Humanized antibodies or functional fragments thereof against tumor antigens

Abstract

There is provided an antibody or fragment thereof wherein the antibody comprises: (a) a heavy chain variable region (VH) wherein the VH comprises a complementarity determining region (CDR) selected from the group consisting of (i) H-CDR1, H-CDR2 and H-CDR3 as shown in any one of SEQ ID NO.1 to 24 or 49 to 88, respectively, and / or (b) a light chain variable region (VL) wherein the VH comprises a complementary determining region (CDR) selected from the group consisting of: (i) H-CDR1, H-CDR2 and H-CDR3 as shown in any one of SEQ ID NO.1 to 24 or 49 to 88; wherein the VL comprises a complementarity determining region (CDR) selected from the group consisting of: (i) L-CDR1, L-CDR2, and L-CDR3 as shown in any one of SEQ ID NO.25 to 48 or 89 to 128, respectively. Preferably, both VH and VL chains are used. Antibodies and fragments thereof have utility in the treatment of cancer.

Description

Technical Field

[0001] The present invention relates to humanized antibodies or functional antibody fragments thereof or probes thereof directed against a group of antigens identified in cancer. Background Art

[0002] Sialyl Tn (STn) is a short O-glycan antigen, which is a disaccharide that is O-linked to a serine or threonine amino acid residue in an α structure through a GalNAc residue in a polypeptide chain, and the disaccharide consists of sialic acid linked to N-acetylgalactosamine (i.e. Neu5Acα-2,6GalNAc). This truncated polysaccharide has been detected at different frequencies in different types of cancer (Julian, Videira and Delannoy 2012), but is not present in normal healthy tissues. In addition, STn is targeted for metastatic, drug-resistant and highly malignant tumors. In this type of tumor, their characteristics are as follows:

[0003] 1) The association of STn expression with early-stage cancer cells and metastatic cancer cells (Okasaki et al., 2012).

[0004] 2) Increased STn expression in patients is associated with poor prognosis, reduced overall survival, and lack of response to chemotherapy (Choi et al., 2000)

[0005] 3) Escape from immune cell surveillance (Carrascal et al., 2014)

[0006] α-2,6 sialic acid is often a truncated cancer biomarker. Short α 2,6 sialylated O-glycans are overexpressed in several types of cancer. They are often involved in cancer progression and metastasis. In addition, it has been reported that truncated glycans contribute to immune evasion through their recognition by many immune receptors such as sialic acid binding proteins (Siglecs) (Crocke, Paulson, and Varkl, 2007; Micoll et al., 2003).

[0007] The present invention provides further antibodies, functional antibody fragments thereof or probes thereof that specifically bind to these cancer biomarkers. In addition to the specific identification of tumor cells, these antibodies also have the potential to block the recognition of such ligands by host cell receptors, which are involved in mechanisms fundamental to tumor progression (including immune tolerance).

[0008] A number of antibodies have been approved for treating cancer patients (see for example https: / / www.cancer.org), and further details of these and further background to the present invention can be found in WO2019 / 147152.

[0009] WO2019 / 147152 describes nucleotide sequences encoding monoclonal antibodies (mAbs) against STn and a group of glycans terminated with α-2,6-linked sialic acid. These antigens are short-chain glycans that are overexpressed in cancer but not expressed by normal cells. Summary of the invention

[0010] In a broad aspect, according to the present invention, there is provided an antibody or fragment thereof, or a probe thereof, wherein the antibody or fragment or probe comprises:

[0011] (a) a heavy chain variable region (VH), wherein the VH comprises a complementarity determining region (CDR) selected from the group consisting of:

[0012] (i) H-CDR1, H-CDR2 and H-CDR3 as shown in any one of SEQ ID NOs. 1 to 24 or 49 to 88, respectively

[0013] and / or,

[0014] (b) a light chain variable region (VL), wherein the VL comprises a complementarity determining region (CDR) selected from the group consisting of:

[0015] (i) L-CDR1, L-CDR2 and L-CDR3 as shown in any one of SEQ ID NOs. 25 to 48 or 89 to 128, respectively.

[0016] Fragment can be the functional antibody fragment of disclosed antibody, i.e. retains the ability of binding antigen.Antibody as herein described, fragment or probe can bind with sialyl Tn (STn) antigen specificity.Suitably, antibody, fragment or probe are humanized antibodies, fragment or probe, and are therefore suitable for being applied to human patients.Antibody, fragment or probe can be for example affinity matured humanized antibodies, fragment or probe.

[0017] In one aspect, an antibody or fragment thereof may comprise a heavy chain variable region (VH) and a light chain variable region (VL). As will be appreciated, a constant region may also be provided.

[0018] Thus, in one aspect, the present invention essentially provides engineered antibodies having amino acid changes in the chimeric L2A5 framework regions described in WO2019147152 to humanize them. The main scope of humanization is the engineering of antibodies from non-human species whose protein sequences have been modified to increase their similarity to antibodies normally produced in humans. The inventors have discovered and produced humanized L2A5 variants as disclosed in the present application, retaining binding and specificity to STn while showing reduced immunogenicity.

[0019] In a further aspect, the present invention also describes additional engineered antibodies based on humanized variants (referred to in this application as V1). Through a process of affinity maturation, different point mutations were introduced into the CDRs, which enabled the inventors to generate variants with higher binding affinity to STn. As disclosed in this patent application, several antibody variants have shown increased binding to STn+ cell lines and BSM mucins, with no associated binding to other glycans.

[0020] The present application describes the generation of humanized antibodies that recognize STn with moderate to high affinity and high specificity, a feature that is usually not predictable in advance. Humanized clones also potentially have reduced immunogenicity, which reduces the chance of human anti-drug antibodies (HAMA) responses, increases therapeutic window and improves antibody PK profiles.

[0021] Furthermore, the present application describes the development of high affinity humanized anti-STn antibodies through an affinity maturation process.For certain therapeutic applications, it is desirable to have antibodies that have high affinity for the target antigen, thereby improving the anti-tumor response.

[0022] The inventors have now discovered methods for improving antibody affinity and binding to target sialyl Tn (STn) by generating new antibodies. These are related to the clones described in patent WO2019147152A1. In particular, the inventors have provided many different humanized antibody clones, including humanized clones mentioned herein with the acronym V1. In particular, using this humanized V1 clone, the inventors now also provide a series of new and different antibodies produced by affinity maturation processes. These new clones or variants have differences in amino acid sequences and an increase in affinity and binding to target sialyl Tn (STn), and are therefore substantially improved relative to known antibodies.

[0023] Therefore, the present application describes high affinity humanized anti-STn antibodies obtained by affinity maturation process. For some applications, it is highly desirable to have antibodies with high affinity to target antigens, which improve anti-tumor responses. For example, this can allow:

[0024] -Antibody-drug conjugates or radioimmunoconjugates with increased tumor uptake and anti-tumor function.

[0025] - Fine-tune the bispecific T cell engager and CAR receptor to induce desired levels of T cell activation.

[0026] - Improved STn blockade in vivo, which leads to anti-tumor responses by restoring the function of immune cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 shows the sequence ID numbers assigned to the variants disclosed herein, which are reflected in the accompanying sequence listing.

[0029] Figure 2 shows the amino acid sequences of the variable chains (VH and VL) of certain humanized variants disclosed herein.

[0030] Figure 3a shows an amino acid sequence alignment comparing the heavy chain (VH) of the parent antibody (L2A5) with certain humanized variants described herein, wherein:

[0031] (asterisks) Positions with a single completely conserved residue.

[0032] : (colon) Positions that are conserved between amino acid groups with similar properties.

[0033] . (period) Positions that are conserved between amino acid groups with weakly similar properties.

[0034] Figure 3b shows an amino acid sequence alignment comparing the light chain (VL) of the parent antibody (L2A5) with certain humanized variants described herein.

[0035] (asterisks) Positions with a single completely conserved residue.

[0036] : (colon) Positions that are conserved between amino acid groups with similar properties.

[0037] . (period) Positions that are conserved between amino acid groups with weakly similar properties.

[0038] Figure 4 shows the amino acid sequence of the VH heavy chain of the humanized variants disclosed herein. The H-CDR1, H-CDR2 and H-CDR3 sequences are highlighted in bold.

[0039] FIG. 5 shows the V L Amino acid sequence of the light chain. The L-CDR1, L-CDR2 and L-CDR3 sequences are highlighted in bold.

[0040] FIG6a shows the V H Amino acid sequence of the heavy chain. H-CDR1, H-CDR2 and H-CDR3 sequences are highlighted in bold.

[0041] Figure 6b shows the V L Amino acid sequence of the light chain. The L-CDR1, L-CDR2 and L-CDR3 sequences are highlighted in bold.

[0042] Figure 7 shows the amino acid sequences of the variable chains (VH and VL) of the affinity matured variants disclosed herein, along with the clonal variant names and their corresponding sequence identity numbers, as reflected in the accompanying sequence listing.

[0043] Figure 8 shows the percentage of dose response effect (EC50) of V1-3 humanized clones screened against BSM mucin by ELISA using normalized EC50 of humanized Ab clones V1, V2 and V3 plotted as percentage of dose response effect (y-axis) versus antibody dose in log scale (x-axis). Clone V2 had a lower EC50 compared to V1 and V3 clones. EC50 values: V1 0.3238 to 0.4573; V2 0.06649 to 0.1365; V3 0.3440 to 0.4490.

[0044] Figure 9 shows the binding of humanized clones to different STn+ cancer cell lines. The three variants shown (V1, V2 and V3) maintained high binding to different cell lines expressing STn.

[0045] Figure 10 shows NMR analysis of contact / interaction points between the antibody and the glycan molecule, using humanized variant 6 (V6), the antibody was observed to bind primarily to the sialic acid portion of STn (orange circles), but also interact with the GalNac portion (lower right of the figure).

[0046] Figure 11 shows how to use surface plasmon resonance (SPR) to measure the affinity and kinetic parameters of different anti-STn antibodies.BSA-STn is immobilized to the chip, and the antibody is injected onto the surface as the association phase.CellmAbCBS humanized clones (V1-V3) show high affinity to BSA-STn, wherein the KD range is 29nM to 39nM.The interaction between the positive control clone and the BSA-STn is not detected.

[0047] Figures 12A and 12B show the results of glycan array analysis, which uses different immobilized glycan probes to evaluate the binding specificity and binding strength of antibodies to a group of α2-6 sialylated glycans. A shows that when compared with the "positive control", humanized mAb V1-V3 has increased binding to STn-Ser. B shows that compared with the chimeric L2A5 antibody, humanized clone V1 and affinity matured clone V64 maintain binding to STn-Ser. In addition, compared with the parent chimeric L2A5 antibody, clones V1 and V64 show improved binding to STn-Thr.

[0048] Figure 13 A to D shows the results from the in silico immunogenicity analysis, predicted affinity values ​​for the VH and VL regions of the V1 and V2 antibody clones (y-axis), respectively, compared to the chimeric / parental L2A5 Ab, at different positions and using different protein sequences (x-axis). Compared to the chimeric L2A5, V1 and V2 reported reduced immunogenicity values.

[0049] Figure 14 shows the results of antibody internalization assay analysis using humanized antibody variants (V2, V1) using MDA-MB231 breast cancer cell lines overexpressing STn transgenes, compared with control IgG and 3F1 (commercially available antibodies) using humanized Ab variants (V1-2). Antibody internalization is reported as signal to background ratio MFI (y axis), normalized to untreated cells at 2-6 and 16 hours (x axis).

[0050] Figure 15 shows representative IHC staining results using humanized V1, V2 and V3 antibody clones in colon cancer and different metastatic tissues. The scale bar represents 50 um.

[0051] Figure 16 shows the EC50 results of binding properties of certain affinity matured antibody variants to bovine submandibular mucin (BSM) using ELISA assay and EC50 analysis. Binding to BSM is shown as absorbance (OD) on the y-axis at different antibody concentrations (µg / ml) on the x-axis. The clones tested included new variants with point mutations in the CDRs (selected after the affinity maturation process).

[0052] Figure 17 shows the binding profiles of certain affinity matured variants using different cancer cell lines presenting different STn expression levels. Each antibody was titrated using a 7-point concentration (µg / ml) curve and the binding intensity was measured by flow cytometry using a secondary antibody conjugated to a fluorophore.

[0053] Figure 18 shows the EC50 of certain affinity matured variants based on binding results obtained in the MDA-MB-231 STn breast cancer cell line, the EC50 for each antibody was calculated. This table summarizes the EC50 obtained for each clone as well as the maximum MFI detected.

[0054] Figure 19 shows the binding results of different sialylated probes and different types of polysaccharides used for some affinity maturation variants. Use polysaccharide arrays with different sialylated probes (x-axis) to report binding with the fluorescence intensity (y-axis) of affinity maturation clones. Affinity maturation clones retain the specificity to STn-serine (probe 3) and STn-threonine (probe 4).

[0055] Figure 20a shows the V1 structure of the humanized V1 variants disclosed herein. HSequence ID No and amino acid sequence of the heavy chain. H-CDR1, H-CDR2 and H-CDR3 sequences are in bold.

[0056] Figure 20b shows the V1 variants of the humanized V1 disclosed herein. L Sequence ID No and amino acid sequence of the light chain. L-CDR1, L-CDR2 and L-CDR3 sequences are in bold.

[0057] It should be understood that a monoclonal antibody (mAb) refers to an antibody produced by a single B cell clone. MAbs can also be produced by hybridomas (which are hybrids between B cells and myeloma cells) or cell lines that express recombinant DNA encoding immunoglobulin heavy and light chains and will therefore produce a single and specific antibody.

[0058] Antibodies can be expressed into an extracellular environment and then purified from there.

[0059] The specificity of an antibody is its ability to react with one antigen or a group of antigens that share a certain epitope. An epitope, also called an antigenic determinant, is the part of an antigen that is recognized by an antibody.

[0060] Antibodies belong to the immunoglobulin class of proteins and are usually an assembly of two identical heavy chains (about 50-70 kDa) and two identical light chains (about 25 kDa). At the amino terminus of each heavy or light chain, there is a sequence of 100-130 amino acids encoding the variable region. In the carboxyl terminus of each heavy or light chain, there is a sequence encoding the constant region. Typically, each antibody binds to the same antigen, i.e., is bivalent.

[0061] Antigen binding fragment (Fab) is an antibody fragment that binds to an antigen. Each Fab is composed of a constant domain and a variable domain from each heavy and light chain of the antibody. The fragment crystallizable (Fc) region is composed of 2 or 3 domains at the carboxyl termini of the two heavy chains. The Fab ensures binding to the antigen, while the Fc region ensures that each antibody generates an effector immune response. The Fc region binds to various cell receptors such as Fc receptors and other molecules such as complement proteins, thereby mediating different physiological effects, including conditioning to promote phagocytosis of phagocytes, cell lysis by natural killer cells, and degranulation of mast cells, basophils and eosinophils.

[0062] The term "variable domain" or "variable region" is the amino terminal portion of the light chain or heavy chain of an antibody that interacts with an antigen. It usually has a length of about 120 to 130 amino acids in the heavy chain, and usually has a length of about 100 to 110 amino acids in the light chain. The sequence of each variable region is substantially different, particularly in the complementary determining region (CDR) responsible for interacting with a specific antigen. The flanks of the CDR are framework regions (FRs) that vary less. Three CDRs are usually present in each of the light and heavy chains. Therefore, for example, CDR L1, L2 and L3 are in the light chain, and CDR H1, H2 and H3 are in the heavy chain.

[0063] The expression "functional antibody fragment or probe" appropriately refers to a portion of an antibody that includes the variable regions of the heavy and light chains of an antibody, or includes the variable regions of the heavy chain or the variable regions of the light chain of an antibody. For example, a functional antibody fragment or probe retains most or all of the binding activity of the original antibody from which the fragment or probe was derived. Such functional antibody fragments or probes may, for example, include single-chain Fv (scFv), diabodies, triabodies, tetrabodies, and minibodies.

[0064] It should be understood that, as used herein, the term fragment refers in particular to fragments of antibodies as explicitly described, and these form an important aspect of the present disclosure. In this way, a monoclonal or recombinant antibody as provided in the present disclosure can be provided, for example, with any of the following fragments: (i) a Fab fragment consisting of a VL, VH, CL and CH1 domain; (ii) a Fd fragment consisting of a VH and CH1 domain; (iii) a Fv fragment consisting of a VL and VH domain; (iv) a dAb fragment consisting of a VH domain; (v) an isolated CDR region; (vi) a F(ab')2 fragment, which is a bivalent fragment comprising two connected Fab fragments; and (vii) a single-chain Fv molecule (scFv), wherein the VH domain and the VL domain are connected by a peptide linker that allows the two domains to associate to form an antigen binding site.

[0065] Alternatively, as will be appreciated, an antibody according to the present disclosure may comprise an entire IgG antibody, whereby the antibody includes both variable and constant regions.

[0066] The term "nucleotide sequence" refers to a sequence of nucleotides of any length, wherein the nucleotides are deoxyribonucleotides or ribonucleotides or analogs thereof.

[0067] As will be appreciated, a nucleotide sequence can be transcribed to produce mRNA, which is then translated into a polypeptide and / or fragments thereof.

[0068] Further aspects of the invention will now be described. In a preferred aspect, an antibody or a functional antibody fragment thereof or a probe is provided, wherein the antibody or fragment or probe comprises one of the following heavy chain CDR and light chain CDR pairs:

[0069] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 1 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 25;

[0070] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 2 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 26;

[0071] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 3 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 27;

[0072] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 4 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 28;

[0073] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 5 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 29;

[0074] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 6 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 30;

[0075] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 7 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 31;

[0076] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 8 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 32;

[0077] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 9 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 33;

[0078] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 10 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 34;

[0079] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 11 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 35;

[0080] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 12 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 36;

[0081] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 13 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 37;

[0082] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 14 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 38;

[0083] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 15 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 39;

[0084] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 16 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 40;

[0085] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 17 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 41;

[0086] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 18 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 42;

[0087] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 19 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 43;

[0088] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 20 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 44;

[0089] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 21 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 45;

[0090] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 22 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 46;

[0091] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 23 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 47; or

[0092] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 24 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 48.

[0093] Sequence identity information identifying the humanized and affinity matured variants provided by the present invention is given in Figures 1 to 6 and in the sequence listing accompanying this application, including the complete VH and VL sequences and CDR regions of each variant.

[0094] The present invention provides humanized and affinity matured variants, which show excellent binding affinity and specificity to the antigen STn, and also show reduced immunogenicity. Humanized variants are disclosed herein by means of SEQ ID No 1-24 (variable VH region) and SEQ ID No 25-48 (variable VL region), and affinity matured antibody variants are disclosed herein by means of SEQ ID No 49-88 (variable VH region) and SEQ ID No 89-128 (variable VL region),

[0095] In a preferred aspect, an antibody or a functional antibody fragment or probe thereof is provided, wherein the antibody or fragment or probe comprises one of the following heavy chain CDR and light chain CDR pairs:

[0096] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 17 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 41;

[0097] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 20 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 44;

[0098] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 21 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 45.

[0099] In a further aspect, an antibody or a functional fragment thereof or a probe is provided, wherein the antibody or fragment or probe comprises one of the following light chain CDR and heavy chain CDR pairs:

[0100] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 49 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 89;

[0101] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 50 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 90;

[0102] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 51 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 91;

[0103] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 52 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 92;

[0104] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 53 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 93;

[0105] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 54 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 94;

[0106] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 55 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 95;

[0107] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 56 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 96;

[0108] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 57 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 97;

[0109] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 58 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 98;

[0110] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 59 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 99;

[0111] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 60 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 100;

[0112] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 61 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 101;

[0113] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 62 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 102;

[0114] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 63 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 103;

[0115] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 64 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 104;

[0116] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 65 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 105;

[0117] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 66 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 106;

[0118] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 67 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 107;

[0119] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 68 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 108;

[0120] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 69 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 109;

[0121] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 70 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 110;

[0122] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 71 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 111;

[0123] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 72 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 112;

[0124] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 73 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 113;

[0125] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 74 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 114;

[0126] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 75 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 115;

[0127] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 76 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 116;

[0128] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 77 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 117;

[0129] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 78 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 118;

[0130] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 79 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 119;

[0131] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 80 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 120;

[0132] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 81 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 121;

[0133] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 82 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 122;

[0134] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 83 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 123;

[0135] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 84 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 124;

[0136] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 85 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 125;

[0137] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 86 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 126;

[0138] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 87 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 127; or

[0139] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 88 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 128.

[0140] In a preferred aspect, an antibody or fragment thereof or a probe is provided, wherein the antibody or fragment or probe comprises one of the following heavy chain CDR and light chain CDR pairs:

[0141] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 49 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 89;

[0142] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 70 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 110;

[0143] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 81 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 121; or

[0144] H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 88 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 128.

[0145] In a further aspect of the present invention, an antibody or a functional antibody fragment or probe thereof is provided, wherein in addition to the CDR regions herein, the antibody or fragment or probe further comprises:

[0146] (a) a heavy chain variable region (VH), wherein VH comprises a humanized heavy chain framework region

[0147] and / or,

[0148] (b) a light chain variable region (VL), wherein the VL comprises a humanized light chain framework region.

[0149] Humanized framework regions can be further described, for example, as follows. It should be understood that variable framework regions refer to sequences surrounding the CDR regions. Thus, different combinations of CDR regions and variable framework regions described herein can be prepared if desired.

[0150] Therefore, in one aspect of the present invention, an antibody or fragment thereof is provided, wherein the antibody or fragment comprises:

[0151] (a) a heavy chain variable region (VH), wherein the VH comprises a humanized heavy chain framework region as shown in a heavy chain variable region (VH) sequence selected from the group consisting of:

[0152] (i) any one of SEQ ID NO. 1 to 24 or 49 to 88, respectively

[0153] and / or,

[0154] (b) a light chain variable region (VL), wherein the VL comprises a humanized light chain framework region shown in a light chain variable region (VL) sequence selected from the group consisting of:

[0155] (ii) any one of SEQ ID NOs. 25 to 48 or 89 to 128, respectively.

[0156] If desired, one of the above humanized heavy chain framework regions can be paired with any of the humanized light chain framework regions.

[0157] Certain pairings of framework regions are preferred. In one aspect of the invention, an antibody or fragment thereof is provided, wherein the antibody or fragment comprises one of the following light chain and heavy chain framework region pairs, wherein the heavy chain framework region is as shown in the heavy chain variable region (VH) sequence shown below, and wherein the light chain framework region is as shown in the light chain variable region (VL) sequence shown below:

[0158] A heavy chain framework region of SEQ ID NO. 1 paired with a light chain framework region from SEQ ID NO. 25;

[0159] A heavy chain framework region of SEQ ID NO. 2 paired with a light chain framework region from SEQ ID NO. 26;

[0160] A heavy chain framework region of SEQ ID NO. 3 paired with a light chain framework region from SEQ ID NO. 27;

[0161] A heavy chain framework region of SEQ ID NO. 4 paired with a light chain framework region from SEQ ID NO. 28;

[0162] A heavy chain framework region of SEQ ID NO. 5 paired with a light chain framework region from SEQ ID NO. 29;

[0163] A heavy chain framework region of SEQ ID NO. 6 paired with a light chain framework region from SEQ ID NO. 30;

[0164] A heavy chain framework region of SEQ ID NO. 7 paired with a light chain framework region from SEQ ID NO. 31;

[0165] A heavy chain framework region of SEQ ID NO. 8 paired with a light chain framework region from SEQ ID NO. 32;

[0166] A heavy chain framework region of SEQ ID NO. 9 paired with a light chain framework region from SEQ ID NO. 33;

[0167] A heavy chain framework region of SEQ ID NO. 10 paired with a light chain framework region from SEQ ID NO. 34;

[0168] A heavy chain framework region of SEQ ID NO. 11 paired with a light chain framework region from SEQ ID NO. 35;

[0169] A heavy chain framework region of SEQ ID NO. 12 paired with a light chain framework region from SEQ ID NO. 36;

[0170] A heavy chain framework region of SEQ ID NO. 13 paired with a light chain framework region from SEQ ID NO. 37;

[0171] A heavy chain framework region of SEQ ID NO. 14 paired with a light chain framework region from SEQ ID NO. 38;

[0172] A heavy chain framework region of SEQ ID NO. 15 paired with a light chain framework region from SEQ ID NO. 39;

[0173] A heavy chain framework region of SEQ ID NO. 16 paired with a light chain framework region from SEQ ID NO. 40;

[0174] A heavy chain framework region of SEQ ID NO. 17 paired with a light chain framework region from SEQ ID NO. 41;

[0175] A heavy chain framework region of SEQ ID NO. 18 paired with a light chain framework region from SEQ ID NO. 42;

[0176] A heavy chain framework region of SEQ ID NO. 19 paired with a light chain framework region from SEQ ID NO. 43;

[0177] A heavy chain framework region of SEQ ID NO. 20 paired with a light chain framework region from SEQ ID NO. 44;

[0178] A heavy chain framework region of SEQ ID NO. 21 paired with a light chain framework region from SEQ ID NO. 45;

[0179] A heavy chain framework region of SEQ ID NO. 22 paired with a light chain framework region from SEQ ID NO. 46;

[0180] A heavy chain framework region of SEQ ID NO. 23 paired with a light chain framework region from SEQ ID NO. 47; or

[0181] The heavy chain framework region of SEQ ID NO. 24 is paired with the light chain framework region from SEQ ID NO. 48.

[0182] In a further aspect of the invention, an antibody or fragment thereof or a probe thereof is provided, wherein the antibody or fragment or probe comprises one of the following light chain and heavy chain framework region pairs, wherein the heavy chain framework region is as shown in the heavy chain variable region (VH) sequence shown below, and wherein the light chain framework region is as shown in the light chain variable region (VL) sequence shown below:

[0183] A heavy chain framework region of SEQ ID NO. 49 paired with a light chain framework region from SEQ ID NO. 89;

[0184] A heavy chain framework region of SEQ ID NO. 50 paired with a light chain framework region from SEQ ID NO. 90;

[0185] A heavy chain framework region of SEQ ID NO. 51 paired with a light chain framework region from SEQ ID NO. 91;

[0186] A heavy chain framework region of SEQ ID NO. 52 paired with a light chain framework region from SEQ ID NO. 92;

[0187] A heavy chain framework region of SEQ ID NO. 53 paired with a light chain framework region from SEQ ID NO. 93;

[0188] A heavy chain framework region of SEQ ID NO. 54 paired with a light chain framework region from SEQ ID NO. 94;

[0189] A heavy chain framework region of SEQ ID NO. 55 paired with a light chain framework region from SEQ ID NO. 95;

[0190] A heavy chain framework region of SEQ ID NO. 56 paired with a light chain framework region from SEQ ID NO. 96;

[0191] A heavy chain framework region of SEQ ID NO. 57 paired with a light chain framework region from SEQ ID NO. 97;

[0192] A heavy chain framework region of SEQ ID NO. 58 paired with a light chain framework region from SEQ ID NO. 98;

[0193] A heavy chain framework region of SEQ ID NO. 59 paired with a light chain framework region from SEQ ID NO. 99;

[0194] A heavy chain framework region of SEQ ID NO. 60 paired with a light chain framework region from SEQ ID NO. 100;

[0195] A heavy chain framework region of SEQ ID NO. 61 paired with a light chain framework region from SEQ ID NO. 101;

[0196] A heavy chain framework region of SEQ ID NO. 62 paired with a light chain framework region from SEQ ID NO. 102;

[0197] A heavy chain framework region of SEQ ID NO. 63 paired with a light chain framework region from SEQ ID NO. 103;

[0198] A heavy chain framework region of SEQ ID NO. 64 paired with a light chain framework region from SEQ ID NO. 104;

[0199] A heavy chain framework region of SEQ ID NO. 65 paired with a light chain framework region from SEQ ID NO. 105;

[0200] A heavy chain framework region of SEQ ID NO. 66 paired with a light chain framework region from SEQ ID NO. 106;

[0201] A heavy chain framework region of SEQ ID NO. 67 paired with a light chain framework region from SEQ ID NO. 107;

[0202] A heavy chain framework region of SEQ ID NO. 68 paired with a light chain framework region from SEQ ID NO. 108;

[0203] A heavy chain framework region of SEQ ID NO. 69 paired with a light chain framework region from SEQ ID NO. 109;

[0204] A heavy chain framework region of SEQ ID NO. 70 paired with a light chain framework region from SEQ ID NO. 110;

[0205] A heavy chain framework region of SEQ ID NO. 71 paired with a light chain framework region from SEQ ID NO. 111;

[0206] A heavy chain framework region of SEQ ID NO. 72 paired with a light chain framework region from SEQ ID NO. 112;

[0207] A heavy chain framework region of SEQ ID NO. 73 paired with a light chain framework region from SEQ ID NO. 113;

[0208] A heavy chain framework region of SEQ ID NO. 74 paired with a light chain framework region from SEQ ID NO. 114;

[0209] A heavy chain framework region of SEQ ID NO. 75 paired with a light chain framework region from SEQ ID NO. 115;

[0210] A heavy chain framework region of SEQ ID NO. 76 paired with a light chain framework region from SEQ ID NO. 116;

[0211] A heavy chain framework region of SEQ ID NO. 77 paired with a light chain framework region from SEQ ID NO. 117;

[0212] A heavy chain framework region of SEQ ID NO. 78 paired with a light chain framework region from SEQ ID NO. 118;

[0213] A heavy chain framework region of SEQ ID NO. 79 paired with a light chain framework region from SEQ ID NO. 119;

[0214] A heavy chain framework region of SEQ ID NO. 80 paired with a light chain framework region from SEQ ID NO. 120;

[0215] A heavy chain framework region of SEQ ID NO. 81 paired with a light chain framework region from SEQ ID NO. 121;

[0216] A heavy chain framework region of SEQ ID NO. 82 paired with a light chain framework region from SEQ ID NO. 122;

[0217] A heavy chain framework region of SEQ ID NO. 83 paired with a light chain framework region from SEQ ID NO. 123;

[0218] A heavy chain framework region of SEQ ID NO. 84 paired with a light chain framework region from SEQ ID NO. 124;

[0219] A heavy chain framework region of SEQ ID NO. 85 paired with a light chain framework region from SEQ ID NO. 125;

[0220] A heavy chain framework region of SEQ ID NO. 86 paired with a light chain framework region from SEQ ID NO. 126;

[0221] A heavy chain framework region of SEQ ID NO. 87 paired with a light chain framework region from SEQ ID NO. 127; or

[0222] The heavy chain framework region of SEQ ID NO. 88 is paired with the light chain framework region from SEQ ID NO. 128.

[0223] The fact is that the framework region allows a certain degree of variability in the exact sequence while still allowing the function to be maintained, including binding affinity and specificity. Therefore, the present invention also provides antibodies or fragments thereof or probes as described, wherein the heavy chain framework region and / or the light chain framework region may have 80% or more, preferably 85% or more sequence identity with the specific sequences described herein. For example, this may be done by substitution, addition or deletion of amino acid residues, wherein substitution is generally preferred. Substitution may be, for example, conservative amino acid substitution.

[0224] In a preferred aspect of the invention, the antibodies or fragments thereof or probes as described herein are such that the heavy chain framework region and / or the light chain framework region have 90% or more, preferably 95% or more sequence identity with the specific sequences described herein. For example, this can be done by substitution, addition or deletion of amino acid residues, wherein substitution is generally preferred. Substitution can be, for example, conservative amino acid substitution.

[0225] In a further aspect of the present invention, there is provided an antibody or fragment thereof or a probe thereof, wherein the antibody or fragment or probe comprises:

[0226] (a) a heavy chain variable region (VH) selected from the group consisting of:

[0227] (i) any one of SEQ ID NO. 1 to 24 or 49 to 88, respectively

[0228] and / or,

[0229] (a) a light chain variable region (VL) selected from the group consisting of:

[0230] (ii) any one of SEQ ID NOs. 25 to 48 or 89 to 128, respectively.

[0231] Any VH domain can be paired with any VL domain, although certain pairings are preferred.

[0232] Therefore, in a further aspect, the present invention provides an antibody or fragment thereof or a probe thereof as described herein, wherein the antibody or fragment or probe comprises one of the following heavy chain variable region (VH) and light chain variable region (VL) pairs:

[0233] SEQ ID NO. 1 paired with SEQ ID NO. 25;

[0234] SEQ ID NO. 2 paired with SEQ ID NO. 26;

[0235] SEQ ID NO. 3 paired with SEQ ID NO. 27;

[0236] SEQ ID NO. 4 paired with SEQ ID NO. 28;

[0237] SEQ ID NO. 5 paired with SEQ ID NO. 29;

[0238] SEQ ID NO. 6 paired with SEQ ID NO. 30;

[0239] SEQ ID NO. 7 paired with SEQ ID NO. 31;

[0240] SEQ ID NO. 8 paired with SEQ ID NO. 32;

[0241] SEQ ID NO. 9 paired with SEQ ID NO. 33;

[0242] SEQ ID NO. 10 paired with SEQ ID NO. 34;

[0243] SEQ ID NO. 11 paired with SEQ ID NO. 35;

[0244] SEQ ID NO. 12 paired with SEQ ID NO. 36;

[0245] SEQ ID NO. 13 paired with SEQ ID NO. 37;

[0246] SEQ ID NO. 14 paired with SEQ ID NO. 38;

[0247] SEQ ID NO. 15 paired with SEQ ID NO. 39;

[0248] SEQ ID NO. 16 paired with SEQ ID NO. 40;

[0249] SEQ ID NO. 17 paired with SEQ ID NO. 41;

[0250] SEQ ID NO. 18 paired with SEQ ID NO. 42;

[0251] SEQ ID NO. 19 paired with SEQ ID NO. 43;

[0252] SEQ ID NO. 20 paired with SEQ ID NO. 44;

[0253] SEQ ID NO. 21 paired with SEQ ID NO. 45;

[0254] SEQ ID NO. 22 paired with SEQ ID NO. 46;

[0255] SEQ ID NO. 23 paired with SEQ ID NO. 47; or

[0256] SEQ ID NO. 24 paired with SEQ ID NO. 48.

[0257] In a further aspect of the present invention, an antibody or fragment thereof or a probe thereof is provided, wherein the antibody or fragment or probe comprises one of the following heavy chain variable region (VH) and light chain variable region (VL) pairs:

[0258] SEQ ID NO. 49 paired with SEQ ID NO. 89;

[0259] SEQ ID NO. 50 paired with SEQ ID NO. 90;

[0260] SEQ ID NO. 51 paired with SEQ ID NO. 91;

[0261] SEQ ID NO. 52 paired with SEQ ID NO. 92;

[0262] SEQ ID NO. 53 paired with SEQ ID NO. 93;

[0263] SEQ ID NO. 54 paired with SEQ ID NO. 94;

[0264] SEQ ID NO. 55 paired with SEQ ID NO. 95;

[0265] SEQ ID NO. 56 paired with SEQ ID NO. 96;

[0266] SEQ ID NO. 57 paired with SEQ ID NO. 97;

[0267] SEQ ID NO. 58 paired with SEQ ID NO. 98;

[0268] SEQ ID NO. 59 paired with SEQ ID NO. 99;

[0269] SEQ ID NO. 60 paired with SEQ ID NO. 100;

[0270] SEQ ID NO. 61 paired with SEQ ID NO. 101;

[0271] SEQ ID NO. 62 paired with SEQ ID NO. 102;

[0272] SEQ ID NO. 63 paired with SEQ ID NO. 103;

[0273] SEQ ID NO. 64 paired with SEQ ID NO. 104;

[0274] SEQ ID NO. 65 paired with SEQ ID NO. 105;

[0275] SEQ ID NO. 66 paired with SEQ ID NO. 106;

[0276] SEQ ID NO. 67 paired with SEQ ID NO. 107;

[0277] SEQ ID NO. 68 paired with SEQ ID NO. 108;

[0278] SEQ ID NO. 69 paired with SEQ ID NO. 109;

[0279] SEQ ID NO. 70 paired with SEQ ID NO. 110;

[0280] SEQ ID NO. 71 paired with SEQ ID NO. 111;

[0281] SEQ ID NO. 72 paired with SEQ ID NO. 112;

[0282] SEQ ID NO. 73 paired with SEQ ID NO. 113;

[0283] SEQ ID NO. 74 paired with SEQ ID NO. 114;

[0284] SEQ ID NO. 75 paired with SEQ ID NO. 115;

[0285] SEQ ID NO. 76 paired with SEQ ID NO. 116;

[0286] SEQ ID NO. 77 paired with SEQ ID NO. 117;

[0287] SEQ ID NO. 78 paired with SEQ ID NO. 118;

[0288] SEQ ID NO. 79 paired with SEQ ID NO. 119;

[0289] SEQ ID NO. 80 paired with SEQ ID NO. 120;

[0290] SEQ ID NO. 81 paired with SEQ ID NO. 121;

[0291] SEQ ID NO. 82 paired with SEQ ID NO. 122;

[0292] SEQ ID NO. 83 paired with SEQ ID NO. 123;

[0293] SEQ ID NO. 84 paired with SEQ ID NO. 124;

[0294] SEQ ID NO. 85 paired with SEQ ID NO. 125;

[0295] SEQ ID NO. 86 paired with SEQ ID NO. 126;

[0296] SEQ ID NO. 87 paired with SEQ ID NO. 127; or

[0297] SEQ ID NO. 88 paired with SEQ ID NO. 128.

[0298] In the same manner as described above, the present invention also provides an antibody or fragment thereof or a probe as described, wherein the heavy chain variable region (VH) and / or the light chain variable region (VL) may have 80% or more, preferably 85% or more sequence identity with the specific VH and VL sequences described herein. For example, this can be carried out by substitution, addition or deletion of amino acid residues, wherein substitution is generally preferred. Substitutions may be, for example, conservative amino acid substitutions.

[0299] In a preferred aspect of the invention, the antibody or fragment thereof or probe as described herein has a heavy chain variable region (VH) and / or a light chain variable region with a specific sequence described herein having a sequence identity of 90% or more, preferably 95% or more. For example, this can be done by substitution, addition or deletion of amino acid residues, wherein substitution is generally preferred. Substitution can be, for example, conservative amino acid substitution.

[0300] Functionally, the invention provides antibodies or fragments thereof or probes thereof as described herein, which bind to STn and a group of polysaccharides terminated with α 2,6-linked sialic acid. Polysaccharides terminated with α 2,6-linked sialic acid may include, for example, STn, 2,6-sialic acid T, disialyl T or 2,6-sialyl lactosamine.

[0301] The overall group of glycans recognized by the antibodies or fragments thereof or probes thereof described herein include:

[0302] 1. Sialyl Tn:

[0303] NeuAcα--6GaINAcα / β1-

[0304] 2.2,6-Sialyl T:

[0305] Gal β1-3GalNAcα1 –- NeuAcα2-6

[0306] 3. Disialyl T:

[0307] NeuAcα2-3Galβ1-3GalNAcα1 --- NeuAcα2-6

[0308] 4.2,6-Sialyl-N-acetyllactosamine:

[0309] NeuAcα2-6Galβ1-4Glcβ1 -

[0310] Sialyl Tn, also known as STn, sialic acid Tn, sialyl Tn, Neu5Ac-α 2,6GalNAcα-O-Ser / Thr, or also known as CD175s by the "cluster of differentiation" nomenclature, is the simplest sialylated mucin-type O-glycan. STn is a truncated O-glycan α-O-linked to serine / threonine (Ser / Thr) that contains sialic acid (Neu5Ac) α-2,6 (via carbon 6) linked to N-acetyl-galactosamine (GalNAc) (Neu5Ac-α2, 6GalNAc α-O-Ser / Thr). Sialylation prevents the formation of various core structures otherwise found in mucin-type O-glycans.

[0311] STn is expressed by more than 80% of human cancers and is associated with poor prognosis and reduced overall survival in patients with different cancers. The biosynthesis of the STn antigen has been linked to the expression of the sialyltransferase ST6GalNAc1 and to mutations or loss of heterozygosity in the COSMC gene.

[0312] In contrast to many current antibody therapeutics, antibodies that bind STn with this type of specificity are of particular interest due to their high tumor specificity and low or absent reactivity toward normal cells.

[0313] As described herein, the antibody or fragment thereof or probe thereof is capable of specifically binding to STn or a group of α-2,6 sialylated glycans.

[0314] The antibodies or fragments thereof described herein may be subject to glycan changes at the glycosylation sites.

[0315] In one aspect of the invention, antibodies or fragments thereof as described herein or probes thereof may be provided in any suitable form. For example, antibodies or fragments or probes may be provided in the form of ScFv, monoclonal antibodies, chimeric antibodies, humanized antibodies, bispecific antibodies, antibody drug conjugates (ADC) or CAR-T- cells or other forms, as will be understood by those skilled in the art.

[0316] Thus, for example, the antibodies or fragments thereof or probes of the invention can be provided as single-chain fragment variable antibodies (scFv). This refers to a functional antibody fragment containing only a VL region and a VH region, which are connected by a linker to form a monovalent antigen binding site. Diabodies, triabodies and tetrabodies are antibodies that include dimers, trimers or tetramers of scFv, i.e., contain two, three and four polypeptide chains, respectively, and form two, three and four antigen binding sites, respectively, which may be the same or different.

[0317] The antibodies, functional antibody fragments or probes thereof of the present invention may have one or more binding sites. If more than one binding site is contained, these sites may be identical or different from each other. In the case of two different binding sites, the antibody, its functional antibody fragment or probe is referred to as a "bispecific" antibody.

[0318] In a further aspect, the present invention therefore also provides an antibody drug conjugate (ADC) comprising an antibody or fragment thereof or a probe as described herein, a linker and a cytotoxic drug.

[0319] The present invention also provides a pharmaceutical composition comprising the antibody or a functional antibody fragment or probe thereof, or an antibody drug conjugate (ADC) as described herein and a pharmaceutically acceptable carrier.

[0320] On the other hand, a method for detecting tumor biomarkers in patient samples using an antibody or its functional antibody fragment or probe as described herein, or an antibody drug conjugate (ADC) or a pharmaceutical composition is provided. The method involves staining a biological sample obtained from a subject with a nucleotide sequence encoding an antibody or its functional antibody fragment or probe as described herein, or an antibody drug conjugate (ADC) under conditions suitable for the specific binding of the antibody. The presence or absence of the binding of the antibody indicates a tumor cell expressing cell surface STn, 2,6-sialic acid T, disialyl T or 2,6-sialyllactosamine. For example, the biological sample analyzed may include isolated cells or tissues or tumor-derived proteins.

[0321] The present invention also provides antibodies or functional antibody fragments thereof or probes, or antibody drug conjugates (ADCs), or pharmaceutical compositions for medical use, all of which are as described herein. In particular, antibodies as pharmaceutical compositions for medical use are intended for use in the treatment of cancer patients. It is contemplated that various types of tumors can be treated with the variants disclosed herein.

[0322] Therefore, in some aspects, the antibodies, functional antibody fragments or probes thereof of the present invention can be conjugated to or fused to one or more diagnostic agents or therapeutic agents or any other desired molecules. The resulting conjugated antibodies, functional antibody fragments or probes thereof can be used to monitor or diagnose the onset, progression and / or severity of diseases associated with STn or α-2,6 sialylated glycan expression.

[0323] The antibodies or functional fragments or probes thereof of the present invention can also be used to detect the expression of STn or α-2,6 sialylated glycans in any biological sample using classical immunohistological methods (IHC or immunoassays such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA)), flow cytometry and immunoblotting.

[0324] The antibodies, functional antibody fragments or probes thereof of the present invention may be contained alone, conjugated or combined with a pharmaceutical composition, provided at an effective concentration, so as to exert a therapeutically useful effect with minimal side effects.

[0325] In a further aspect, the present invention includes an isolated polynucleotide comprising a nucleic acid sequence, wherein the nucleic acid sequence encodes an antibody or a functional antibody fragment or probe as described herein, in particular the variable heavy chain region of an antibody, the variable light chain region domain of an antibody, or a functional antibody fragment or probe.

[0326] In a further aspect, the present invention provides an expression vector comprising a polynucleotide encoding an antibody or fragment or probe as described herein. As will be appreciated, a suitable host cell comprising such an expression vector may be provided.

[0327] The present invention further provides a pharmaceutical composition comprising a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof (preferably an antibody or fragment as described and claimed herein), wherein the nucleotide sequence is encapsulated using an mRNA delivery system. Such systems are known in the art. The mRNA delivery system enables the antibody or antibody fragment to be transiently expressed in a target cell, thereby promoting the production of a therapeutic protein in the cell.

[0328] mRNA delivery systems comprising nucleotide sequences encoding monoclonal antibodies or functional antibody fragments (preferably antibodies or fragments as described and claimed herein) include various methods that allow effective delivery to target cells, including lipid-based nanoparticles (LNPs), polymer-based nanoparticles, and viral vectors.

[0329] For example, in the case of LNP, the formulation is usually composed of lipid-based nanoparticles and nucleotide sequences encoding antibodies or antibody fragments, and the nanoparticles are composed of lipids such as phospholipids and cholesterol. The formulation allows the nucleotide sequence to be encapsulated in a lipid bilayer structure, thereby protecting it from degradation and facilitating its delivery to target cells.

[0330] In one embodiment, LNPs can be prepared by combining lipids and nucleotide sequences in an appropriate solvent, followed by a controlled mixing process, such as microfluidics or ultrasonic treatment, to form small and stable nanoparticles. The resulting LNPs can be further optimized to achieve desired characteristics, such as size, stability, and cellular uptake efficiency, by adjusting lipid composition, nucleotide sequence concentration, and other formulation parameters.

[0331] In order to achieve effective delivery, LNP can be administered to a subject via various routes, including intravenous, intramuscular or subcutaneous injection. After administration, LNP enters the target cell by endocytosis, and the encapsulated nucleotide sequence is released into the cytoplasm. Then, the nucleotide sequence is translated into the desired antibody or antibody fragment, which results in transient expression in the target cell.

[0332] The use of LNPs as an mRNA delivery system allows for controlled and transient production of therapeutic antibodies or antibody fragments in a targeted manner. This technology offers advantages such as ease of formulation, high encapsulation efficiency, and calibrated delivery characteristics, making it an effective method for delivering nucleotide sequences encoding antibodies or antibody fragments for therapeutic applications.

[0333] Therefore, the present invention also provides a composition comprising a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof, wherein the antibody or fragment is as described and claimed herein, wherein the nucleotide sequence is encapsulated in an mRNA delivery system, wherein the mRNA delivery system is capable of promoting transient expression of the sTn antibody or antibody fragment in a target cell.

[0334] The mRNA delivery system can be any suitable system, but in preferred aspects, the mRNA delivery system comprises lipid-based nanoparticles, polymer-based nanoparticles or viral vectors. As mentioned above, lipid-based nanoparticles (LNP) are particularly suitable.

[0335] In a further aspect, a method for delivering a monoclonal antibody or a functional antibody fragment thereof (preferably an antibody or fragment as described and claimed herein) to a target cell is provided, the method comprising: a) encapsulating a nucleotide sequence encoding the antibody or antibody fragment in an mRNA delivery system; b) administering the mRNA delivery system to the target cell; c) allowing the mRNA to be taken up by the target cell and expressed, thereby producing the antibody or antibody fragment in the target cell.

[0336] In one aspect, the mRNA delivery system can be further modified with a targeting moiety to enhance specific uptake by target cells expressing sialyl Tn (STn) antigen.

[0337] In a further aspect, a therapeutic composition is also provided, comprising an mRNA delivery system as described herein and a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof (preferably an antibody or fragment as described herein and claimed) that specifically binds to sialyl Tn (STn) antigen, wherein the composition is formulated for administration to a human or animal subject. As should be understood, the therapeutic composition can, for example, further comprise a carrier or excipient suitable for systemic or local administration to a subject.

[0338] In a further aspect, the present invention provides a method for treating cancer characterized by overexpression of sialyl Tn (STn) antigen, the method comprising: a) incorporating a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof that binds to the STn antigen into an mRNA delivery system; b) administering the mRNA delivery system to a subject in need thereof, thereby allowing the antibody or antibody fragment to be expressed in the subject's cells and selectively targeting cancer cells expressing STn. Preferably, the monoclonal antibody or a functional antibody fragment thereof that binds to the STn antigen is an antibody or fragment as described and claimed herein.

[0339] The present invention also provides a therapeutic diagnostic composition comprising an mRNA delivery system comprising a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof (preferably the antibody or fragment as described and claimed herein) that specifically binds to a sialyl Tn (STn) antigen and a detectable label, wherein the composition allows both therapeutic delivery to cancer cells expressing STn and imaging of cancer cells expressing STn.

[0340] In a further aspect, a method for treating cancer in an animal or human characterized by overexpression of a sialyl Tn (STn) antigen is provided, the method comprising administering to a subject in need thereof a therapeutic composition comprising an antibody or fragment thereof, preferably an antibody or fragment as described and claimed herein, thereby selectively targeting and treating cancer cells expressing STn in the animal or human.

[0341] In a further aspect, the present invention also provides a cell therapy composition comprising an sTn antibody, preferably an antibody or fragment thereof as described and claimed herein, for engaging and directing effector cells to a target, wherein the cell therapy includes technologies such as chimeric antigen receptor (CAR) therapy, natural killer (NK) cell therapy, and cell-specific engagers, thereby facilitating targeted recognition and cytotoxicity against cells expressing sTn.

[0342] The present invention also provides for the use of sTn antibodies (preferably antibodies or fragments thereof as described and claimed herein) in cell therapy applications, wherein the sTn antibody sequences are incorporated into effector cells by genetic modification, together with various technologies including CAR-T, NKCAR and cell-specific engagers to achieve specific recognition and enhanced cytotoxicity against target cells expressing sTn antigens.

[0343] Another aspect of the invention provides the use of sTn antibodies (preferably antibodies or fragments thereof as described and claimed herein) for directing effector cells to target cells expressing sTn in cell therapy applications, wherein the cell therapy comprises a range of technologies including but not limited to CAR-T, NK CAR and cell-specific engagers, thereby promoting targeted cytotoxic and immune-mediated responses against cells expressing sTn.

[0344] In a further aspect, there is also provided the use of sTn antibodies (preferably antibodies or fragments thereof as described and claimed herein) in cell therapy applications, wherein the sTn antibodies are used to engage and direct effector cells through various technologies including CAR-T, NK CAR and cell-specific engagers to achieve targeted recognition, activation and cytotoxicity against cells expressing sTn antigens.

[0345] In a still further aspect, there is provided the use of sTn antibodies (preferably antibodies or fragments thereof as described and claimed herein) for achieving targeted recognition and cytotoxicity of effector cells in cell therapy applications, wherein the cell therapy includes a range of technologies such as CAR-T, NK CAR and cell-specific engagers to promote engagement of effector cells with cells expressing sTn and promote immune-mediated responses.

[0346] According to the present invention, the method of producing an antibody or a functional antibody fragment thereof or a probe as described herein may comprise the use of such a suitable host cell.

[0347] The present invention also provides mRNA sequences encoding antibodies targeting sTn antigens, such as those described and claimed herein. The present invention exploits the degeneracy of the genetic code, which allows the design of multiple mRNA sequences encoding the same antibody but optimized for expression in human cells.

[0348] For example, the present invention provides mRNA sequences encoding variable heavy (VH) chains and variable light (VL) chains of anti-sTn antibodies, and some specific examples are given below. Using the standard genetic code and taking into account factors such as codon usage bias, mRNA stability and immunogenicity, an optimized mRNA sequence can be generated for each chain.

[0349] As an illustrative embodiment of the present invention, the amino acid sequences of the VH and VL chains of the anti-sTn antibodies with respect to the following mAb clones are given, for example, in Figures 4 to 6:

[0350] mAb_v1

[0351] mAb_v64

[0352] mAb_v46

[0353] mAb_v48

[0354] The corresponding optimized nucleotide sequence generated using the standard genetic code and taking into account factors such as codon usage bias in humans, mRNA stability and immunogenicity is as follows:

[0355] VH sequence:

[0356] For mAb_v1 and mAb_v48 (and the specified nucleotide SEQ ID NO: 174):CAGGUGCAGCUGCAGGAGAGCGGCCCCGGCCUGGUGAAGCCCAGCCAGACCCUGAGCCUGACCUGCACCGUGAUCGGCUACAGCAUCACCAGCGGCUACUACUGGAACUGGAUCAGGCAGCCCCCCGGCAAGGGCCUGGAGUGGAUCGGCAGCAUCAACUACGACGG CAGCAACAUCUACAACCCCAGCCUGAAGAGCAGGGUGACCAUCAGCAGGGACACCAGCAAGAACCAGUUCAGCCUGAAGCUGAGCAGCGUGACCGCCGCCGACACCGCCGUGUACUACUGCGCCAGGGGCGGCGACUACUGGGGCCAGGGCACCACCGUGACCGUGAGCAGC

[0357] For mAb_v64 (and designated nucleotide SEQ ID NO: 175):

[0358] CAGGUGCAGCUGCAGGAGAGCGGCCCCGGCCUGGUGAAGCCCAGCCAGACCCUGAGCCUGACCUGCACCGUGAUCGGCCAGAGCAUCACCAGCGGCUACUACUGGAACUGGAUCAGGCAGCCCCCCGGCAAGGGCCUGGAGUGGAUCGGCAGCAUCAACUACGACGGCA GCAACAUCUACAACCCCAGCCUGAAGAGCAGGGUGACCAUCAGCAGGGACACCAGCAAGAACCAGUUCAGCCUGAAGCUGAGCAGCGUGACCGCCGCCGACACCGCCGUGUACUACUGCGCCAGGGGCGGCCACCCCUGGGGCCAGGGCACCACCGUGACCGUGAGCAGC

[0359] For mAb_v46 (and the specified nucleotide SEQ ID NO: 176):

[0360] CAGGUGCAGCUGCAGGAGAGCGGCCCCGGCCUGGUGAAGCCCAGCCAGACCCUGAGCCUGACCUGCACCGUGAUCGGCUACAGCAUCACCAGCGGCUACAACUGGAACUGGAUCAGGCAGCCCCCCGGCAAGGGCCUGGAGUGGAUCGGCAGCAUCAACCCCGACGGCAGCAACUUCUACAACCCCAGCCUGAAGAGCAGGGUGACCAUCAGCAGGGACACCAGCAAGAACCAGUUCAGCCUGAAGCUGAGCAGCGUGACCGCCGCCGACACCGCCGUGUACUACUGCGCCAGGGGCGGCGACUACUGGGGCCAGGGCACCACCGUGACCGUGAGCAGC

[0361] VL sequence:

[0362] For mAb_v1 and mAb_v64; mAb_v46 (and the specified nucleotide SEQ ID NO: 177):

[0363] GAGAUCGUGCUGACCCAGAGCCCCGCCACCCUGAGCCUGAGCCCCGGCGAGAGGGCCACCCUGAGCUGCAGCGCCAGCAGCAGCGUGAGCUACAUGCACUGGUUCCAGCAGAAGCCCGGCCAGGCCCCCAGGAGGUGGAUCUACGACACCAGCAAGAGGGCCACCGGCGUGCCCGCCAGGUUCAGCGGCAGCGGCAGCGGCACCGACUACACCCUGACCAUCAGCAGCCUGGAGCCCGAGGACUUCGCCGCCUACUACUGCCAGCAGUGGAGCAGCGACCCCCCCAUGCUGACCUUCGGCGGCGGCACCAAGCUGGAGAUCAAG

[0364] For mAb_v48 (and the specified nucleotide SEQ ID NO: 178):

[0365] GAGAUCGUGCUGACCCAGAGCCCCGCCACCCUGAGCCUGAGCCCCGGCGAGAGGGCCACCCUGAGCUGCAGCGCCAGCAGCACCGUGAGCUACAUGCACUGGUUCCAGCAGAAGCCCGGCCAGGCCCCCAGGAGGUGGAUCUACGACACCAGCAAGAGGGCC ACCGGCGUGCCCGCCAGGUUCAGCGGCAGCGGCAGCGGCACCGACUACACCCUGACCAUCAGCAGCCUGGAGCCCGAGGACUUCGCCGCCUACUACUGCCAGCAGUGGACCGCCGACCCCCCCAUGCUGACCUUCGGCGGCGGCACCAAGCUGGAGAUCAAG

[0366] The above mRNA sequences have been generated using the first codon of each corresponding amino acid according to the standard genetic code. However, it should be noted that there is a considerable degree of degeneracy in the genetic code, which means that most amino acids (except methionine and tryptophan) can be encoded by more than one codon. This feature paves the way for the generation of multiple mRNA sequences for any given amino acid sequence (such as those of the VH and VL chains of an antibody).

[0367] Therefore, as will be appreciated, alternative mRNA sequences encoding the same antibody can be generated using different codon selections. In practice, the generation of these alternative sequences can be guided by considerations such as the codon selection bias in the target organism (in this case, humans), the stability of the resulting mRNA, the degree of immunogenicity, and the effects of translation speed on the folding and post-translational modifications of the protein product.

[0368] In addition, other methods such as machine learning algorithms can be used to optimize nucleotide sequences based on these factors. These optimized sequences can provide advantages with regard to the efficiency of protein production, mRNA stability and the immunogenicity of the end product. Therefore, this degeneracy characteristic of genetic code emphasizes the potential of a large number of sequences within the scope of the present invention, allowing the generation of encoding the same therapeutic antibody but according to the multiple mRNA sequences optimized by different parameters.

[0369] The use of these mRNA sequences for antibody production may present numerous advantages in biomedical applications such as targeted cancer therapy, given its ability to direct the in situ production of antibodies of interest, potentially leading to more effective, personalized treatments.

[0370] Lack of sequence (Liability)

[0371] As part of the present invention, we have also focused on identifying sequence deficiencies (i.e. post-translational modification-PTM-sites) in the CDRs of the humanized V1 and affinity matured clones described herein. We have identified at least one PTM site in the heavy chain and another PTM site in the light chain. In order to remove the deficiencies, it is proposed to introduce a single amino acid change in each PTM, thereby altering the CDRs.

[0372] The highest risk locations have been assessed as:

[0373] In VL:

[0374] CDR3 position 93 / 94 "DP" aspartate fragmentation site

[0375] In VH:

[0376] CDR2 position 53 / 54 "NS" deamidation site.

[0377] This risk appears to be specific to the affinity matured variant mAb-v53.

[0378] CDR2 position 55 / 56 "DG" aspartate isomerization site.

[0379] Thus, in one aspect of the invention, any of the L-CDR3 sequences or VL variable light chain sequences disclosed herein (humanized or affinity matured) may be further mutated to replace the "D" (aspartic acid / aspartate) at position 93 with any of the following amino acid residues:

[0380] A, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y.

[0381] In a further aspect, any of the L-CDR3 sequences or VL variable light chain sequences (humanized or affinity matured) disclosed herein can be further mutated to replace the "P" (proline) at position 94 with any of the following amino acid residues:

[0382] A, E, F, H, I, K, L, N, Q, R, T, V, W or Y.

[0383] One of the changes indicated for position 93 may be paired with any of the changes indicated for position 94 .

[0384] In a preferred aspect, any of the L-CDR3 sequences or VL variable light chain sequences (humanized or affinity matured) disclosed herein can be further mutated to replace the "DP" at positions 93 and 94 with any of the following amino acid residue pairs:

[0385] DA, DK, DN, EP, KP, NP, QP, RP, AA, EE, FF, GP, HH, II, KK, LL, NN, QQ, RR, SP, TT, VV, WW or YY.

[0386] Thus, the VL CDR3 sequence in any of the sequences disclosed herein may be modified in the manner described above. The mutations DA, DK, DN, EP, KP, NP, QP or RP may be preferred.

[0387] Some preferred VL sequences incorporating the above sequences lacking modifications are shown in Figure 20b, which discloses variable light chains based on humanized variants of V1 (v65 to v88). These are shown as sequence ID NOs 150 to 173.

[0388] According to a further aspect of the invention, any of the H-CDR2 sequences or VH variable heavy chain sequences disclosed herein (humanized or affinity matured) may be further mutated to replace the "D" (aspartic acid / aspartate) at position 55 with any of the following amino acid residues:

[0389] A, E, F, G, H, I, K, L, P, Q, R, V, W or Y.

[0390] In a further aspect, any of the H-CDR2 sequences or VH variable heavy chain sequences (humanized or affinity matured) disclosed herein can be further mutated to replace the "G" (glycine) at position 56 with any of the following amino acid residues:

[0391] A, E, F, H, I, K, L, N, Q, R, T, V, W or Y.

[0392] One of the changes indicated for position 55 may be paired with any of the changes indicated for position 56 .

[0393] In a preferred aspect, any of the H-CDR2 sequences or VH variable heavy chain sequences (humanized or affinity matured) disclosed herein can be further mutated to replace the "DG" at positions 55 and 56 with any of the following amino acid residue pairs:

[0394] DE, DK, DA, EG, QG, RG, AA, EE, FF, GG, HH, KK, LL, DN, PQ, QQ, RR, DT, VV, WW or YY.

[0395] Thus, the VH CDR2 sequence in any of the sequences disclosed herein may be modified in the manner described above. The mutations DE, DK, DA, EG, QG or RG may be preferred.

[0396] Some preferred VH sequences incorporating the above sequences lacking modifications are shown in Figure 20a, which discloses the variable heavy chains of humanized variants (v65 to v85) based on V1. These are shown as sequence ID NOs 129 to 149.

[0397] In a preferred aspect, any of the L-CDR3 sequences or VL variable light chain sequences disclosed herein (humanized or affinity matured) containing a mutation replacing "DP" at positions 93 and 94 with any of the following amino acid residues DA, DK, DN, EP, KP, NP, QP, RP, AA, EE, FF, GP, HH, II, KK, LL, NN, QQ, RR, SP, TT, VV, WW or YY can be paired with any of the H-CDR2 sequences or VH variable heavy chain sequences (humanized or affinity matured) disclosed herein and containing a mutation replacing "DG" at positions 55 and 56 with any of the following amino acid residues DE, DK, DA, EG, QG, RG, AA, EE, FF, GG, HH, KK, LL, DN, PQ, QQ, RR, DT, VV, WW or YY.

[0398] In a further aspect of the invention, in the affinity matured variant mAb-v53, it may be advantageous to further mutate the variant to replace the "NS" (asparagine / serine) at positions 53 and 54 of CDR2 in the variable heavy chain with alternative amino acids. For example, N can be replaced with one of A, E, F, G, H, I, K, L, P, Q, R, V, W, or Y, while S remains at position 54. Alternatively, S can be replaced with A, E, F, G, H, I, K, L, P, Q, R, V, W, or Y, while N remains at position 54. Alternatively, both N and S can be changed, such that a combination of the above variations can be used. DETAILED DESCRIPTION

[0399] Materials and methods

[0400] Generally, where applicable, the method for producing an antibody of the present invention may comprise fusion between two cells producing a hybridoma, introducing a nucleotide sequence of the present invention into a host cell, culturing the host cell under appropriate conditions for a sufficient period of time to produce the encoded heavy and / or light chains of the antibody or functional fragment or probe of the present invention, and then purifying the heavy and / or light chains of the antibody or functional fragment or probe thereof.

[0401] The recombinant expression of the antibody or its functional antibody fragment or probe of the present invention that binds to STn or a group of α-2,6 sialylated antigens may include constructing an expression vector containing a nucleotide sequence encoding the heavy chain and / or light chain of the antibody or its functional antibody fragment or probe of the present invention.

[0402] Carrier can be produced by recombinant DNA technology.Such carrier can also include other encoding nucleotide sequences of origin chimeric antibody sequence.For example, they can include the nucleotide sequence of encoding antibody molecule constant region (referring to WO 86 / 05807 and WO 89701036), make it possible to express chimeric protein, this chimeric protein contains the amino acid sequence of antibody of the present invention, its functional antibody fragment or probe, followed by whole heavy chain or light chain or both of antibody.

[0403] The expression vector can be transferred to a host cell by transfection / transduction technology, and the resulting cell produces the antibody of the present invention or its functional antibody fragment. Therefore, the present invention comprises a host cell containing a nucleotide sequence encoding the antibody of the present invention or its functional antibody fragment or probe.

[0404] Host cells may be selected to modify the characteristics of products derived from the inserted nucleotide sequences.

[0405] In one aspect, these host cells can add glycosylation or phosphorylation sites or other modifications to the encoded protein.For example, the host cell can provide for the correct processing and cellular trafficking / secretion of the protein.

[0406] Finally, in order to increase the similarity to antibodies normally produced in humans and attempt to reduce the immunogenic effects, the inventors have provided new and improved useful antibody variants, including humanization of the parent L2A5 antibody, and antibody affinity maturation throughout selected humanized variants, designated by the acronym V1, resulting in the generation of antibody variants with increased binding and affinity to the target STn.

[0407] The obtained antibody clones / variants were characterized with respect to binding to different cancer cell lines, specificity for the target and immunogenicity, as further described below.

[0408] Generally speaking, the methods adopted by the present inventors and the specific processes described are fully understood by those skilled in the art in terms of their technical details.

[0409] Humanization

[0410] Variable domain analysis and CDR identification

[0411] For the purpose of identifying complementarity determining regions (CDRs) and analyzing the closest matching germline sequences, the IMGT Domain Gap Align tool was used: http: / / www.imgt.org / 3Dstructure-DB / cgi / DomainGapAlign.cgi

[0412] Molecular modeling

[0413] Molecular models of the VH and VL domains were constructed using in-house software based on homology to previously published antibody crystal structures. PDB files allow viewing in any molecular visualization software. Images were generated using PyMol.

[0414] Sequence defect analysis

[0415] The antibody sequences were analyzed for lack of specificity based on published protein motifs. The analysis was performed using an in-house system built in Microsoft Excel. The software used the following motif, where X represents any amino acid except proline:

[0416]

[0417] Gene synthesis and cloning

[0418] The variable heavy and variable light domains were designed with appropriate restriction sites at the 5' and 3' ends to enable cloning into the Absolute Antibody cloning and expression vectors. The variable domain sequences were codon optimized for expression in human cells. After gene synthesis, the variable domains were cloned into the appropriate species and type of Absolute Antibody vector. The correct sequence was verified by Sanger sequencing, with DNASTAR Lasergene software used to analyze the raw data. Once confirmed, a plasmid DNA preparation of appropriate size was performed to generate sufficient amounts of high-quality DNA for transfection.

[0419] Expression and purification

[0420] HEK 293 (human embryonic kidney 293) mammalian cells are expanded to the optimal stage for transient transfection. Use heavy chain and light chain expression vector transient transfection cells and cultivate 6 days again. By centrifugal harvesting culture with 4000 rpm, and filter by 0.22 M filter. The first step of purification is carried out by protein A affinity chromatography, wherein using citrate pH 3.0 buffer to carry out wash-out, then use 0.5 M Tris, pH 9.0 to neutralize. Then use desalting column that the eluted protein buffer obtained is exchanged in PBS. Determine antibody concentration by UV spectroscopy, and concentrate antibody as required.

[0421] Antibody analysis

[0422] Antibody purity was determined by SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) and HPLC (high performance liquid chromatography). SEC-HPLC was performed on an Agilent 1100 series instrument using a suitable size exclusion column (SEC). Antibody expression titer was determined by Protein A HPLC.

[0423] Humanized Antibody Characterization

[0424] Different assays were performed to demonstrate whether the humanized variants retained similar biophysical properties (specificity, affinity and internalization) as the parental clone. These assays included:

[0425] Evaluation of binding to BSM mucin (STn carrier) by ELISA

[0426] Evaluation of binding to different STn+ cell lines (flow cytometry)

[0427] NMR studies to understand the interaction of antibodies with STn-serine glycans

[0428] In silico immunogenicity analysis

[0429] Glycan arrays to determine antibody specificity

[0430] Affinity determination by SPR

[0431] TMA to evaluate mAb binding to patient-derived cancer tissues

[0432] Affinity Maturation

[0433] Library generation

[0434] Bioinformatic analysis of the parental antibodies was performed to generate a site-directed CDR-mutation library. After homology modeling of the antibody Fv region and CDR grafting onto the template, CDR residues that may be involved in antigen binding were identified. For the heavy chain, 16 positions were identified, and for the light chain, 14 positions were identified. By analyzing the NGS database, common amino acids for a specific germline were identified. Based on this, degenerate codons were designed to introduce mutations at the identified positions that may be involved in antigen binding. Amino acids with unfavorable characteristics are generally avoided. The introduction of mutations can be described by a Gaussian distribution, with an average of four mutations per antibody chain. Primers were designed based on the degenerate codons and used to introduce mutations into the antibody sequence. The mutated antibody genes were cloned into Yumab's scFv phage display vector, and three libraries were generated and packaged into antibody-phage particles. A total functional diversity of more than 5×10 8 cfu of each library. Antibody clones with functional open reading frames were identified by DNA sequence analysis. Packaging and purification of antibody-phage particles resulted in at least 3 × 10 11 cfu / ml.

[0435] Affinity maturation by in vitro selection

[0436] The generated antibody-phage libraries were used for affinity maturation by in vitro selection. For each individual library, an overall excess of antibody-phage particles equal to the functional size was used. Specific amounts were combined into one library for in vitro selection.

[0437] For the first round of panning, biotinylated BSM is used.The antibody phage output of the first round of panning generated on the biotinylated protein is used for the second round on the STn+ cell of gradually decreasing quantity, to increase stringency and output is driven to the antibody with increase avidity.In these two rounds of panning, negative selection is carried out for several negative antigens.By in vitro selection, four different strategies are used to carry out affinity maturation.By increasing stringency from strategy one to strategy four, the amount of the antibody-phage particle of expected wash-out is gradually reduced.

[0438] Antibody Screening

[0439] The antibody-phage particles washed out after the second round of panning were used to infect Escherichia coli. 384 clones from each strategy were randomly selected for antibody screening. A total of 1536 antibody clones were used to produce monoclonal scFv antibodies in bacterial systems. The antibody clones produced were tested for binding activity to positive and negative cell lines. The control antibody (IgG) and parental scFv antibody provided were used as positive controls. Parental scFv antibody was identified with a signal-to-noise ratio of 20, so clones with a signal-to-noise ratio greater than 20 were identified as hits.

[0440] Antibody Sequencing

[0441] 210 clones were identified as hits and selected for DNA sequence analysis. Sequence analysis revealed 40 uniquely mutated antibodies. These antibodies showed 1-6 mutations in the CDRs. Several hotspot mutations were identified, indicating preferred mutations at different positions.

[0442] In addition, all 40 kinds of uniquely mutated antibodies are selected and soluble scFv is produced. The product is used for ELISA screening of two positive antigens (biotinylated BSM and non-biotinylated BSM) and two negative antigens (streptavidin and BSA). The signal-to-noise ratio between the positive and negative antigens is calculated for analysis. Most antibodies show strong binding to these two positive antigens and no binding to the negative antigen. Based on the results generated, the antibodies are selected for conversion into final form and produced in mammalian cell culture.

[0443] Conversion to final format (human IgG1):

[0444] Based on the results obtained, 20 antibodies were selected for conversion into human IgG1. The antibodies were cloned into Yumab's mammalian expression vector and produced in mammalian cell culture. The antibodies were purified using protein A affinity chromatography and their buffer was exchanged to phosphate buffered saline. Quality control was performed by UV / VIS spectroscopy and reducing SDS-PAGE. 18 antibodies were successfully produced and showed high purity and integrity. In parallel, the parent antibodies were cloned in the same format and produced simultaneously.

[0445] Affinity Ranking

[0446] In order to verify antibody binding, titration was performed on the positive (MDA-MB-231 STn) and negative cell lines (MDA-MB-231WT) provided and also on bovine submaxillary mucin (BSM). Additional titration experiments were performed with cell lines (COLO205, SNU16, OV90) expressing STn naturally. All antibodies showed strong and specific binding to target cells. EC50 values ​​were calculated. The best antibody showed an EC50 value of about 0.6 nM, while the parental antibody was calculated to have a value of 2 nM. The specificity of affinity matured antibody clones was assessed by glycan array.

[0447] result

[0448] Humanized variants

[0449] EC50 ELISA - BSM

[0450] To evaluate the binding of antibodies to the target antigen STn, we employed an in vitro assay using a mucin that naturally expresses STn: bovine submaxillary mucin (BSM). Humanized variants (V1, V2, and V3) were incubated in wells coated with BSM and evaluated for binding using ELISA assays. Absorbance was detected at 450 nm, and normalized EC50 was then calculated, as shown in Figure 8.

[0451] Fig. 8 shows the normalized EC50 using humanized clones V1, V2 and V3. ELISA assay was performed using bovine submaxillary mucin (BSM). 96-well plates were coated with BSM [3ug / mL] dissolved in 1X PBS. Absorbance was detected at 450 nm using a microplate reader. Absorbance values ​​were normalized to background and plotted as % (log scale) of dose response effect relative to antibody dose, as shown in the figure. EC50 (μg / mL) was calculated for each condition. Therefore, on the one hand, the present invention therefore provides humanized antibody clones combined with antigen STn, wherein the EC50 according to the above test is less than 0.5, for example, ranging between 0.05 and 0.5. For example, for V1 clones, the range can be between 0.3238 and 0.4573; for V2 clones, 0.06649 to 0.1365, and for V3 clones, 0.3440 to 0.4490.

[0452] Antibody clone V2 as disclosed herein, wherein the binding affinity measured by BSM ELISA as described herein has 3 times the percentage of dose response effect compared with other mAb clones V1 and V3, thus indicating better binding activity at lower concentrations. Relative EC50 values ​​are included in the legend of Figure 8, and compared with V1 and V3 clones, the EC50 in V2 shows a decrease to one-third. These results collectively indicate that these humanized variants have good binding properties to the target antigen STn.

[0453] Binding to STn+ cell lines

[0454] Fig. 9 shows the result that humanized clone is combined with several STn+ cell lines.In these cell lines, four kinds of cell lines present the STn natural expression of different levels, comprise low (LS174T, OVCAR8), middle (SNU16) and high (OV90), and two kinds of cell lines present the genetic overexpression (PANC1-STn and MDA-MB-231-STn) of STn.Due to the different STn expression levels in those cell lines, compared with those cell lines with low STn expression, lower EC50 (higher combination under lower dosage) is represented in high expression cell line.However, three kinds of mAb variants (V1, V2 and V3) shown in the result display keep the high combination with the different cell lines expressing STn, and this presents the clustering to STn antigen binding overview (profile).

[0455] NMR

[0456] Figure 10 shows how NMR studies can identify points of contact / interaction between antibodies and glycan molecules. Nuclear magnetic resonance (NMR) is used to acquire data in the form of saturation transfer differences (STD) to study the interaction between the ligand STn and mAb in solution. In this experiment, according to the legend to the right of the scheme, humanized variant 6 (V6) was used and it was observed that the antibody mainly binds to the sialic acid portion of STn (larger circle with 100-76% STD), but also interacts with the GalNac portion.

[0457] SPR

[0458] Figure 11 has been summarized the surface plasma resonance (SPR) data for measuring the avidity and kinetic parameters of different anti-STn antibodies.BSA-STn is immobilized to chip, and antibody is injected onto the surface as association phase.The humanized clones (V1, V2 and V3) of test demonstrate the high affinity to BSA-STn, wherein KD scope is 29nM to 39nM.No interaction is detected between CBS-PC clone (people's positive STn control) and BSA-STn.

[0459] Glycan array

[0460] Figure 12 and Figure 19 show that by using a chip with different immobilized polysaccharide probes, the assay can evaluate the binding specificity and binding strength of antibodies to a group of α2-6 sialylated polysaccharides. Figure 12A shows that compared with the "positive control" mAb, when using V1 and V3 clones, a 2-fold increase in the combination of serine and STn. Figure 12B shows how humanized mAb maintains specificity to STn-Ser compared with parent L2A5 mAb (this confirms that the humanization process does not change mAb properties), and presents an increased combination with STn-Thr probes compared with parent L2A5, which emphasizes the improvement in combination with the target. In addition, Figure 19 shows how affinity-matured clones and first-generation humanized clones V1 present an approximately 30-fold increase in the combination with STn-Ser when compared with the CBS-PC control antibody. Finally, a 30-fold increase in binding to STn-Thr was shown in V64 and V25, and a 10-fold increase was shown in V1, V46, and V53, compared to the CBS-PC control antibody. Together, these data emphasize the increased binding affinity of the antibodies of the invention not only via STn-Ser but also via STn-Thr.

[0461] In silico immunogenicity analysis

[0462] Depending on the HLA background and other factors, therapeutic antibodies may be immunogenic, which induces an immune response (human anti-mouse monoclonal antibody response, or HAMA) that can lead to premature elimination or neutralization of the molecule. In order to analyze the humanized CBS variants and predict their overall immunogenicity compared to the chimeric CBS version (as previously disclosed in WO2019147152A1), computer simulation tools were used to analyze the antibody sequences. As shown in Figure 13 AD, the results from this analysis help predict the overall immunogenicity, and we found that it can be used as a guide for further sequence optimization if necessary.

[0463] Figure 13 (AD) shows the VH and VL affinity predictions in V1 and V2 compared to the chimeric / parental L2A5 Ab. The NetMHCIIPan 4.0 tool was used to set the parameters using the position in the protein sequence, % rank EL (percentile rank of the eluted ligand prediction score), BA (binding affinity), SB (strong binder), WB (weak binder). Antibody sequences were uploaded in FASTA format. Affinity values ​​(1 / EC50 × 100) were calculated based on the binding affinity (BA) provided by the tool.

[0464] The results obtained from the analysis of the variable heavy chain (VH) showed that both CBS-V1 and CBS-V2 had a decrease in the number of immunogenic peptides compared to the chimeric CBS (chimeric L2A5) antibody (Figure AB). Finally, the predicted results of the variable light chain (VL) showed that CBS-V1 had a decrease in the number of immunogenic peptides compared to the chimeric CBS (chimeric L2A5) antibody, while CBS-V2 showed an increase in the number of immunogenic peptides compared to the chimeric CBS (chimeric L2A5) antibody (Figure CD).

[0465] Using these in silico predictions, where an overall reduction in immunogenic peptides was seen in humanized clones V1 and V2 compared to the chimeric L2A5 Ab, these results provide evidence that these variants are less immunogenic than the chimeric CBS and are therefore more suitable for further development.

[0466] Internalization assay

[0467] The purpose of this study was to evaluate the internalization kinetics of CBS anti-STn antibodies in a breast cancer cell line (MDA-MB231-STn) that overexpresses STn. To evaluate this feature, we evaluated the internalization assay using humanized Abs clones (V1 and V2) and negative (IgG) and positive (3F1) antibody controls, as shown in Figure 14.

[0468] Figure 14 shows the results from an antibody internalization assay using humanized Ab variants (V1, V2) in the STn-overexpressing breast cancer cell line MDA-MB231. 5 Target cells (MDA-MB-231 STn+) are plated in 96-well plates. Antibody (10 ug / mL) is incubated with target cells for 2h, 6h or 16h (triplicate for each condition), and pHrodo fluorescence is measured by flow cytometry, and human IgG1 [2,59 mg / mL] (Abcam, Lot. GR3218380-20) is used as negative control. Commercially available anti-STn antibody 3F1 [2.57 mg / mL] is used as positive control, and humanized variants V1 and V2 [1mg / mL] are tested in assay. In this assay, antibody is labeled with Zenon pHrodo fluorophore (Invitrogen, Cat.Z25611), which is activated only under the low pH conditions found in early endosomes. pHrodo fluorescence is indirectly assessed by flow cytometry to internalize antibodies. Signal to background ratio (S / B) is calculated by dividing the MFI data from each antibody by background (target cells only) MFI. S / B data are plotted as mean + / - SD for each time point.

[0469] In conclusion, CBS-V1 and CBS-V2 showed a higher internalization profile in MDA-MB-231 STn+ cells when compared to 3F1 mAb. Internalization was time-dependent and showed a near-peak signal at 6 h, which is a moderate to fast internalization kinetics.

[0470] TMA (Tissue Microarray)

[0471] For the Ab binding ability of the newly generated humanized Ab clones of quantitative assessment, we use anti-human STn V1, V2 and V3 Ab to carry out immunohistochemistry (IHC) on TMA slides. In this analysis, the following Ab is tested using different TMA groups as cancer-tumor (40 types, 95 examples) and cancer metastasis (48 examples). Representative IHC images using V1, V2 and V3 and control (without primary antibody and isotype) are shown in Figure 15.

[0472] Figure 15 shows the representative IHC staining of using humanized V1, V2 and V3 antibody clones in colon cancer and different metastatic tissues.Use Leica Bond automated immunostainer and 3 kinds of anti-STn antibodies V1, V2 and V3 (1:50.00) to add negative (no primary antibody control) and human IgG isotype control, in the case of citrate buffer (pH 6.0), the formalin-fixed paraffin-embedded (FFPE) human colon cancer tissue is carried out immunohistochemistry (IHC).Dyeing is visualized in DAB (brown), and hematoxylin is used as nuclear counterstain (blue).Use Panoramic SCAN (3D Histech) to generate full slide images.The scale bar in the figure represents 50um.

[0473] The results obtained using IHC and humanized Abs (V1, V2 and V3) were shown in both colorectal cancer and metastatic tissues, compared to controls (no primary antibody and human isotype), with strong affinity for the target antigen STn. Interestingly, all three human variants of anti-STn showed very similar binding patterns.

[0474] Conclusion - Humanization

[0475] The findings and conclusions that can be drawn from the results obtained include the following:

[0476] Successful generation of humanized clones derived from the parental L2A5

[0477] Variants V1, V2 and V3 have been shown to maintain high binding and specificity for STn

[0478] V1 and V2 are predicted to be less immunogenic than the parental clones

[0479] We have used V1 as the starting point for the affinity maturation process and further results arising therefrom are described as follows

[0480] Affinity matured clones

[0481] result

[0482] EC50 ELISA – BSM

[0483] This was done for affinity matured clones as described above.

[0484] Figure 16 shows the EC50 ELISA results of some clones (selected after affinity maturation process) with point mutations in CDR regions - these clones were screened by ELISA against BSM mucin. The results show that the affinity matured variants have lower EC50 and 0.5-1 fold increase in binding efficacy at lower concentrations compared to the parental V1 clone.

[0485] EC50 cell lines - COLO205, SNU16, OV90, MDA-MB-231-STn

[0486] This was performed for affinity matured clones as described above.

[0487] Figure 17 shows the results of the binding profiles of the novel affinity matured antibody variants in cell lines with different STn expression levels. Each antibody was titrated using a 7-point concentration curve and the binding intensity was measured by flow cytometry using a secondary antibody conjugated to a fluorophore.

[0488] Based on the binding results obtained in MDA-MB-231 STn cells, the EC50 for each antibody was calculated and these are shown in Figure 18. This table summarizes the EC50 obtained for each clone as well as the maximum MFI detected.

[0489] Thus, in one aspect, the present invention therefore provides an affinity matured humanized antibody clone as described herein, which binds to the antigen STn with an EC50 according to the above test of at least 145 ng / mL or less, preferably at least 110 ng / mL or less; more preferably at least 100 ng / mL or less, or at least 80 ng / mL or less.

[0490] Glycan Array-Affinity Matured Clones

[0491] This was performed for affinity matured clones as described above.

[0492] Affinity matured clones were evaluated in glycan arrays with different sialylation probes and the results are shown in Figure 19. Affinity matured clones were found to retain specificity for STn-serine and STn-threonine (probes 3 and 4) while showing only residual binding to the other probes.

[0493] Conclusion - Affinity Maturation

[0494] The findings and conclusions that can be drawn from the results obtained include the following:

[0495] Introduction of point mutations in specific regions of the V1 CDR generates clones with higher binding affinity

[0496] Despite the higher binding affinity, the affinity matured clones were still specific for STn. This was a surprising result.

Claims

1. An antibody or fragment thereof that binds to a sialyl Tn (STn) antigen, wherein the antibody comprises: (a) a heavy chain variable region (VH), wherein the VH comprises a complementarity determining region (CDR) selected from the group consisting of: (i) H-CDR1, H-CDR2 and H-CDR3 as shown in any one of SEQ ID NOs. 1 to 24 or 49 to 88, respectively and / or, (b) a light chain variable region (VL), wherein the VL comprises a complementarity determining region (CDR) selected from the group consisting of: (i) L-CDR1, L-CDR2 and L-CDR3 as shown in any one of SEQ ID NOs. 25 to 48 or 89 to 128, respectively.

2. The antibody or fragment thereof according to claim 1, wherein the antibody comprises a heavy chain variable region (VH) and a light chain variable region (VL).

3. The antibody or fragment thereof according to claim 1 or 2, wherein the antibody comprises one of the following heavy chain CDR and light chain CDR pairs: H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 1 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 25; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 2 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 26; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 3 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 27; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 4 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 28; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 5 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 29; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 6 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 30; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 7 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 31; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 8 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 32; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 9 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 33; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 10 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 34; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 11 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 35; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 12 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 36; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 13 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 37; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 14 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 38; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 15 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 39; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 16 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 40; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 17 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 41; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 18 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 42; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 19 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 43; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 20 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 44; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 21 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 45; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 22 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 46; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 23 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 47; or H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 24 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO.

48.

4. The antibody or fragment thereof according to claim 3, wherein the antibody comprises one of the following heavy chain CDR and light chain CDR pairs: H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 1 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 25; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 3 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 27; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 2 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO.

26.

5. The antibody or fragment thereof according to claim 1 or 2, wherein the antibody comprises one of the following light chain CDR and heavy chain CDR pairs: H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 49 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 89; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 50 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 90; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 51 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 91; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 52 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 92; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 53 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 93; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 54 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 94; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 55 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 95; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 56 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 96; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 57 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 97; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 58 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 98; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 59 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 99; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 60 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 100; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 61 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 101; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 62 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 102; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 63 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 103; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 64 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 104; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 65 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 105; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 66 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 106; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 67 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 107; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 68 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 108; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 69 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 109; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 70 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 110; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 71 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 111; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 72 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 112; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 73 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 113; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 74 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 114; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 75 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 115; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 76 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 116; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 77 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 117; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 78 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 118; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 79 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 119; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 80 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 120; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 81 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 121; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 82 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 122; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 83 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 123; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 84 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 124; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 85 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 125; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 86 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 126; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 87 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 127; or H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 88 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO.

128.

6. The antibody or fragment thereof according to claim 5, wherein the antibody comprises one of the following heavy chain CDR and light chain CDR pairs: H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 49 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 89; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 70 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 110; H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 81 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO. 121; or H-CDR1, H-CDR2 and H-CDR3 as shown in SEQ ID NO. 88 paired with L-CDR1, L-CDR2 and L-CDR3 as shown in SEQ ID NO.

128.

7. The antibody or fragment thereof according to any one of the preceding claims, wherein the antibody comprises: (a) a heavy chain variable region (VH), wherein the VH comprises a humanized heavy chain framework region and / or, (b) a light chain variable region (VL), wherein the VL comprises a humanized light chain framework region.

8. The antibody or fragment thereof according to any one of the preceding claims, wherein the antibody comprises: (a) a heavy chain variable region (VH), wherein the VH comprises a humanized heavy chain framework region as shown in a heavy chain variable region (VH) sequence selected from the group consisting of: (i) any one of SEQ ID NO. 1 to 24 or 49 to 88, respectively and / or, (b) a light chain variable region (VL), wherein the VL comprises a humanized light chain framework region shown in a light chain variable region (VL) sequence selected from the group consisting of: (ii) any one of SEQ ID NOs. 25 to 48 or 89 to 128, respectively.

9. The antibody or fragment thereof of claim 7, wherein the antibody comprises one of the following light chain framework region and heavy chain framework region pairs, wherein the heavy chain framework region is as shown in the heavy chain variable region (VH) sequence shown below, and wherein the light chain framework region is as shown in the light chain variable region (VL) sequence shown below: A heavy chain framework region of SEQ ID NO. 1 paired with a light chain framework region from SEQ ID NO. 25; A heavy chain framework region of SEQ ID NO. 2 paired with a light chain framework region from SEQ ID NO. 26; A heavy chain framework region of SEQ ID NO. 3 paired with a light chain framework region from SEQ ID NO. 27; A heavy chain framework region of SEQ ID NO. 4 paired with a light chain framework region from SEQ ID NO. 28; A heavy chain framework region of SEQ ID NO. 5 paired with a light chain framework region from SEQ ID NO. 29; A heavy chain framework region of SEQ ID NO. 6 paired with a light chain framework region from SEQ ID NO. 30; A heavy chain framework region of SEQ ID NO. 7 paired with a light chain framework region from SEQ ID NO. 31; A heavy chain framework region of SEQ ID NO. 8 paired with a light chain framework region from SEQ ID NO. 32; A heavy chain framework region of SEQ ID NO. 9 paired with a light chain framework region from SEQ ID NO. 33; A heavy chain framework region of SEQ ID NO. 10 paired with a light chain framework region from SEQ ID NO. 34; A heavy chain framework region of SEQ ID NO. 11 paired with a light chain framework region from SEQ ID NO. 35; A heavy chain framework region of SEQ ID NO. 12 paired with a light chain framework region from SEQ ID NO. 36; A heavy chain framework region of SEQ ID NO. 13 paired with a light chain framework region from SEQ ID NO. 37; A heavy chain framework region of SEQ ID NO. 14 paired with a light chain framework region from SEQ ID NO. 38; A heavy chain framework region of SEQ ID NO. 15 paired with a light chain framework region from SEQ ID NO. 39; A heavy chain framework region of SEQ ID NO. 16 paired with a light chain framework region from SEQ ID NO. 40; A heavy chain framework region of SEQ ID NO. 17 paired with a light chain framework region from SEQ ID NO. 41; A heavy chain framework region of SEQ ID NO. 18 paired with a light chain framework region from SEQ ID NO. 42; A heavy chain framework region of SEQ ID NO. 19 paired with a light chain framework region from SEQ ID NO. 43; A heavy chain framework region of SEQ ID NO. 20 paired with a light chain framework region from SEQ ID NO. 44; A heavy chain framework region of SEQ ID NO. 21 paired with a light chain framework region from SEQ ID NO. 45; A heavy chain framework region of SEQ ID NO. 22 paired with a light chain framework region from SEQ ID NO. 46; A heavy chain framework region of SEQ ID NO. 23 paired with a light chain framework region from SEQ ID NO. 47; or The heavy chain framework region of SEQ ID NO. 24 is paired with the light chain framework region from SEQ ID NO.

48.

10. The antibody or fragment thereof of claim 7, wherein the antibody comprises one of the following light chain framework region and heavy chain framework region pairs, wherein the heavy chain framework region is as shown in the heavy chain variable region (VH) sequence shown below, and wherein the light chain framework region is as shown in the light chain variable region (VL) sequence shown below: A heavy chain framework region of SEQ ID NO. 49 paired with a light chain framework region from SEQ ID NO. 89; A heavy chain framework region of SEQ ID NO. 50 paired with a light chain framework region from SEQ ID NO. 90; A heavy chain framework region of SEQ ID NO. 51 paired with a light chain framework region from SEQ ID NO. 91; A heavy chain framework region of SEQ ID NO. 52 paired with a light chain framework region from SEQ ID NO. 92; A heavy chain framework region of SEQ ID NO. 53 paired with a light chain framework region from SEQ ID NO. 93; A heavy chain framework region of SEQ ID NO. 54 paired with a light chain framework region from SEQ ID NO. 94; A heavy chain framework region of SEQ ID NO. 55 paired with a light chain framework region from SEQ ID NO. 95; A heavy chain framework region of SEQ ID NO. 56 paired with a light chain framework region from SEQ ID NO. 96; A heavy chain framework region of SEQ ID NO. 57 paired with a light chain framework region from SEQ ID NO. 97; A heavy chain framework region of SEQ ID NO. 58 paired with a light chain framework region from SEQ ID NO. 98; A heavy chain framework region of SEQ ID NO. 59 paired with a light chain framework region from SEQ ID NO. 99; A heavy chain framework region of SEQ ID NO. 60 paired with a light chain framework region from SEQ ID NO. 100; A heavy chain framework region of SEQ ID NO. 61 paired with a light chain framework region from SEQ ID NO. 101; A heavy chain framework region of SEQ ID NO. 62 paired with a light chain framework region from SEQ ID NO. 102; A heavy chain framework region of SEQ ID NO. 63 paired with a light chain framework region from SEQ ID NO. 103; A heavy chain framework region of SEQ ID NO. 64 paired with a light chain framework region from SEQ ID NO. 104; A heavy chain framework region of SEQ ID NO. 65 paired with a light chain framework region from SEQ ID NO. 105; A heavy chain framework region of SEQ ID NO. 66 paired with a light chain framework region from SEQ ID NO. 106; A heavy chain framework region of SEQ ID NO. 67 paired with a light chain framework region from SEQ ID NO. 107; A heavy chain framework region of SEQ ID NO. 68 paired with a light chain framework region from SEQ ID NO. 108; A heavy chain framework region of SEQ ID NO. 69 paired with a light chain framework region from SEQ ID NO. 109; A heavy chain framework region of SEQ ID NO. 70 paired with a light chain framework region from SEQ ID NO. 110; A heavy chain framework region of SEQ ID NO. 71 paired with a light chain framework region from SEQ ID NO. 111; A heavy chain framework region of SEQ ID NO. 72 paired with a light chain framework region from SEQ ID NO. 112; A heavy chain framework region of SEQ ID NO. 73 paired with a light chain framework region from SEQ ID NO. 113; A heavy chain framework region of SEQ ID NO. 74 paired with a light chain framework region from SEQ ID NO. 114; A heavy chain framework region of SEQ ID NO. 75 paired with a light chain framework region from SEQ ID NO. 115; A heavy chain framework region of SEQ ID NO. 76 paired with a light chain framework region from SEQ ID NO. 116; A heavy chain framework region of SEQ ID NO. 77 paired with a light chain framework region from SEQ ID NO. 117; A heavy chain framework region of SEQ ID NO. 78 paired with a light chain framework region from SEQ ID NO. 118; A heavy chain framework region of SEQ ID NO. 79 paired with a light chain framework region from SEQ ID NO. 119; A heavy chain framework region of SEQ ID NO. 80 paired with a light chain framework region from SEQ ID NO. 120; A heavy chain framework region of SEQ ID NO. 81 paired with a light chain framework region from SEQ ID NO. 121; A heavy chain framework region of SEQ ID NO. 82 paired with a light chain framework region from SEQ ID NO. 122; A heavy chain framework region of SEQ ID NO. 83 paired with a light chain framework region from SEQ ID NO. 123; A heavy chain framework region of SEQ ID NO. 84 paired with a light chain framework region from SEQ ID NO. 124; A heavy chain framework region of SEQ ID NO. 85 paired with a light chain framework region from SEQ ID NO. 125; A heavy chain framework region of SEQ ID NO. 86 paired with a light chain framework region from SEQ ID NO. 126; A heavy chain framework region of SEQ ID NO. 87 paired with a light chain framework region from SEQ ID NO. 127; or The heavy chain framework region of SEQ ID NO. 88 is paired with the light chain framework region from SEQ ID NO.

128.

11. The antibody or fragment thereof according to any one of claims 7 to 10, wherein the heavy chain framework region and / or the light chain framework region have 80% sequence identity with the recited sequence.

12. The antibody or fragment thereof according to any one of claims 7 to 11, wherein the heavy chain framework region and / or the light chain framework region have 90% sequence identity with the recited sequence.

13. The antibody or fragment thereof according to any one of the preceding claims, wherein the antibody comprises: (a) a heavy chain variable region (VH) selected from the group consisting of: (i) any one of SEQ ID NO. 1 to 24 or 49 to 88, respectively and / or, (a) a light chain variable region (VL) selected from the group consisting of: (ii) any one of SEQ ID NOs. 25 to 48 or 89 to 128, respectively.

14. The antibody or fragment thereof according to claim 13, wherein the antibody comprises one of the following heavy chain variable region (VH) and light chain variable region (VL) pairs: SEQ ID NO. 1 paired with SEQ ID NO. 25; SEQ ID NO. 2 paired with SEQ ID NO. 26; SEQ ID NO. 3 paired with SEQ ID NO. 27; SEQ ID NO. 4 paired with SEQ ID NO. 28; SEQ ID NO. 5 paired with SEQ ID NO. 29; SEQ ID NO. 6 paired with SEQ ID NO. 30; SEQ ID NO. 7 paired with SEQ ID NO. 31; SEQ ID NO. 8 paired with SEQ ID NO. 32; SEQ ID NO. 9 paired with SEQ ID NO. 33; SEQ ID NO. 10 paired with SEQ ID NO. 34; SEQ ID NO. 11 paired with SEQ ID NO. 35; SEQ ID NO. 12 paired with SEQ ID NO. 36; SEQ ID NO. 13 paired with SEQ ID NO. 37; SEQ ID NO. 14 paired with SEQ ID NO. 38; SEQ ID NO. 15 paired with SEQ ID NO. 39; SEQ ID NO. 16 paired with SEQ ID NO. 40; SEQ ID NO. 17 paired with SEQ ID NO. 41; SEQ ID NO. 18 paired with SEQ ID NO. 42; SEQ ID NO. 19 paired with SEQ ID NO. 43; SEQ ID NO. 20 paired with SEQ ID NO. 44; SEQ ID NO. 21 paired with SEQ ID NO. 45; SEQ ID NO. 22 paired with SEQ ID NO. 46; SEQ ID NO. 23 paired with SEQ ID NO. 47; or SEQ ID NO. 24 paired with SEQ ID NO.

48.

15. The antibody or fragment thereof according to claim 13, wherein the antibody comprises one of the following heavy chain variable region (VH) and light chain variable region (VL) pairs: SEQ ID NO. 49 paired with SEQ ID NO. 89; SEQ ID NO. 50 paired with SEQ ID NO. 90; SEQ ID NO. 51 paired with SEQ ID NO. 91; SEQ ID NO. 52 paired with SEQ ID NO. 92; SEQ ID NO. 53 paired with SEQ ID NO. 93; SEQ ID NO. 54 paired with SEQ ID NO. 94; SEQ ID NO. 55 paired with SEQ ID NO. 95; SEQ ID NO. 56 paired with SEQ ID NO. 96; SEQ ID NO. 57 paired with SEQ ID NO. 97; SEQ ID NO. 58 paired with SEQ ID NO. 98; SEQ ID NO. 59 paired with SEQ ID NO. 99; SEQ ID NO. 60 paired with SEQ ID NO. 100; SEQ ID NO. 61 paired with SEQ ID NO. 101; SEQ ID NO. 62 paired with SEQ ID NO. 102; SEQ ID NO. 63 paired with SEQ ID NO. 103; SEQ ID NO. 64 paired with SEQ ID NO. 104; SEQ ID NO. 65 paired with SEQ ID NO. 105; SEQ ID NO. 66 paired with SEQ ID NO. 106; SEQ ID NO. 67 paired with SEQ ID NO. 107; SEQ ID NO. 68 paired with SEQ ID NO. 108; SEQ ID NO. 69 paired with SEQ ID NO. 109; SEQ ID NO. 70 paired with SEQ ID NO. 110; SEQ ID NO. 71 paired with SEQ ID NO. 111; SEQ ID NO. 72 paired with SEQ ID NO. 112; SEQ ID NO. 73 paired with SEQ ID NO. 113; SEQ ID NO. 74 paired with SEQ ID NO. 114; SEQ ID NO. 75 paired with SEQ ID NO. 115; SEQ ID NO. 76 paired with SEQ ID NO. 116; SEQ ID NO. 77 paired with SEQ ID NO. 117; SEQ ID NO. 78 paired with SEQ ID NO. 118; SEQ ID NO. 79 paired with SEQ ID NO. 119; SEQ ID NO. 80 paired with SEQ ID NO. 120; SEQ ID NO. 81 paired with SEQ ID NO. 121; SEQ ID NO. 82 paired with SEQ ID NO. 122; SEQ ID NO. 83 paired with SEQ ID NO. 123; SEQ ID NO. 84 paired with SEQ ID NO. 124; SEQ ID NO. 85 paired with SEQ ID NO. 125; SEQ ID NO. 86 paired with SEQ ID NO. 126; SEQ ID NO. 87 paired with SEQ ID NO. 127; or SEQ ID NO. 88 paired with SEQ ID NO.

128.

16. The antibody or fragment thereof according to any one of the preceding claims, wherein L-CDR3 is further mutated to replace D (aspartic acid / aspartate) at position 93 with any one of the following amino acid residues: A, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y.

17. The antibody or fragment thereof according to any one of the preceding claims, wherein L-CDR3 is further mutated to replace P (proline) at position 94 with any one of the following amino acid residues: A, E, F, H, I, K, L, N, Q, R, T, V, W or Y.

18. The antibody or fragment thereof according to claim 16, wherein any of the mutations indicated for position 93 is paired with any of the mutations indicated for position 94 in claim 17.

19. The antibody or fragment thereof according to claim 16, 17 or 18, wherein L-CDR3 is further mutated to replace the DP at positions 93 and 94 with any one of the following amino acid residue pairs: DA, DK, DN, EP, KP, NP, QP, RP, AA, EE, FF, GP, HH, II, KK, LL, NN, QQ, RR, SP, TT, VV, WW or YY. 20 . The antibody or fragment thereof according to claim 16 , wherein the light chain variable sequence VL is as shown in any one of sequence ID NOs 150 to 173.

21. The antibody or fragment thereof according to any one of the preceding claims, wherein H-CDR2 is further mutated to replace D (aspartic acid / aspartate) at position 55 with any one of the following amino acid residues: A, E, F, G, H, I, K, L, P, Q, R, V, W or Y.

22. The antibody or fragment thereof according to any one of the preceding claims, wherein H-CDR2 is further mutated to replace the G (glycine) at position 56 with any one of the following amino acid residues: A, E, F, H, I, K, L, N, Q, R, T, V, W or Y.

23. The antibody or fragment thereof of claim 21, wherein any of the mutations indicated for position 55 is paired with any of the mutations indicated for position 56 in claim 22.

24. The antibody or fragment thereof according to claim 21, 22 or 23, wherein H-CDR2 is further mutated to replace DG at positions 55 and 56 with any one of the following amino acid residue pairs: DE, DK, DA, EG, QG, RG, AA, EE, FF, GG, HH, KK, LL, DN, PQ, QQ, RR, DT, VV, WW or YY.

25. The antibody or fragment thereof according to any one of claims 21 to 24, wherein the heavy chain variable sequence VH is as shown in any one of sequence ID NOs 129 to 149.

26. The antibody or fragment thereof according to any one of claims 16 to 25, wherein L-CDR3 is further mutated to replace "DP" at positions 93 and 94 with any one of the following amino acid residue pairs: DA, DK, DN, EP, KP, NP, QP, RP, AA, EE, FF, GP, HH, II, KK, LL, NN, QQ, RR, SP, TT, VV, WW or YY; and wherein H-CDR2 is further mutated to replace DG at positions 55 and 56 with any one of the following amino acid residue pairs: DE, DK, DA, EG, QG, RG, AA, EE, FF, GG, HH, KK, LL, DN, PQ, QQ, RR, DT, VV, WW or YY.

27. The antibody or fragment thereof according to any one of claims 16 to 26, wherein L-CDR3 is further mutated to replace "DP" at positions 93 and 94 with any one of the following amino acid residue pairs: DA, DK, DN, EP, KP, NP, QP or RP; and wherein H-CDR2 is further mutated to replace DG at positions 55 and 56 with any one of the following amino acid residue pairs: DE, DK, DA, EG, QG or RG.

28. The antibody or fragment thereof according to any one of claims 13 to 27, wherein the heavy chain variable region (VH) and / or the light chain variable region (VL) have 80% sequence identity with the recited sequence.

29. The antibody or fragment thereof according to claim 28, wherein the heavy chain variable region (VH) and / or the light chain variable region (VL) have 90% sequence identity with the recited sequence.

30. The antibody or fragment thereof according to any one of the preceding claims, which binds to STn and a group of glycans terminated with α2,6-linked sialic acid.

31. The antibody or fragment thereof of claim 30, wherein the α 2,6-linked sialic acid-terminated polysaccharide comprises STn, 2,6-sialic acid T, disialyl T, or 2,6-sialyllactosamine.

32. An antibody or fragment thereof according to any one of the preceding claims, which has undergone glycan changes at glycosylation sites.

33. An antibody or fragment thereof according to any one of the preceding claims, in the form of a ScFv (single chain variable fragment), a monoclonal antibody, a chimeric antibody, a humanized antibody, a bispecific or multispecific antibody, an antibody drug conjugate (ADC) or a cell therapy.

34. The antibody or fragment thereof according to any one of the preceding claims, which is a functional antibody fragment thereof or a probe thereof, wherein the antibody or fragment thereof binds to STn and a group of glycans terminated with α2,6-linked sialic acid.

35. A cell therapy composition comprising an antibody according to any one of the preceding claims for engaging and directing effector cells to a target, wherein the cell therapy includes technologies such as chimeric antigen receptor (CAR) therapy, natural killer (NK) cell therapy, and cell-specific engagers to promote targeted recognition and cytotoxicity against cells expressing sTn.

36. Use of an antibody according to any one of claims 1 to 34 in cell therapy applications, wherein the antibody is a sTn antibody, wherein the sTn antibody sequence is incorporated into effector cells by genetic modification, together with various technologies including CAR-T, NK CAR and cell-specific engagers to achieve specific recognition and enhanced cytotoxicity against target cells expressing sTn antigens.

37. Use of an antibody according to any one of claims 1 to 34 for directing effector cells to target cells expressing sTn in cell therapy applications, wherein the antibody is a sTn antibody, wherein the cell therapy includes a range of technologies including but not limited to CAR-T, NK CAR and cell-specific engagers, thereby promoting targeted cytotoxic and immune-mediated responses against cells expressing sTn.

38. Use of an antibody according to any one of claims 1 to 34 in cell therapy applications, wherein the antibody is a sTn antibody, wherein the sTn antibody is used to engage and direct effector cells through various technologies including CAR-T, NK CAR and cell-specific engagers to achieve targeted recognition, activation and cytotoxicity against cells expressing the sTn antigen.

39. Use of an antibody according to any one of claims 1 to 34 for achieving targeted recognition and cytotoxicity of effector cells in cell therapy applications, wherein the antibody is a sTn antibody, wherein the cell therapy includes a range of technologies such as CAR-T, NKCAR and cell-specific engagers to promote the engagement of effector cells with cells expressing sTn and promote immune-mediated responses.

40. An antibody drug conjugate (ADC) comprising the antibody according to any one of the preceding claims, a linker and a cytotoxic drug.

41. A pharmaceutical composition comprising the antibody or fragment thereof according to any one of claims 1 to 34, or the antibody drug conjugate (ADC) according to claim 40, and a pharmaceutically acceptable carrier.

42. A method of detecting a tumor in a subject using the antibody or fragment thereof according to any one of claims 1 to 34, or the antibody drug conjugate (ADC) according to claim 40, or the pharmaceutical composition according to claim 41, the method comprising: A biological sample obtained from a subject is stained with a nucleotide sequence encoding an antibody according to any one of claims 1 to 34 or an antibody drug conjugate (ADC) according to claim 40 under conditions suitable for specific binding of the antibody, wherein the presence or absence of binding of the sequence indicates the presence or absence of tumor cells expressing cell surface STn, 2,6-sialylo T, disialyl T or 2,6-sialyllactosamine, optionally wherein the biological sample comprises isolated cells or tissues or tumor-derived proteins.

43. The antibody or fragment thereof according to any one of claims 1 to 34, or the antibody drug conjugate (ADC) according to claim 40, or the pharmaceutical composition according to claim 41, for use in medicine.

44. The antibody or fragment thereof according to any one of claims 1 to 34, or the antibody drug conjugate (ADC) according to claim 40, or the pharmaceutical composition according to claim 41, for use in treating cancer.

45. A composition comprising a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof, wherein the antibody or fragment is as described in any one of claims 1 to 34, wherein the nucleotide sequence is encapsulated in an mRNA delivery system, wherein the mRNA delivery system is capable of promoting transient expression of the sTn antibody or antibody fragment in a target cell.

46. ​​The composition of claim 45, wherein the mRNA delivery system comprises a lipid-based nanoparticle, a polymer-based nanoparticle, or a viral vector.

47. A method for delivering a monoclonal antibody or a functional antibody fragment thereof to a target cell, wherein the antibody or fragment is as described in any one of claims 1 to 34, the method comprising: a) encapsulating a nucleotide sequence encoding the antibody or antibody fragment in an mRNA delivery system; b) administering the mRNA delivery system to the target cell; c) allowing the mRNA to be taken up by the target cell and expressed, thereby producing the antibody or antibody fragment in the target cell.

48. The method of claim 47, wherein the mRNA delivery system is further modified with a targeting moiety to enhance specific uptake by target cells expressing the sialyl Tn (STn) antigen.

49. A therapeutic composition comprising an mRNA delivery system as described in claim 46 and a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof that specifically binds to the sialyl Tn (STn) antigen, wherein the composition is formulated for administration to a subject.

50. The therapeutic composition of claim 49, further comprising a carrier or excipient suitable for systemic or local administration to the subject.

51. A method for treating a cancer characterized by overexpression of a sialyl Tn (STn) antigen, the method comprising: a) incorporating a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof that binds to an STn antigen into an mRNA delivery system; b) administering the mRNA delivery system to a subject in need thereof, thereby allowing the antibody or antibody fragment to be expressed within the cells of the subject and selectively target cancer cells expressing STn.

52. The therapeutic composition of claim 49 or 50, or the method of claim 51, wherein the monoclonal antibody or functional antibody fragment thereof comprises an antibody or fragment thereof according to any one of claims 1 to 34.

53. Therapeutic diagnostic compositions, comprising an mRNA delivery system, the mRNA delivery system comprising a nucleotide sequence and a detectable label, the nucleotide sequence encoding a monoclonal antibody or its functional antibody fragment according to any one of claims 1 to 34 that specifically binds to a sialyl Tn (STn) antigen, wherein the compositions allow for both therapeutic delivery of cancer cells expressing STn and imaging of cancer cells expressing STn.

54. A method for treating a cancer characterized by overexpression of a sialyl Tn (STn) antigen in an animal or human, the method comprising administering to a subject in need thereof a therapeutic composition comprising an antibody or fragment thereof according to any one of claims 1 to 34, thereby selectively targeting and treating cancer cells expressing STn in the animal or human.

55. An expression vector comprising a polynucleotide encoding the antibody according to any one of claims 1 to 34.

56. A host cell comprising the expression vector according to claim 55.

57. A method of producing an antibody or fragment thereof according to any one of claims 1 to 5, the method comprising using a host cell according to claim 56.

58. A polynucleotide sequence encoding an antibody or a functional antibody fragment thereof, wherein the antibody or fragment thereof is as claimed in any one of claims 1 to 34.

59. The polynucleotide sequence of claim 58, comprising mRNA.

60. An mRNA delivery system comprising a polynucleotide according to claim 58 or 59.

Images