEQ ID NO: 1-2) was used to perform Southern PCR. The blot technology was used to detect the genome of the cells, and ES cell clones with homologous recombination were screened out. The ES cell clones with homologous recombination were injected into C57BL / 6 (B6) blastocysts, and the injected blastocysts were transferred to the oviducts of pseudo-pregnant female mice (C57BL / 6J) according to standard procedures. After the chimeric mice were born, the chimeras were judged based on the fur color and the degree of chimerism, and the male chimeric mice were mated with wild-type female mice C57BL / 6J. Mice containing Flox sites at both ends of CREBZF CKO (conditional knockout) were obtained through Flp-mediated homologous recombination.

[0138] Neo probe-F:TCATCTCACCTTGCTCCTGC(SEQ ID NO:1)

[0139] Neo probe-R:AAGGCGATAGAAGGCGATGC(SEQ ID NO:2)

[0140] There are two pairs of primers for genotyping CREBZF Flox, which are shown in SEQ ID NOs: 3-4 and SEQ ID NOs: 5-6 respectively.

[0141] F1:GCTTGCAGTTTAGAGAGAAACAGC(SEQ ID NO:3)

[0142] R1:CAGCCAGAGTATCGCGAGATTC(SEQ ID NO:4)

[0143] F2:TTGACAATAAGTATTGAGGCATGCG(SEQ ID NO:5)

[0144] R2:TTTCCAACTTCTCAAGTGGTGAAC(SEQ ID NO:6)

[0145] The target fragments generated by F1 and R1 PCR were 248 bp (wild type) and 318 bp (CREBZF genotype mice containing Flox sites), respectively, and the target fragments generated by F2 and R2 PCR were 157 bp (wild type) and 285 bp (CREBZF genotype mice containing Flox sites), respectively.

[0146] (2) Generation of macrophage-specific CREBZF knockout mice (CREBZF MKO)

[0147] The LysM-Cre transgenic mice (LysM-Cre TG) used in the present invention were purchased from Shanghai Model Organisms and are tool mice used together with transgenic mice carrying Flox to specifically knock out genes in macrophages.

[0148] Macrophage-specific CREBZF knockout mice (CREBZF MKO) were obtained by crossing CREBZF mice with Flox and LysM-Cre transgenic mice (LysM-Cre TG) to obtain first-generation heterozygous mice, and then the heterozygous mice were self-crossed in the second generation to obtain a small number of homozygous knockout mice CREBZF MKO (CREBZF Flox+ / +Cre+ / -) and homozygous control mice CREBZF WT (CREBZF Flox+ / +Cre- / -). Then, the knockout mice obtained were mated with the control mice to expand the population and obtain a sufficient number of mice for experiments.

[0149] Wild-type and CREBZF MKO mice were randomly divided into four groups, two of which were induced with a normal (Chow) diet, and the other two groups were fed with a high-fat and high-sugar (HFHS) diet. The high-fat and high-sugar diet (HFHS) consumed by mice was purchased from Research Diet, USA.

[0150] The primers used to detect LysM-Cre are shown in SEQ ID NOs: 7 to 9. The target fragment size in wild-type mice is 350 bp, and the target fragment size in mice with Cre fragment inserted is 700 bp.

[0151] Forward1:CCC AGA AAT GCC AGA TTA CG(SEQ ID NO:7)

[0152] Forward2:TTA CAG TCG GCC AGG CTG AC(SEQ ID NO:8)

[0153] Reverse:CTT GGG CTG CCA GAA TTT CTC(SEQ ID NO:9)

[0154] A similar approach was used, except that the target of CREBZF knockout was replaced by hepatocytes instead of macrophages, to obtain liver-specific knockout mice (CREBZF LKO).

[0155] 2. Main reagents, instruments and equipment

[0156] (1) Main reagents:

[0157] The triglyceride detection kit (Infinity Triglycerides Reagent, TG) and cholesterol detection kit (Infinity Cholesterol Reagent, TC) were purchased from Thermo Scientific.

[0158] Ultrasensitive Mouse Insulin ELISA kit (Mercodia);

[0159] Antibodies for flow cytometry were purchased from Thermo Scientific;

[0160] Luciferase substrate was purchased from PE (PerkinElmer) and Promega;

[0161] Bromocriptine mesylate was purchased from MCE Company;

[0162] PrestoBlue cell viability assay reagent (Thermo Scientific);

[0163] Blade azure.

[0164] (2) Instruments and equipment:

[0165] Nuclear magnetic resonance (NMR) body composition analysis (Bruker magnetic resonance fat content measurement instrument Mq7.5);

[0166] Microplate reader (Tecan-200 - Microplate reader Infinite 200PRO);

[0167] Micropipettes were purchased from Rainin or Eppendorf;

[0168] The vertical electrophoresis tank, wet transfer membrane instrument, and supporting power supply were purchased from Bio-Rad;

[0169] The refrigerated centrifuge was purchased from Eppendorf;

[0170] The PCR instrument was purchased from Bio-Rad;

[0171] The real-time fluorescence quantitative PCR system ABI 7500 Fast Real-Time PCR System was purchased from Applied Biosystems;

[0172] The flow cytometer CytoFLEX S was purchased from Beckman Coulter.

[0173] 3. Animal grouping

[0174] Eight-week-old CREBZF MKO male mice and matched CREBZF WT male mice were randomly divided into groups as shown in Table 1.

[0175] Table 1: Grouping and treatment of mice

[0176]

[0177] Eight-week-old CREBZF MKO male mice and matched CREBZF WT male mice were fed a high-fat and high-sugar diet for 16 weeks, and were intraperitoneally injected with adjuvant (vehicle) or 10 mg / ml Bromocriptine mesylate for the last four weeks.

[0178] 4. Construction of experimental mouse model

[0179] The mice were kept in an SPF animal room. After weaning on day 22, they were separated into cages according to gender. The mice were allowed to eat and drink freely (standard food provided by Shanghai Experimental Animal Center). The animal room was maintained at a temperature of 22±3°C, a humidity of 35±5%, and a 12-hour day and night cycle. All experiments were conducted on 8-week-old male mice.

[0180] 5. Mouse index determination and mouse tissue collection

[0181] (1) Weekly measurement of mouse indicators: The body weight and food intake of mice were measured every week and the data were recorded.

[0182] (2) Mice sacrifice: Four months after the experiment, the mice were sacrificed and their tissues were collected.

[0183] Sacrifice method: Use isoflurane anesthesia to induce deep coma in mice, then open the chest cavity and use a 1ml syringe to collect blood from the apex of the heart. The blood is placed in a blood collection tube containing anticoagulant, centrifuged at 4℃3000rpm for 15min, and the supernatant is collected. After blood collection, take a picture of the ventral side of the mouse. Quickly remove epididymal fat, weigh it after taking a picture, fix it with formaldehyde and embed it in frozen (OCT) to observe the pathological changes of adipose tissue in experimental mice, and the remaining tissue is used for Western Blot experiment and RT-PCR experiment.

[0184] 6. Cell activity detection

[0185] The PrestoBlue kit was used to detect cell activity. After entering living cells, resazurin was reduced to resorufin, which can produce strong fluorescence. Therefore, its fluorescence intensity can reflect cell activity.

[0186] Example 1: Construction of CREBZF promoter-mediated luciferase reporter system

[0187] The 2006 bases (bp) before the start codon of CREBZF, i.e., its promoter region, were cloned into the luciferase gene. Because one region (~754bp to ~707bp) was rich in GC and could not be obtained by conventional amplification, the promoter was synthesized in two segments (~2000bp to ~733bp promoter fragment and ~732bp to +106bp promoter fragment) and the two promoter fragments were connected to the pGL3-Luc vector through the NheI / BbsI site and the BbsI / HindIII site. The construction process is as follows Figure 1 As shown in AC.

[0188] The CREBZF promoter region sequence is as follows Figure 1 D. The luciferase expression level can reflect the transcriptional activity of the CREBZF promoter. After adding the luciferase substrate, the higher the fluorescence value, the higher the CREBZF transcriptional activity.

[0189] Example 2: Screening of small molecule inhibitors of CREBZF

[0190] The successfully constructed plasmid was transfected into Huh7 cells and screened using the FDA-approved small molecule compound library.

[0191] The candidate compounds were dissolved in DMSO at a concentration of 10 μM. Taking the DMSO group as a reference, the cell activity in this group was 100% and the inhibitory effect on CREBZF was zero. After the cells were treated with small molecule compounds for 48 hours, the cell activity and fluorescence value were detected. Compared with the DMSO group, the lower the fluorescence value dropped, the stronger the inhibitory effect of the candidate compound (the higher the inhibition rate). Cell activity was also considered, and candidate compounds that could better maintain cell viability were selected.

[0192] Inhibition rate calculation formula:

[0193] Inhibition rate = 1-(fluorescein fluorescence value of drug-treated group / fluorescein fluorescence value of control group).

[0194] Corrected inhibition rate = (fluorescein fluorescence value of treatment group / fluorescein blue fluorescence value of treatment group) / (fluorescein fluorescence value of control group / fluorescein blue fluorescence value of control group).

[0195] The formula for calculating cell viability is: cell viability = phenol blue fluorescence value of the drug-treated group / phenol blue fluorescence value of the control group.

[0196] After the first round of screening ( Figure 2 AB), the inventors selected 70 small molecule compounds with the strongest regulatory effects from 640 compounds for the second round of screening. In this round of screening, considering the cell viability and inhibition rate, the compounds with cell viability greater than 60%, inhibition rate greater than 30%, and corrected inhibition rate greater than 30% compared with the DMSO group were selected. After the second round of screening, the inventors found that there were two compounds with better inhibitory effects, namely bromocriptine and ivermectin ( Figure 2 CD).

[0197] After comprehensively evaluating cell activity and fluorescence values, the inventors screened out bromocriptine as the optimal inhibitor.

[0198] Example 3: Verification of bromocriptine inhibition of CREBZF at cell and animal levels

[0199] To further verify the inhibitory effect of bromocriptine on CREBZF at the cellular and animal levels, the inventors treated Huh7 or HEK293T cells with different concentrations (5 μM, 10 μM, 20 μM) of bromocriptine for 48 hours, added luciferase substrates produced by PE (PerkinElmer) and Promega, and detected the fluorescence intensity, using the DMSO group as a control.

[0200] The results showed that bromocriptine had a good inhibitory effect on CREBZF in both Huh7 and 239T cells ( Figure 3 A). At the same time, the inventors conducted in vivo animal verification. After wild-type male mice were intraperitoneally injected with adjuvant or 0, 5, 10 mg / kg bromocriptine for one week, it was found that bromocriptine significantly inhibited the expression of CREBZF and showed a dose-dependent effect (P<0.05) ( Figure 3 B). In addition, the protein level of CREBZF was also significantly suppressed one week after intraperitoneal injection of bromocriptine ( Figure 3 C) Detection of bromocriptine inhibition of CREBZF in cells and animals.

[0201] These results indicate that bromocriptine can exert CREBZF inhibitory function both in vitro and in vivo.

[0202] Example 4: Animal level verification that bromocriptine improves adipose tissue inflammation via macrophage CREBZF

[0203] 8-week-old male CREBZF macrophage-specific deletion mice (MKO) and their littermates WT mice were fed a high-fat, high-sugar diet for 16 weeks to induce tissue inflammation, and 10 mg / kg bromocriptine or adjuvant was injected intraperitoneally every day for the last 4 weeks. The inventors used flow cytometry to detect the total proportion of macrophages in adipose tissue (F4 / 80+CD11b+), as well as the pro-inflammatory or anti-inflammatory polarization state, and used qPCR to detect the mRNA expression levels of pro-inflammatory factors (IL-1β, IL-6, TNFα, INOS) in adipose tissue. F4 / 80+CD11b+ marks all macrophages, CD11c+CD206- marks pro-inflammatory macrophages, and CD11c-CD206+ marks anti-inflammatory macrophages.

[0204] The total proportion of macrophages (F4 / 80+CD11b+) in the adipose tissue of CREBZF-knocked-out MKO mice was significantly reduced, and inflammation was alleviated. After CREBZF was knocked out, bromocriptine lacked a target, and its addition did not affect the total proportion of macrophages in the adipose tissue of MKO mice. However, in WT mice, the addition of bromocriptine caused the total proportion of macrophages in the adipose tissue of mice to show a downward trend.

[0205] CD206 is mainly expressed on anti-inflammatory macrophages, and CD11c is mainly expressed on pro-inflammatory macrophages. Figure 4 , flow cytometry was performed on adipose tissue to analyze the presence of different types of macrophages (pro-inflammatory macrophages CD206-CD11c+, anti-inflammatory macrophages CD206+CD11c-). The results showed that compared with the WT group of mice, the total number of macrophages in the adipose tissue of MKO mice was significantly reduced; the proportion of pro-inflammatory macrophages CD206-CD11c+ was significantly reduced, and the proportion of anti-inflammatory macrophages CD206+CD11c- was significantly increased. After CREBZF knockout, bromocriptine lacked a target, and its addition or not did not affect the distribution of anti-inflammatory and pro-inflammatory macrophages. However, in WT mice, the addition of bromocriptine significantly reduced the total proportion of macrophages in adipose tissue, the proportion of pro-inflammatory macrophages CD206-CD11c+ was significantly reduced, and the proportion of anti-inflammatory macrophages CD206+CD11c- was significantly increased.

[0206] The results showed that the lack of macrophage CREBZF or the administration of bromocriptine significantly alleviated the chronic inflammation of adipose tissue of mice induced by a high-fat and high-sugar diet. However, when CREBZF was knocked out in macrophages, the administration of bromocriptine could not further significantly alleviate the chronic inflammation, indicating that bromocriptine improves chronic inflammation by inhibiting CREBZF.

[0207] Example 5: Animal level verification that bromocriptine improves hyperlipidemia and fatty liver via macrophage CREBZF

[0208] Eight-week-old male CREBZF macrophage-specific deletion mice (MKO) and their littermates were fed a high-fat, high-sugar diet for 16 weeks to induce tissue inflammation, and 10 mg / kg bromocriptine or adjuvant (Vehicle) was injected intraperitoneally every day for the last 4 weeks. The inventors used a kit to detect the levels of plasma triglycerides and cholesterol, and used qPCR to detect the mRNA expression levels of fatty acid synthesis-related genes (FAS, ACC, SCD1) in liver tissue, and observed tissue sections of liver lipid deposition.

[0209] The inventors found that bromocriptine alone or CREBZF knockout in macrophages can effectively improve HFHS diet-induced hyperlipidemia ( Figure 5 AB) and fatty liver ( Figure 5 CD). However, in CREBZF MKO mice, administration of bromocriptine could not further significantly improve the relevant indicators ( Figure 5 AD).

[0210] Embodiment 6, drug screening method

[0211] 1. Animal group settings

[0212] Test group: 8-week-old C57Bl / 6 mice were fed a high-fat, high-sugar diet for 16 weeks to induce tissue inflammation; after that, they were treated with the candidate drug;

[0213] Control group: 8-week-old C57Bl / 6 mice, fed a high-fat and high-sugar diet for 16 weeks to induce tissue inflammation; but no candidate substances were given.

[0214] 2. Drug screening

[0215] The effects of the candidate substances in the test group and the control group on the macrophage CREBZF of the animals in the test group and the control group were detected and compared.

[0216] If, after administration of the candidate drug to the test group, the expression of macrophage CREBZF is significantly reduced or absent, or the activity of CREBZF is significantly reduced, it indicates that the candidate is a potential substance for treating or preventing macrophage-related diseases.

[0217] Example 7. Comparison of CREBZF macrophage-specific knockout and knockout in other tissue cells

[0218] The results of comparing the CREBZF macrophage-specific knockout (MKO) and the CREBZF liver-specific knockout (CREBZF LKO) in terms of plasma triglyceride (TG) were shown in Table 2.

[0219] Table 2

[0220]

[0221] According to Table 2, in terms of plasma triglyceride (TG) content, the improvement effect of MKO was significantly more ideal than that of LKO.

[0222] The above results show that macrophage CREBZF-specific knockout significantly improved the plasma triglyceride (TG) level of animals induced by a high-fat and high-sugar diet compared with hepatocyte CREBZF-specific knockout. Moreover, as demonstrated above, macrophage CREBZF-specific knockout can effectively prevent macrophages in adipose tissue from secreting excessive pro-inflammatory factors and relieve chronic inflammation.

[0223] discuss

[0224] The present invention discloses that the specific knockout of CREBZF gene in macrophages can significantly improve diet-induced chronic inflammation. Also disclosed is a method for screening CREBZF inhibitors or agonists using a luciferase reporter gene system, and successfully screened the CREBZF inhibitor bromocriptine. It has been verified that bromocriptine can achieve pharmacological regulation of macrophage CREBZF in vivo and in vitro, and improve diet-induced metabolic disorders and chronic inflammation of adipose tissue. Therefore, the present invention has found the use of bromocriptine in the preparation of drugs targeting macrophage CREBZF, which inhibits macrophage CREBZF, thereby inhibiting macrophage-related diseases, exerting metabolic improvement functions, and treating diseases related to macrophages (such as inflammation, fatty liver, NASH, liver tissue regeneration, liver failure, liver cancer, etc.).

[0225] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. At the same time, all the documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference separately.

Claims

1. A method for screening drugs for treating or preventing macrophage-related diseases, comprising: (1) treating a system comprising macrophages expressing CREBZF with a candidate substance; and, (2) detecting the expression or activity of CREBZF in macrophages in the system; If the candidate substance statistically down-regulates the expression or activity of macrophage CREBZF, the candidate substance is a drug for treating or preventing macrophage-related diseases.

2. The method according to claim 1, characterized in that Step (1) comprises: in the test group, adding the candidate substance to the expression system; and / or, Step (2) comprises: detecting the expression or activity of macrophage CREBZF in the system and comparing it with a control group, wherein the control group is an expression system to which the candidate substance is not added; if the candidate substance statistically downregulates the expression or activity of macrophage CREBZF, then the candidate substance is a drug for treating or preventing macrophage-related diseases.

3. The method according to claim 1, characterized in that The system comprising macrophages is selected from: an animal system, a cell system, a subcellular system, a tissue system or an organ system.

4. The method according to claim 3, characterized in that The system containing macrophages is an animal system, and the animals include: rodents, non-human primates; preferably, a high-fat and high-sugar diet is used to induce macrophage-related diseases in the animal system; more preferably, while selecting a candidate substance that downregulates the expression or activity of macrophage CREBZF, the method of downregulation also includes observing an indicator selected from the following group: (i) the total proportion of macrophages in adipose tissue; wherein, if the total proportion of macrophages is significantly downregulated, the candidate substance is a drug for treating or preventing macrophage-related diseases; (ii) the number of pro-inflammatory macrophages CD206-CD11c+ in adipose tissue; wherein, if the number of pro-inflammatory macrophages CD206-CD11c+ is significantly downregulated, the candidate substance is a drug for treating or preventing macrophage-related diseases; (iii) the number of anti-inflammatory macrophages CD206+CD11c- in adipose tissue; wherein, if the number of anti-inflammatory macrophages CD206+CD11c- is significantly upregulated, the candidate substance is a drug for treating or preventing macrophage-related diseases.

5. The method according to claim 1, characterized in that The macrophage-related diseases include: Adipose tissue inflammation, adipose tissue macrophage infiltration diseases, obesity-related metabolic diseases; Preferably, the adipose tissue inflammation includes: chronic inflammation of adipose tissue; Preferably, the adipose tissue macrophage infiltration disease includes: adipose tissue macrophage increase disease, adipose tissue pro-inflammatory macrophage increase disease, adipose tissue anti-inflammatory macrophage deficiency disease; Preferably, the obesity-related metabolic diseases include: metabolic diseases caused by overeating; preferably, the obesity-related metabolic diseases include: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, fatty liver, obesity.

6. Use of bromocriptine or its pharmaceutically acceptable salt in the preparation of medicines for: (1) Targeting CREBZF; preferably, the CREBZF is macrophage CREBZF; or (2) Treat or prevent macrophage-related diseases.

7. The use according to claim 6, characterized in that The drug further contains a pharmaceutically acceptable carrier or excipient; or The pharmaceutically acceptable salts include acid salts and basic salts; Preferably, the acid salts include: hydrochlorides, hydrobromides, sulfates, nitrates, phosphates, and methanesulfonates; the basic salts include: sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, and aluminum salts.

8. The use according to claim 6 or 7, characterized in that The macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and obesity-related metabolic diseases; Preferably, the adipose tissue inflammation includes: chronic inflammation of adipose tissue; Preferably, the adipose tissue macrophage infiltration disease includes: adipose tissue macrophage increase disease, adipose tissue pro-inflammatory macrophage increase disease, adipose tissue anti-inflammatory macrophage deficiency disease; Preferably, the obesity-related metabolic diseases include: metabolic diseases caused by overeating; preferably, the obesity-related metabolic diseases include: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, fatty liver, obesity.

9. A CREBZF promoter-mediated reporter gene system, comprising a nucleic acid construct or an expression vector comprising the nucleic acid construct, wherein: The nucleic acid construct comprises: a CREBZF promoter and a reporter gene expression box.

10. Use of the CREBZF promoter-mediated reporter gene system according to claim 7 for screening agents that target and regulate CREBZF; preferably, the agent is an inhibitor; preferably, the inhibitor is an agent for treating or preventing macrophage-related diseases.

11. A method for screening an agent that targets and regulates CREBZF, the method comprising: (a) providing a CREBZF promoter-mediated reporter gene system; (b) adding the candidate substance to the system of (1) and observing its effect on the system; If it can specifically inhibit the expression of the reporter gene, the candidate substance is a CREBZF inhibitor; if it can specifically promote the expression of the reporter gene, the candidate substance is a CREBZF agonist; Preferably, the inhibitor is an agent for treating or preventing macrophage-related diseases.

Images