Fermented mucus lactobacillus, intestinal motility-promoting probiotic preparation and preparation method thereof

Abstract

The present invention provides a fermented Lactobacillus fermentum IG50, which has a CGMCC accession number of 32111. The fermented Lactobacillus fermentum provided by the present invention can ferment Magnolia officinalis to produce a motilin receptor agonist. The present invention also provides a probiotic preparation that helps improve intestinal motility. The present invention also provides a method for preparing the probiotic preparation. The preparation method of the probiotic preparation is simple and can be produced on a large scale.

Description

Technical Field

[0001] The present invention belongs to the field of probiotic fermentation, and in particular relates to a fermented Lactobacillus mucinus and a fermentation product thereof, including a probiotic preparation for promoting intestinal peristalsis of the fermented Lactobacillus mucinus and a preparation method thereof. Background Art

[0002] Probiotics include bacteria and fungi, but the most commonly used probiotics belong to the Lactobacillus and Bifidobacterium groups. Additionally, members of other bacterial genera, such as Streptococcus, Enterococcus, and Bacillus, as well as members of the yeast genus Saccharomyces, can possess probiotic properties. The most common probiotics include: Lactobacillus acidophilus, Lactobacillus johnsonii, Lactobacillus gasseri, Lactobacillus casei, Lactobacillus rhamnosus, Lactobacillus plantarum, Bifidobacterium longum, Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium longum subsp. infantis. Some bacteria that are less commonly found in the gastrointestinal tract, such as Lactobacillus bulgaricus, Streptococcus thermophilus, and Lactococcus, also belong to the probiotic group.

[0003] Among the aforementioned probiotics, intestinal probiotics can colonize the intestines, combat harmful bacteria, and maintain a balanced intestinal flora. They can also regulate the body's immune function by enhancing the intestinal mucosal barrier, inhibiting the growth and adhesion of pathogenic bacteria, regulating immune cell activity, and promoting the production of immune factors. Furthermore, intestinal probiotics can also promote intestinal motility.

[0004] Slow bowel movements refer to slowed peristalsis, or the movement of food and waste through the intestines. Common symptoms include:

[0005] 1. Constipation: Slow intestinal motility can cause food to stay in the intestines for too long, making it difficult to defecate.

[0006] 2. Abdominal bloating and pain: This can prolong food digestion and produce excess gas and fluid in the intestines, leading to bloating and pain. Bloating often worsens after meals, while abdominal pain can be intermittent or persistent.

[0007] 3. Indigestion: Because food stays in the intestines for too long, the absorption of nutrients by the intestines may be affected, leading to indigestion. Indigestion can manifest as stomach discomfort, hiccups, belching, and nausea.

[0008] 4. Nausea and vomiting: It may cause slower gastric emptying, leading to nausea and vomiting. Nausea and vomiting usually occur after eating, and food staying in the stomach for too long may cause nausea.

[0009] 5. Loss of appetite and weight loss: Slow intestinal motility causes food to stay in the intestines for a long time after eating, which may reduce appetite and lead to weight loss.

[0010] Slow intestinal motility may also cause other symptoms, such as fatigue, anxiety, depression, heartburn, chest tightness, acid reflux, etc.

[0011] All of these will lead to a decline in the patient's quality of life.

[0012] On the other hand, common Chinese herbal medicines, such as Magnolia officinalis, are believed to have the function of promoting intestinal motility. Therefore, screening out substances that can ferment Magnolia officinalis and obtain the function of promoting intestinal motility has become a direction for solving the problem.

[0013] Most commercially available probiotics are obtained from food, while those obtained from human feces (human-derived probiotics) account for a relatively small proportion. However, after being screened and acclimated to the human gastrointestinal environment, human-derived probiotics are more likely to colonize in the human intestine, thereby exerting greater probiotic benefits. In particular, human-derived probiotics have a high survival rate and are safer. The fermentation of traditional Chinese medicines by selected human-derived probiotics more closely resembles that of probiotics in the human body, making them safer.

[0014] The fermented mucus Lactobacillus disclosed in the Chinese invention application with publication number CN116751716A is a natural strain with high food safety. It has significant inhibitory activity against both α-amylase and α-glucosidase, is resistant to saliva, gastric acid, and bile salts, and has good intestinal colonization ability. It also has good cholesterol degradation ability and has important application value in the fields of food, health products, etc.

[0015] Chinese invention application publication number CN117099962A discloses the use of fermented Lactobacillus mucilaginosus in the preparation of foods that improve zinc deficiency. The authors found that fermented Lactobacillus mucilaginosus LFPerfectus001 inhibits the decrease in blood zinc levels caused by zinc deficiency and increases hair zinc and immunoglobulin G (IgG) levels. This effectively improves anorexia, weight loss, and liver damage caused by zinc deficiency, providing a new use for fermented Lactobacillus mucilaginosus LFPerfectus001. Combined with drug sensitivity testing, hemolytic activity testing, mouse pathogenicity phenotypic testing, and virulence and resistance gene analysis, fermented Lactobacillus mucilaginosus LFPerfectus001 was demonstrated to be a safe strain from multiple perspectives.

[0016] However, none of the above prior arts involve the problem of accelerating intestinal peristalsis. Summary of the Invention

[0017] The first object of the present invention is to provide a fermentative Lactobacillus mucilaginosus that can ferment Magnolia officinalis and promote intestinal peristalsis.

[0018] The second object of the present invention is to provide a fermentation product obtained by fermenting Magnolia officinalis with Lactobacillus mucilaginosus.

[0019] The third object of the present invention is to provide a probiotic preparation comprising fermented Lactobacillus mucilaginosus.

[0020] The fourth object of the present invention is to provide a method for preparing a probiotic preparation.

[0021] The present invention is achieved through the following technical solutions.

[0022] A strain of Lactobacillus fermentum IG50, whose Latin name is Limosilactobacillus fermentum. This strain has the accession number CGMCC No. 32111. This strain was deposited with the General Microbiology Center of the China Culture Collection Administration on September 29, 2024. The depository code is CGMCC. The depository address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101, and the accession number is CGMCC32111. This strain was alive at the time of deposit.

[0023] A fermentation product obtained by fermenting a Magnolia bark extract with Lactobacillus mucilaginosus IG50, wherein the fermentation product comprises a motilin receptor agonist;

[0024] The structure of the motilin receptor agonist is as follows:

[0025]

[0026] A probiotic preparation comprises fermented Lactobacillus mucilaginosus IG50 and a fermentation product obtained by fermenting a magnolia bark extract with fermented Lactobacillus mucilaginosus IG50.

[0027] The probiotic preparation also includes a freeze-drying protectant.

[0028] The freeze-drying protective agent comprises 2-4% skim milk powder, 1.5-1.8% soy protein isolate, 1.5-2.5% casein, 1.5-3.5% whey protein, 3-4% L-cysteine, 1-5% oligofructose, 2-3% trehalose, 0.6-2.5% calcium alginate and the balance is water.

[0029] The preparation method of the probiotic preparation comprises the steps of fermenting and culturing the probiotics to obtain bacterial mud, mixing the bacterial mud with a freeze-drying protective agent, and then freeze-drying.

[0030] The culture medium used in the fermentation culture includes the following components in percentage by weight:

[0031] Yeast extract powder 0.3-0.8%, beef extract powder 0.4-0.8%, peptone 0.7-0.9%, diammonium hydrogen citrate 0.1-0.2%, dipotassium hydrogen phosphate 0.1-0.3%, anhydrous magnesium sulfate 0.01-0.03%, Tween 80 0.05-0.15%, glucose 0.5-2.5%, maltodextrin 1.0-1.5%, galacto-oligosaccharide 0.5-0.8%, magnolia bark extract 0.3-0.5%, and water as the balance. The preparation method of the magnolia bark extract is as follows:

[0032] The Magnolia officinalis is extracted and crushed to obtain powder, and the powder is subjected to supercritical CO2 extraction to obtain the product.

[0033] The entrainer used in the supercritical CO2 extraction includes acetone;

[0034] The material-liquid ratio of the entrainer to the powder is 1:0.08 g / mL.

[0035] The supercritical CO2 extraction uses a CO2 flow rate of 18-30 L / h;

[0036] The supercritical CO2 extraction adopts an extraction pressure of 2-4 MPa;

[0037] The extraction temperature used in the supercritical CO2 extraction is 40-50°C;

[0038] The extraction time of the supercritical CO2 extraction is 3-5h.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] The fermented mucus lactobacillus provided by the invention can ferment magnolia bark and obtain a motilin receptor agonist.

[0041] The probiotic preparation provided by the present invention is helpful to improve intestinal motility.

[0042] The preparation method of the probiotic preparation provided by the present invention is simple and can be produced on a large scale. DETAILED DESCRIPTION

[0043] The embodiments of the present invention will be described in detail below with reference to the examples, but those skilled in the art will appreciate that the following examples are intended only to illustrate the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the methods were performed according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0044] Since Magnolia officinalis is mainly absorbed by the human body after fermentation by intestinal probiotics when used as a traditional Chinese medicine, the present invention is expected to screen out probiotics that can ferment Magnolia officinalis from the human intestinal tract and isolate beneficial compounds from the fermentation product. The intestinal flora of newborn babies is relatively simple, with probiotic flora accounting for the vast majority, and without the use of antibiotics, the activity of probiotics is very high. Therefore, the success rate of screening and isolating bacteria with target functions from the feces of newborn babies is relatively high.

[0045] The specific extraction process of Magnolia officinalis extract is as follows: the bark of Magnolia officinalis is crushed into a powder of 10-55 mesh, and then the powder is placed in a supercritical CO2 extraction kettle. Acetone is used as an entrainer, and acetone is added according to the material-liquid ratio of acetone to Magnolia officinalis of 1:0.08 g / mL. Magnolia officinalis is subjected to supercritical CO2 extraction, and the CO2 flow rate is controlled at 18-30 L / h, the extraction pressure is 2-4 MPa, the extraction temperature is 40-50°C, the extraction is carried out for 3-5 hours, and the extract is collected for later use.

[0046] Bacterial screening process

[0047] 1. Take 2 g of fresh feces from a healthy infant within 7 days of birth, filter it with sterile saline, spread it on a plate containing MSR culture medium after gradient dilution, place it in an anaerobic incubator, and culture it in a constant temperature incubator at 37°C for 48 hours.

[0048] 2. After colonies grow on the plate, use an inoculating loop to pick colonies and streak them for purification based on their color, size, transparency, and edge shape. Repeat purification three times until the color, size, transparency, and edge shape of the colonies on the same plate are uniform.

[0049] 3. The purified colonies were subjected to Gram staining and catalase analysis, retaining Gram-positive bacteria and catalase-negative bacteria.

[0050] 4. Spread the remaining bacteria on an MRS plate containing 0.8% calcium carbonate, and pick out the slightly larger bacteria with a transparent calcium-soluble circle.

[0051] 5. The selected bacteria will be subjected to the next step of gastric acid and bile salt tolerance test.

[0052] Artificial gastric juice tolerance test: The treated bacterial liquid was inoculated into artificial gastric juice with pH 3.0, and cultured in a 37°C water bath for 3 hours. The number of viable bacteria was then determined and the survival rate was calculated.

[0053] Artificial intestinal fluid tolerance test: bacteria with high survival rate were treated in artificial gastric fluid for 3 hours and then inoculated into artificial intestinal fluid (containing 0.3% bile salts). After incubation in a 37°C water bath for 6 hours, the number of viable bacteria was determined and the survival rate was calculated.

[0054] 6. Fermentation testing was performed on strains with high survival rates. Specifically, 0.5 wt% Magnolia officinalis extract was added to MRS medium, with a bacterial inoculum of 2% and incubated at 37°C. The fermentation products were tested using a human motilin (MTL) ELISA Kit, revealing that the fermentation product of strain IG50 exhibited an agonist effect on the motilin receptor.

[0055] IG50 was sequenced and compared with the obtained sequencing results, and was identified as belonging to Lactobacillus muciferum.

[0056] The 16s rDNA sequencing results of the bacteria are as follows:

[0057] CTAGCTAGCAGTACAGAGAGTTTGTGGCACGCGTTTGCCCAATTAGGTTGGTGGTGCT

[0058] TGCACCTGATTGATTTTGGTCGCCAACGAGGTGGCGGACGGGTGAGTAACACGTAGGT

[0059] AACCTGCCCAGAAGCGGGGGACAACATTTGGAAACAGATGCTAATACCGCATAACAAC

[0060] GTTGTTCGCATGAACAACGCTTAAAAGATGGCTTCTCGCTATCACTTCTGGATGGACCT

[0061] GCGGTGCATTAGCTTGTTGGTGGGGTAACGGCCTACCAAGGCGATGATGCATAGCCG

[0062] AGTTGAGAGACTGATCGGCCACAATGGGACTGAGACACGGCCCATACTCCTACGGGA

[0063] GGCAGCAGTAGGGAATCTTCCACAATGGGCGCAAGCCTGATGGAGCAACACCGCGT

[0064] GAGTGAAGAAGGGTTTCGGCTCGTAAAGCTCTGTTGTTAAAGAAGAACACGTATGAGA

[0065] GTAACTGTTCATACGTTGACGGTATTTAACCAGAAAGTCACGGCTAACTACGTGCCAG

[0066] CAGCCGCGGTAATACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGA

[0067] GTGCAGGCGGTTTTCTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGAAGTGCAT

[0068] CGGAAACTGGATAACTTGAGTGCAGAAGAGGGTAGTGGAACTCCATGTGTAGCGGTG

[0069] GAATGCGTAGATATATGGAAGAACACCAGTGGCGAAGGCGGCTACCTGGTCTGCAAC

[0070] TGACGCTGAGACTCGAAAGCATGGGTAGCGAACAGGATTAGATACCCTGGTAGTCCAT

[0071] GCCGTAAACGATGAGTGCTAGGTGTTGGAGGGTTTCCGCCCTTCAGTGCCGGAGCTA

[0072] ACGCATTAAGCACTCCGCCTGGGGAGTACGACCGCAAGGTTGAAACTCAAAGGAATT

[0073] GACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCTACGCGAAGAA

[0074] CCTTACCAGGTCTTGACATCTTGCGCCAACCCTAGAGATAGGGCGTTTCCTTCGGGAA

[0075] CGCAATGACAGGTGGTGCATGGTCGTCGTCAGCTCGTGTCGTGAGATGTTGGGTTAA

[0076] GTCCCGCAACGAGCGCAACCCTTGTTACTAGTTGCCAGCATTAAGTTGGGCACTCTAG

[0077] TGAGACTGCCGGTGACAAACCGGAGGAAGGTGGGGACGACGTCAGATCATCATGCC

[0078] CCTTATGACCTGGGCTACACACGTGCTACAATGGACGGTACAACGAGTCGCGAACTC

[0079] GCGAGGGCAAGCAAATCTCTTAAAACCGTTCTCAGTTCGGACTGCAGGCTGCAACTCG

[0080] CCTGCACGAAGTCGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGT

[0081] TCCCGGGCCTTGTACACACCGCCCGTCACACCCTAACAAACCAAACATAGAGTCGAG

[0082] CCTGGGTCAGTAAGTACAAGGAAGGCACCATAGAGTAACCAC

[0083] See SEQ ID NO.1 for details.

[0084] In order to extract, separate and identify substances that can act on motilin receptors from the fermentation broth, the present invention purifies the fermentation broth. The specific steps are as follows:

[0085] (1) After the fermentation is completed, the fermentation liquid is soaked in 95% ethanol, centrifuged and the bacterial residue is discarded, the ethanol soaked clear liquid is collected and loaded onto an HP20 macroporous adsorption resin column at a rate of 0.5 BV / h for adsorption, and then eluted with 6 times the column volume of water and 50% ethanol-water solution, respectively, at an elution flow rate of 1.5 BV / h to remove some impurity pigments; then eluted with 4 times the column volume of 95% ethanol, the eluate is collected, and concentrated to obtain a paste-like crude extract;

[0086] (2) Take the paste crude extract and add a small amount of methanol to dissolve it by ultrasonication, then stir and mix it with G200-300 mesh silica gel, and vacuum dry to remove the solvent; and fill the silica gel with the crude product into the upper layer of G200-300 mesh silica gel column, and then use petroleum ether: ethyl acetate = 7:1, petroleum ether: ethyl acetate = 4:1.5, petroleum ether: ethyl acetate = 3:1 as the mobile phase for gradient elution.

[0087] Elution, collecting the eluate in sections;

[0088] (3) The collected eluate was detected for effective components by HPLC, and the same components were combined and concentrated under vacuum. The concentrated solution was collected and dissolved in DMSO and loaded onto a DAC dynamic axial compression system. After HPLC detection, the target product was combined and vacuum dried to obtain a pure compound. HPLC analysis conditions: mobile phase: chromatographic grade acetonitrile (phase A), pure water containing 0.5% (v:v) formic acid (phase B); chromatographic column: ZORBAX SB-C18 (250×4.6 mm, 5 μm); flow rate: 1 mL / min; maximum pressure limit: 400 bar; detector: VWD; column temperature: 25°C; wavelength: 255 nm, 305 nm; injection volume: 20 μL; retention time: 25 min; gradient elution conditions: starting from A15%B85%, reaching A70%B30% at 18 min, reaching A90%B10% at 20 min, reaching A95%B10% at 21 min, reaching A100%B10% at 22 min, reaching A100%B80% at 24 min, and maintaining A20%B80% at 25 min.

[0089] The DAC dynamic axial compression system has C18 filler, 85% acetonitrile-water solution as the mobile phase, a controlled flow rate of 10 ml / min, and a detection wavelength of 247 nm.

[0090] Among the substances extracted by the above method, the following compounds exhibited motilin receptor agonist effects.

[0091]

[0092] The spectral data of this compound are as follows:

[0093] 1H NMR (300MHz, CD3CN, δ, ppm)

[0094] 8.01(s,1H),7.86(s,1H),6.95(s,1H),6.67,(s,1H),6.08(s,1H),5.35(s,1H),4.49(s,1H),

[0095] 3.65,(d,2H),3.46(d,2H),3.33(d,2H),,3.01(s,1H),2.88(s,1H),2.85(d,2H),1.80(m,3H),1.63(m,3H),1.24(m,3H).

[0096] 13C NMR (300MHz, CD3CN, δ, ppm)

[0097] 175.4, 170.7, 147.7, 139.2, 138.8, 124.5, 123.7, 119.6, 111.0, 109.1, 68.4

[0098] 59.9, 42.6, 40.0, 33.6, 32.3, 23.3, 17.6, 14.0.

[0099] Furthermore, the agonist activity of the above compounds on motilin receptors was tested as follows:

[0100] A 96-well, black-walled, clear-bottomed cell culture plate was coated with BD Matrigel and incubated at 37°C for 1 hour. The supernatant was aspirated and CHO-K1 cells expressing the corresponding human motilin receptor gene were seeded at a density of 4 × 10 cells per well in the 96-well, black-walled, clear-bottomed cell culture plate. The cells were cultured in a 37°C, 5% CO2 incubator for 16–24 hours. The cells were then harvested with 0.05% trypsin-EDTA and centrifuged. The culture medium was discarded. The cell pellet was resuspended in culture medium, and 100 μL / well of freshly prepared staining solution was added. The cells were incubated at 37°C, protected from light, and 5% CO2 for 60 minutes. Compounds were prepared in 100% DMSO and diluted to 5× the final concentration in assay buffer (Hanks' balanced salt solution, 20 mM HEPES, and 0.1% BSA). The resulting mixture was then dispensed into a 384-well plate (5 μL / well). Sample preparation: Test samples were prepared at varying concentrations. A specific volume of the test sample was added to the cells at a volume of 50 μL / well. After incubation at 37°C, 5% CO₂, for 4.5 hours, CCF4-AM loading solution (Invitrogen Corp.) was added to each well. After incubation at room temperature for 2 hours, fluorescence intensity was measured using an FDSS plate reader (Hamamatsu Photonics KK) with an excitation wavelength of 400 nm and an emission wavelength of 465 nm / 540 nm. The agonist effect of the sample on the motilin receptor was determined using a Flexstation 3 multi-function microplate reader. The results were analyzed using Graphpad Prism 5 software.

[0101] result

[0102] At a test concentration of 0.85 mM, the compound exhibited a strong agonist effect on the motilin receptor, with an agonist rate of 95.6%. This indicates that the compound exhibits an agonist effect on the motilin receptor and can be used as a novel motilin agonist to improve gastrointestinal motility.

[0103] Preparation of probiotic preparations

[0104] Probiotic fermentation culture: The activated strains were inoculated into spore-forming medium at an inoculum size of 2 mL / 100 mL. The culture was shaken at 37°C and 200 rpm for 48 h. The culture was then heated in a water bath at 75°C for 15 min. The precipitate was centrifuged at 6000 g for 10 min, and the sludge was collected after washing three times with sterile saline.

[0105] The culture medium comprises the following components in percentage by weight: 0.3-0.8% yeast extract, 0.4-0.8% beef extract, 0.7-0.9% peptone, 0.1-0.2% diammonium hydrogen citrate, 0.1-0.3% dipotassium hydrogen phosphate, 0.01-0.03% anhydrous magnesium sulfate, 0.05-0.15% Tween 80, 0.5-2.5% glucose, 1.0-1.5% maltodextrin, 0.5-0.8% galacto-oligosaccharide, 0.3-0.5% magnolia bark extract, and the balance distilled water;

[0106] Preparation of probiotic freeze-dried powder: The probiotic slurry is uniformly mixed with a freeze-dried protective agent, pre-frozen at -80°C for 3 hours, freeze-dried to -60°C, and the slurry is vacuum freeze-dried to obtain the probiotic freeze-dried powder; the freeze-dried protective agent comprises the following components in weight percentage: 2-4% skim milk powder, 1.5-1.8% soy protein isolate, 1.5-2.5% casein, 1.5-3.5% whey protein, 3-4% L-cysteine, 1-5% fructooligosaccharides, 2-3% trehalose, 0.6-2.5% calcium alginate, and the balance sterile water;

[0107] Animal Experimental Design: Thirty-six 7-week-old male SPF-grade BALB / c mice were randomly divided into a blank group, a model group, and a fermented Lactobacillus mucinous IG50 treatment group, with 12 mice in each group. After 7 days of acclimatization, the blank group was gavaged with sterile saline daily, while the mice in the other groups were gavaged with loperamide hydrochloride (10 mg / kg bw) to create a gastrointestinal motility inhibition model in mice. One hour later, the blank group and the model group were gavaged with sterile saline, while the treatment group was gavaged with a probiotic preparation (5×10 8 cfu / mL), and the gavage volume was 0.2 mL for 14 consecutive days.

[0108] Detection indicators and methods

[0109] Determination of gastrointestinal motility in mice

[0110] On day 13, mice were fasted overnight. Mice in the control group were gavaged with sterile saline, while mice in the other groups were gavaged with loperamide hydrochloride (10 mg / kg bw). One hour later, all mice were gavaged with 0.2 mL of ink containing the corresponding test formulation. The animals were then immediately transferred to a clean, empty cage and given food and water ad libitum. The time from gavage with ink to the first black stool was recorded.

[0111] On day 14, mice were fasted overnight and gavaged as on day 13. Thirty minutes later, mice were anesthetized with an intraperitoneal injection of ketamine (100 mg / kg bw). Blood was collected and the mice were sacrificed by cervical dislocation. The laparotomy was performed, and the entire small intestine from the pylorus to the cecum was carefully removed. The distance traveled by ink and the total length of the small intestine were measured. Small intestinal propulsion rate (%) = distance traveled by ink / total length of the small intestine × 100%.

[0112] Group Small intestinal propulsion rate (%) Blank group 65.2 Modeling Group 38.1 Treatment group 75.6

[0113] Determination of serum motilin levels in mice

[0114] The collected mouse blood was allowed to stand for 2 hours and centrifuged at 3000×g for 15 minutes to obtain serum. The experiment was performed according to the instructions of the corresponding mouse motilin (MTL) ELISA kit, and the concentration of motilin in mouse serum was calculated according to the standard curve.

[0115] Group Motilin level (ng / L) Blank group 134.8 Modeling Group 100.5 Treatment group 175.4

[0116] The above experimental results show that probiotic preparations can significantly regulate the content of animal motilin and improve the gastrointestinal motility of animals.

Claims

1. A fermented Lactobacillus mucilaginosus ( Limosilactobacillus fermentum )IG50, characterized by: Its accession number is CGMCC NO.32111.

2. A fermentation product obtained by fermenting the Magnolia Bark Extract with the fermented Lactobacillus mucilaginosus IG50 according to claim 1, characterized in that: The fermentation product includes a motilin receptor agonist; The structure of the motilin receptor agonist is as follows:

3. A probiotic preparation, characterized in that: The method comprises the fermented Lactobacillus mucilaginosus IG50 according to claim 1, the fermentation product according to claim 2 and a freeze-drying protective agent; The preparation method of the probiotic preparation comprises the following steps: The activated fermented Lactobacillus mucilaginosus IG50 was inoculated into the culture medium at an inoculum size of 2 mL / 100 mL, cultured at 37°C and 200 rpm for 48 h, heated in a water bath at 75°C for 15 min, centrifuged at 6000 g for 10 min, and precipitated, washed three times with sterile saline, and then the bacterial sludge was collected; Mixing the bacterial sludge with a freeze-drying protective agent and then freeze-drying; The culture medium used in the fermentation culture includes the following components in percentage by weight: Yeast extract powder 0.3-0.8%, beef extract powder 0.4-0.8%, peptone 0.7-0.9%, diammonium hydrogen citrate 0.1-0.2%, dipotassium hydrogen phosphate 0.1-0.3%, anhydrous magnesium sulfate 0.01-0.03%, Tween 80 0.05-0.15%, glucose 0.5-2.5%, maltodextrin 1.0-1.5%, galacto-oligosaccharide 0.5-0.8%, magnolia bark extract 0.3-0.5%, balance water; The preparation method of the Magnolia Bark Extract is as follows: The magnolia bark is crushed to obtain powder, and the powder is subjected to supercritical CO2 extraction to obtain the product.

4. The probiotic preparation according to claim 3, wherein: The freeze-drying protective agent comprises 2-4% skim milk powder, 1.5-1.8% soy protein isolate, 1.5-2.5% casein, 1.5-3.5% whey protein, 3-4% L-cysteine, 1-5% oligofructose, 2-3% trehalose, 0.6-2.5% calcium alginate and the balance is water.

5. The probiotic preparation according to claim 3, wherein: The entrainer used in the supercritical CO2 extraction includes acetone; The material-liquid ratio of the entrainer to the powder is 1:0.08 g / mL.

6. The probiotic preparation according to claim 3, wherein: The supercritical CO2 extraction uses a CO2 flow rate of 18-30 L / h; The supercritical CO2 extraction adopts an extraction pressure of 2-4 MPa; The extraction temperature used in the supercritical CO2 extraction is 40-50°C; The extraction time of the supercritical CO2 extraction is 3-5h.

Images