Astroblastoma cell model as well as construction method and application thereof

Abstract

The invention relates to an astroblastoma (ABM) cell model as well as a construction method and application thereof. The astroblastoma cell model is a human induced neural progenitor cell which carries and can express MN1: BEND2 and / or MN1: CXXC5 fusion genes, has the molecular phenotype and proliferation characteristics of MN1 fusion gene mutant ABM tumors, can still well simulate the characteristics of the ABM tumors when transplanted into animal brains, and can be used for preparing the astroblastoma cell model. Therefore, an important research tool is provided for mechanism research and drug development of ABM tumors.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an astroblastoma cell model and a preparation method and application thereof. Background Art

[0002] Astroblastoma (ABM) is an understudied, rare central nervous system tumor that primarily affects children and young adults. The exact cellular origin and pathogenesis of astroblastoma are unclear. Existing studies have shown that astroblastoma may originate from forebrain neural stem cells or precursor cells. Our previous research results show that astroblastoma may originate from ventral forebrain neural stem cells or precursor cells. Recent molecular pathology studies have revealed that gene fusion mutations are a unique genetic feature of astroblastoma, distinguishing it from other tumors with similar histopathological features.

[0003] In 2016, through tumor sequencing analysis, it was found that astroblastomas are often accompanied by gene mutations such as MN1, BEND2, and CXXC5, among which the most important mutation form is MN1:BEND2 gene fusion. MN1 is a known important proto-oncogene, so initial studies believed that MN1 mutations may be the main pathogenic factor of astroblastoma. Accordingly, in the 2021 "WHO Classification of Central Nervous System Tumors", "MN1 mutant astroblastoma" was included for the first time, and MN1 gene fusion mutations were used as the molecular diagnostic basis for the disease. Recent studies have found that compared with other central nervous system brain tumors, the expression of astrocyte markers in astroblastoma is not prominent; on the contrary, the tumor expresses neural stem cell characteristic genes, suggesting that the disease may be related to abnormalities in the stem cell stage.

[0004] At present, there is no cell model that can simulate ABM, which limits the study of its pathogenesis and the development of treatment strategies. Therefore, it is urgent to develop a cell model that can better simulate ABM disease, so as to provide a basis for the mechanism study and drug screening of ABM.

[0005] Human embryonic stem cells (hESCs) have become an ideal tool for studying early human development and disease models due to their unlimited proliferation capacity and multidirectional differentiation potential. However, achieving efficient, stable and specific gene expression in hESCs remains a challenge. Summary of the invention

[0006] Purpose of the Invention

[0007] In view of the problems or needs existing in the prior art, the purpose of the present invention is to provide an astroblastoma (ABM) cell model and its preparation method and application. The astroblastoma cell model can stably express the characteristic fusion gene (MN1:BEND2 or MN1:CXXC5) of astroblastoma cells, has the molecular phenotype and proliferation characteristics of MN1 fusion gene mutant ABM tumors, and can well simulate the characteristics of ABM tumors after being transplanted into animals, and is an effective astroblastoma cell model.

[0008] Solution

[0009] In order to achieve the above object, the technical solution of the present invention is:

[0010] In a first aspect, the present invention provides an astroblastoma cell model, wherein the astroblastoma cell model is a human induced neural progenitor cell that carries and can express MN1:BEND2 and / or MN1:CXXC5 fusion gene.

[0011] In a feasible embodiment, the MN1:BEND2 fusion gene expresses any of the following proteins:

[0012] A1) a protein with an amino acid sequence as shown in SEQ ID NO: 1;

[0013] A2) A derivative protein of the protein shown in A1) obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 1 and having more than 80% identity with the protein shown in A1).

[0014] Preferably, the MN1:BEND2 fusion gene expresses a protein having an amino acid sequence as shown in SEQ ID NO: 1, which is a protein expressed by the fusion of exon 1 of MN1 and exons 7-14 of BEND2.

[0015] SEQ ID NO: 1:

[0016]

[0017]

[0018] In the above SEQ ID NO: 1, the underlined portion is the amino acid sequence encoded by exon 1 of MN1, and the bolded portion is the amino acid sequence encoded by exons 7-14 of BEND2.

[0019] In a further feasible embodiment, the MN1:BEND2 fusion gene has a nucleotide sequence selected from the following:

[0020] a1) the nucleotide sequence shown in SEQ ID NO: 2;

[0021] a2) having more than 80% identity with the nucleotide sequence shown in SEQ ID NO: 2, and encoding a nucleotide sequence of the protein shown in A1) or A2) in claim 2;

[0022] Preferably, the MN1:BEND2 fusion gene has a nucleotide sequence as shown in SEQ ID NO: 2, which comprises the coding nucleotides of exon 1 of MN1 and the coding nucleotides of exons 7-14 of BEND2.

[0023] SEQ ID NO:2

[0024]

[0025]

[0026]

[0027] GAGTGCCCCATATCCAGCCTCTTCATATCTTCCCATCACTTCTAATTTTGAATC

[0028] TGGCCCACAAATGAGTTATGGGACAATGAGTTACTCAACTGAAATGAAAAATA

[0029] ACTGTGACCAAGATGATGCTTCAGCATCTGCCTGCCTCACTCCCGATTTTGCA

[0030] CTGTTACCTCTGAATATTTTGGTAAAAGTAGACACCAACACGGAAAACAGCGT

[0031] CAACACAATGAATCGCTCAACTTTATTGGACAGTGACAGTGGCCAGGATTCTT

[0032] CCTCATCATCTGTCTGTATCCCTCCCAAGTATGGCTATCTTGGTGATCCAAAA

[0033] AGAAATGTCAGAGTACTTAAAATCCATTTGCTGGCCGTACAAAATATGGCCAA

[0034] ACCTAAGCAAGCAGCCTGCTACTTGGTTCGTATTTTGTTCTCCAAGGAAATCC

[0035] TGATTAGCAGCTCAGTGGATATCCATTTGAAAGACAGCCAATCCCTCGACCCG

[0036] AACAAAATGGCTGCATTGAGAGAATATCTGGCAACAACTTTTCCCACCTGTGA

[0037] TTTGCATGAACATGGAAAAGACTGGCAGGACTGTATTTCTGGTATCAATTCTA

[0038] TGATCTACTGTTTATGTTCTGAAGGCAAGAGTACTCCAAAAACTGTTCGCAAA

[0039] AATAAAAAACGTACCAACCGTGTTGCATCGGCATCTGCAGATAGAAATGACCA

[0040] AAGGGGCAGAGATGGTGGTGAAGGCTGTTCTTGGATGTTTCAGCCAATGAAT

[0041] AACTCCAAAATGAGAGAAAAGAGGAACTTGCAGCCAAACAGTAATGCTATCC

[0042] CTGAAGGAATGCGAGAACCTTCCACTGATAATCCAGAGGAACCTGGTGAAGC

[0043] ATGGAGCTATTTTGGAAGACCATGGAGAAATATACGGATGCCATGTTCAGTAC

[0044] TGACTTTGGCAAAAACTAAGTCTTGCGCAAGCCTGTCGGCTAGATACCTTATT

[0045] CAGAAACTCTTCACAAAAGATGTCCTGGTCCAAAGTAACGTCTATGGCAATCT

[0046] GAAGCATGGCCTGTGTGCCCTTGACCCCAATAAGATTAGTGCTCTCCGAGAG

[0047] TTCCTCCAAGAAAACTACCCAATTTGTGATCTCTCGGAAAATGGAAGAGACT

[0048] GGAAGTCGTGTGTGACCTCCATCAACAGCGGTATCCGTAGCCTTAGACATGA

[0049] CGTCAGAAGGGCTGAAGCCAGGTCTCAGTCGCTTCCAGCAGTGACCCCTCC

[0050] AGAGCTGGAGCAGGAGTCAAAGCCAGGAGATCCCGACGCCACTGACCCAAGCACC.

[0051] In the above SEQ ID NO: 2, the underlined portion is the coding nucleotide of exon 1 of MN1, and the bolded portion is the coding nucleotide of exons 7-14 of BEND2.

[0052] In a feasible embodiment, the MN1:CXXC5 fusion gene expresses any of the following proteins:

[0053] B1) a protein with an amino acid sequence as shown in SEQ ID NO: 3;

[0054] B2) A derivative protein of the protein shown in B1) having more than 80% identity with the protein shown in B1) obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 3.

[0055] Preferably, the MN1:CXXC5 fusion gene expresses a protein having an amino acid sequence as shown in SEQ ID NO: 3, which is a protein expressed by the fusion of exon 1 of MN1 and part of exon 3 and part of exon 4 of CXXC5.

[0056] SEQ ID NO:3:

[0057]

[0058] In the above SEQ ID NO: 3, the underlined portion is the amino acid sequence encoded by exon 1 of MN1, and the bolded portion is the amino acid sequence encoded by part of exon 3 and part of exon 4 of CXXC5.

[0059] In a further feasible embodiment, the MN1:CXXC5 fusion gene has a nucleotide sequence selected from the following:

[0060] b1) the nucleotide sequence shown in SEQ ID NO:4;

[0061] b2) a nucleotide sequence having more than 80% identity with the nucleotide sequence shown in SEQ ID NO: 4, and encoding the protein shown in B1) or B2) in claim 2;

[0062] Preferably, the MN1:CXXC5 fusion gene has a nucleotide sequence as shown in SEQ ID NO:4, which comprises the coding nucleotides of exon 1 of MN1 and the coding nucleotides of part of exon 3 and part of exon 4 of CXXC5.

[0063] SEQ ID NO:4

[0064]

[0065]

[0066]

[0067] In the above SEQ ID NO: 4, the underlined portion is the coding nucleotide of exon 1 of MN1, and the bolded portion is the coding nucleotide of part of exon 3 and part of exon 4 of CXXC5.

[0068] In a second aspect, the present invention provides a method for constructing an astroblastoma cell model as described in the first aspect above, the construction method comprising: introducing the MN1:BEND2 and / or the MN1:CXXC5 fusion gene into human embryonic stem cells through the PiggyBac transposon system, and inducing the human embryonic stem cells stably expressing the MN1:BEND2 and / or the MN1:CXXC5 fusion gene to differentiate into human induced neural progenitor cells.

[0069] In a feasible specific embodiment, the construction method comprises the following steps:

[0070] 1) constructing a piggyBac transposon plasmid containing the MN1:BEND2 and / or the MN1:CXXC5 fusion gene;

[0071] 2) co-transfecting human embryonic stem cells with a piggyBac transposon vector containing the MN1:BEND2 and / or the MN1:CXXC5 fusion gene, a TET-On regulatory element plasmid, and a transposase plasmid, and screening human embryonic stem cell clones that stably express the MN1:BEND2 and / or the MN1:CXXC5 fusion gene;

[0072] 3) Using a neural induction medium, inducing the differentiation of human embryonic stem cell clones stably expressing the MN1:BEND2 and / or the MN1:CXXC5 fusion gene into human induced neural progenitor cells.

[0073] Preferably, in step 1), the vector of the PiggyBac transposon plasmid is a PB-TRE3G-P2A-mNeonGreen vector.

[0074] Preferably, in step 2), the TET-On regulatory element plasmid is a PB-EF1a-TET3G regulatory plasmid, and the nucleotide sequence of TET3G contained therein is shown as SEQ ID NO:5; the transposase plasmid is pCAG-CMV-PBase, and the nucleotide sequence of PBase is shown as SEQ ID NO:6;

[0075] The sequence of SEQ ID NO:5 is as follows:

[0076] ATGTCTAGACTGGACAAGAGCAAAGTCATAAACTCTGCTCTGGAATTACTCAATGGAGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGAAGAACAAGCGGGCCCTGCTCGATGCCCTGCCAATCGAGATGCTGGACAGGCATCATACCCACTCCTGCCCCCTGGAAGGCGAGTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATACCGCTGTGCTCTCCTCTCACATCGCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAGTACGAAACCCTGGAAAATCAGCTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGTGGGCCACTTTACACTGGGCTGCGTATTGGAGGAACAGGAGCATCAAGTAGCAAAAGAGGAAAGAGAGACACCTACCACCGATTCTATGCCCCCACTTCTGAAACAAGCAATTGAGCTGTTCGACCGGCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGACCGACGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCCCGGGTAA;

[0077] The sequence of SEQ ID NO:6 is as follows:

[0078]

[0079] Preferably, in step 2), the mass ratio of the piggyBac transposon plasmid, the TET-On regulatory element plasmid and the transposase plasmid used for co-transfection is 1:(0.8-1.2):(0.8-1.2), preferably 1:1:1.

[0080] Preferably, in step 3), the neural induction medium is SMADi neural induction medium.

[0081] Optionally, the construction method further includes:

[0082] 4) detecting the protein expression of the MN1:BEND2 and / or the MN1:CXXC5 fusion gene in the obtained human induced neural progenitor cells and / or the cell differentiation state, and when it is detected that the MN1:BEND2 and / or the MN1:CXXC5 fusion gene stably expresses protein and the cells differentiate into human induced neural progenitor cells, the astroblastoma cell model is obtained; and, optionally,

[0083] 5) Verify the proliferation characteristics, tissue morphology and expression of characteristic genes of astroblastoma of the obtained astroblastoma cell model.

[0084] Preferably, in step 4), the cell differentiation state is detected by detecting the expression of human induced neural progenitor cell markers sox2, nestin, and sox1.

[0085] In a third aspect, the present invention provides an astroblastoma cell model as described in the first aspect above or an astroblastoma cell model constructed according to the construction method as described in the second aspect above for use in screening drugs for treating astroblastoma.

[0086] Beneficial Effects

[0087] The present invention introduces specific fusion genes MN1:BEND2 and / or MN1:CXXC5 into human embryonic stem cells through the PiggyBac transposon system, screens human embryonic stem cells that stably express the fusion genes, and induces the human embryonic stem cells that stably express the fusion genes to differentiate into human induced neural progenitor cells, thereby obtaining an effective astroblastoma cell model. The cell model has the molecular phenotype and proliferation characteristics of MN1 fusion gene mutant ABM tumors, and when the cell model is transplanted into the brain of an animal, its proliferation characteristics and tissue morphology are also consistent with those of MN1 fusion gene mutant ABM tumors, that is, it can still simulate ABM tumors well, thereby providing an important research tool for mechanism research and drug development of ABM tumors.

[0088] In addition, the method for constructing the astroblastoma cell model of the present invention is highly efficient and stable. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] One or more embodiments are exemplarily described by the pictures in the accompanying drawings, and these exemplary descriptions do not constitute limitations on the embodiments. The special word "exemplary" here means "used as an example, embodiment or illustrative". Any embodiment described as "exemplary" here is not necessarily interpreted as being superior or better than other embodiments.

[0090] Figure 1 This is the plasmid map of PB-TRE3G-P2A-mNeonGreen.

[0091] Figure 2 Schematic diagram of the MN1:BEND2 knock-in hESC strategy; wherein, "1" shows the expression cassette of the PiggyBac transposon plasmid containing the MN1:BEND2 fusion gene, "2" shows the expression cassette of the TET-On regulatory element plasmid, and "3" shows the expression cassette of the transposase plasmid.

[0092] Figure 3 This is the plasmid map of the TET-On regulatory element plasmid PB-EF1a-TET3G.

[0093] Figure 4 This is the plasmid map of the transposase plasmid pCAG-CMV-PBase.

[0094] Figure 5 This is the result of immunofluorescence detection of the expression of fusion proteins HA-MN1:BEND2 and HA-MN1:CXXC5 in hESC.

[0095] Figure 6 This is a graph showing the expression results of Western Blot detection of fusion proteins HA-MN1:BEND2 and HA-MN1:CXXC5 in iNPC.

[0096] Figure 7 This is the result of immunofluorescence detection of the expression of NPC protein markers Nestin, SOX2, and SOX1 in iNPC.

[0097] Figure 8 Changes in transcription levels of ABM marker genes in iNPCs harboring stable MN1 fusion mutations MN1:BEND2 and MN1:CXXC5.

[0098] Fig. 9 The cell proliferation levels of iNPCs cells introduced with the fusion gene MN1:BEND2 (Figure a) or MN1:CXXC5 (Figure b) were compared with those of the control group.

[0099] Fig.10 The figure shows the tracing results of iNPCs cells introduced with the fusion gene MN1:BEND2 (Figure a) or MN1:CXXC5 (Figure b) after being transplanted into the mouse cerebral cortex; the green mark shows the mNeonGreen fluorescence signal, which indicates the survival of iNPCs cells in the brain after transplantation; the blue mark shows the fluorescence signal of HA antibody, which indicates the expression of fusion protein MN1:BEND2 or MN1:CXXC5 in iNPC cells; the red mark shows the fluorescence signal of KI67 protein, which indicates the expression of cell proliferation marker Ki67; the gray mark shows the staining result of DAPI staining of cell nuclei. DETAILED DESCRIPTION

[0100] Unless explicitly stated otherwise, throughout the specification and claims, the term “comprise” or variations such as “include” or “comprising”, etc., will be understood to include the stated elements or components but not to exclude other elements or components.

[0101] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.

[0102] In order to make the present invention more easily understood, some technical terms are specifically defined as follows. Unless otherwise clearly defined in other parts of this document, the technical terms used herein have the meanings commonly understood by ordinary technicians in the field to which the present invention belongs.

[0103] The term "about" when used in conjunction with a numerical value is meant to encompass the numerical value within a range having a lower limit that is 5% less than the specified numerical value and an upper limit that is 5% greater than the specified numerical value, including but not limited to ±5%, ±2%, ±1%, and ±0.1%, as such variations are appropriate for performing the disclosed methods.

[0104] The term "and / or" should be understood to mean any one of the optional items or a combination of any two or more of the optional items.

[0105] As used herein, the term "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as inclusive, that is, including at least one of the numbers or elements in the list, but also including more than one, and optionally, additional unlisted items. Only when terms are clearly indicated to the contrary, such as "only one" or "exactly one" or when "consisting of..." is used in the claims, it will refer to only one number listed or one element of the list.

[0106] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in either single- or double-stranded form.

[0107] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0108] Example 1: Obtaining human induced neural progenitor cells (iNPCs) stably expressing MN1:BEND2 or MN1:CXXC5 fusion genes

[0109] 1. Construction of plasmids for co-transfection

[0110] (1) Construction of piggyBac transposon plasmids containing fusion genes MN1:BEND2 or MN1:CXXC5

[0111] Materials and reagents: human BEND2 cDNA (synthesized by Shanghai Bioengineering Co., Ltd.), human MN1 and CXXC5 cDNA (obtained from Hela cell cDNA by PCR), Phanta Max Master Mix (Vazyme, P515-01), gel recovery kit (OMEGA, D2500-02), ClonExpress Ultra One Step Cloning Kit (Vazyme, C115), PB-TRE3G-P2A-mNeonGreen vector (which is generated by constructing TRE3G sequence and P2A mNeonGreen sequence into the basic vector PB, the specific map is shown in Figure 1 As shown), 5α competent cells.

[0112] The plasmid construction method is as follows:

[0113] By PCR technology, a gene fragment of the fusion gene MN1:BEND2 with a 3xHA tag at the 5' end (the fusion gene MN1:BEND2 includes exon 1 of the MN1 gene and exons 7-14 of the BEND2 gene, and its sequence is shown in SEQ ID NO:2) was amplified, and purified and recovered by agarose gel electrophoresis; the above two fragments were cloned into the PB-TRE3G-P2A-mNeonGreen vector by homologous recombination technology to obtain

[0114] PB-TRE3G-3xHA-MN1:BEND2-P2A-mNeonGreen recombinant expression plasmid. Figure 2 The constitution of the expression cassette in the recombinant expression plasmid is shown.

[0115] In a similar manner, a PB-TRE3G-3xHA-MN1:CXXC5-P2A-mNeonGreen recombinant expression plasmid was constructed (wherein the gene sequence of MN1:CXXC5 is shown in SEQ ID NO: 4).

[0116] In addition, a PiggyBac transposon plasmid containing only mNeonGreen, MN1 exon 1, and BEND2 exons 7-14 was constructed in a similar manner as a control plasmid, which is abbreviated as eGFPCtrl or Ctrl, MN1 e1, and BEND2 e7-14, respectively, below and in the accompanying drawings.

[0117] (2) Construction of TET-On regulatory element plasmid and transposase plasmid

[0118] Furthermore, a TET-On regulatory element plasmid PB-EF1a-TET3G regulatory plasmid (wherein the nucleotide sequence of TET3G is shown in SEQ ID NO: 5, and the plasmid map is shown in Figure 3 ) and transposase plasmid

[0119] pCAG-CMV-PBase (wherein the nucleotide sequence of PBase is shown in SEQ ID NO: 6, and the plasmid map is shown in Figure 4 shown).

[0120] 2. hESC cell culture and transfection

[0121] Materials and reagents: CB0003 hESC cell line, Matrigel (Corning 354277), StemFlex TM Culture medium (Gibco A3349401), ReLeSR TM Agent (STEMCELL Technologies 100-0483).

[0122] The specific steps are as follows:

[0123] In Matrigel-coated dishes, using StemFlex TM hESCs were maintained in an undifferentiated state using culture medium and passaged every 5-7 days using ReLeSR reagent.

[0124] The piggyBac transposon plasmids containing only mNeonGreen, only MN1 (exon1), only BEND2 (exon7-14), or the fusion gene MN1:BEND2 or MN1:CXXC5 were co-transfected with the TET-On regulatory element plasmid and the transposase plasmid at a ratio of 1:1:1 in hESCs using LipofectamineTM Stem Reagent (Invitrogen 2693947), and then stably integrated cell clones were selected by puromycin.

[0125] The expression of HA-MN1:BEND2 or HA-MN1:CXXC5 in hESCs transfected with the piggyBac transposon plasmid containing the fusion gene MN1:BEND2 or MN1:CXXC5 was detected by immunofluorescence staining based on HA tag antibodies. The specific steps of immunofluorescence staining are as follows:

[0126] 1) Preparation of cell slides: Take an appropriate amount of cells and plant them on a cell slide. For human iNPC, the cell slides are coated with Matrigel for 30-60 minutes before planting. After the cells grow to an appropriate density, remove the culture medium and wash them three times with PBS.

[0127] 2) Cell fixation: After washing the cell slides with PBS, the cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes.

[0128] 3) Blocking: Use a blocking solution containing 1% FBS and 0.5% Triton x-100 for 30-60 minutes at room temperature. This step can not only reduce the non-specific binding of the primary antibody, but also pore the cell nucleus so that the antibody can better enter the cell nucleus.

[0129] 4) Primary antibody incubation: Dilute HA-Tag (C29F4) Rabbit mAb (CST) in blocking solution (1:200), mix well, cover on the cell slide, and incubate at 4°C overnight.

[0130] 5) Secondary antibody incubation: After recovering the primary antibody, wash the slides three times with PBS, 10 min each time. Use Donkeyanti-Rabbit IgG-Alexa Fluo 488 (ThermoFisher) as the secondary antibody, dilute 1:500. Incubate at room temperature in the dark for 1 hour.

[0131] 6) Washing: Remove the secondary antibody and wash the slides three times with PBS, 10 min each time, keeping away from light.

[0132] 7) DAPI staining: After washing with PBS, dilute DAPI according to a certain ratio and add it to the cell slide. Incubate at room temperature for 10 minutes, and then wash three times with PBS, each time for 10 minutes. Be careful to avoid light.

[0133] 8) Sealing: Drop about 5 μl of sealing agent on the slide, and be careful to avoid bubbles. Use lens paper to absorb the PBS on the surface of the slide, and then cover the cell slide in reverse. Then store it in a -4° refrigerator for a short time or keep it in a -20° refrigerator.

[0134] 9) Photography: A Leica TCS-SP8 STED 3x laser confocal microscope was used on the focusing chamber platform of the Basic Research Institute.

[0135] Among them, the immunofluorescence detection results of HA-MN1:BEND or HA-MN1:CXXC5 are as follows Figure 5 As shown, Figure 5 In the figure, the blue fluorescence shows the DAPI staining result, which is used to mark the cell nucleus; the green fluorescence shows the HA staining result, which indicates the expression of the fusion protein HA-MN1:BEND or HA-MN1:CXXC5.

[0136] Depend on Figure 5 It can be seen that the signal of HA-MN1:BEND2 or HA-MN1:CXXC5 fusion protein is strong and overlaps with the DAPI signal, indicating the successful expression of HA-MN1:BEND2 or HA-MN1:CXXC5 fusion protein in hESC and its localization in the cell nucleus. This result confirms the effectiveness of the expression system, that is, the stable expression of HA-MN1:BEND2 or HA-MN1:CXXC5 fusion protein in hESC is achieved.

[0137] 3. iNPC differentiation and culture

[0138] Materials and reagents: Matrigel (Corning 354277), STEMdiff TMNeural Induction Medium+SMADi (STEMCELL Technologies 05835), Gentle Cell Dissociation Reagent (STEMCELL Technologies 100-0485), Y-27632 (MCE HY-10071), Accutase dissociation medium (STEMCELL Technologies 07920), sox2 (abcam lot:1007374-3), nestin(abcam), sox1(abcam,lot:1018056-6), HA(C29F4)(CST,lot:3724), STEMdiff TM Neural ProgenitorMedium(STEMCELL Technologies 05833)

[0139] (1) iNPC induction:

[0140] ① Pretreat the culture plate with Matrigel.

[0141] ②Prepare STEMdiff containing apoptosis inhibitor Y-27632 (to increase cell survival rate) TM Neural Induction Medium+SMADi was used as induction medium.

[0142] ③Use Gentle Cell Dissociation Reagent to disperse hESCs, count and adjust the cell density.

[0143] ④ Inoculate hESC cells stably transfected with HA-MN1:BEND2 or HA-MN1:CXXC5 fusion protein expression plasmids or control plasmids eGFPCtrl, MN1 e1, BEND2 e7-14 in the above-mentioned induction medium, replace the preheated induction medium daily until the 6th day (or 9th day), and use Accutase dissociation medium to digest the cells for passaging.

[0144] ⑤ According to the above-mentioned culture conditions and passaging method, a total of three passagings were carried out and the induction culture was carried out for a total of 18-21 days to obtain iNPC cells; among them, the iNPC cells induced by hESCs stably transfected with the fusion protein HA-MN1:BEND2 or HA-MN1:CXXC5 may be referred to as KI iNPC (i.e., Knockin iNPC) in the following text or in the accompanying drawings, and the iNPC cells induced by hESCs stably transfected with the control plasmid eGFPCtrl may be referred to as Ctrl iNPC in the following text or in the accompanying drawings.

[0145] (2) iNPC identification:

[0146] The expression and molecular weight of the fusion protein were verified by Western Blot using HA antibody. Figure 6 As shown. Figure 6 It can be seen that the fusion proteins HA-MN1:BEND2 or HA-MN1:CXXC5 were successfully expressed in iNPC cells induced by hESCs.

[0147] The expression of proteins such as Sox2, Nestin, and Sox1 in iNPC cells was identified by immunofluorescence. The results showed that the iNPC cells induced by the above steps clearly expressed typical NPC markers Sox2, Nestin, and Sox1, indicating that iNPCs differentiated from hESCs possessed the molecular characteristics of neural precursor cells, proving the success of the differentiation process.

[0148] As a representative result, Figure 7 The immunofluorescence detection results of iNPC cells induced by hESCs expressing fusion proteins HA-MN1:BEND2 or HA-MN1:CXXC5 are shown. Figure 7 In the figure, blue fluorescence shows the DAPI staining result, which is used to mark the cell nucleus; green fluorescence shows the staining result of Nestin, Sox2, Sox1 and other proteins. Figure 7 It can be seen that iNPC cells induced by hESCs expressing the fusion protein HA-MN1:BEND2 or HA-MN1:CXXC5 all expressed typical NPC markers Sox2, Nestin and Sox1 at high levels, indicating that these iNPC cells have the molecular characteristics of neural precursor cells, proving the success of the differentiation process.

[0149] (3) iNPC cultivation:

[0150] iNPC cells were cultured in STEMdiff TMThe cells were cultured in Neural Progenitor Medium (STEMCELL Technologies 05833) and digested with Accutase dissociation medium every 3 days for subculture.

[0151] Example 2: Identification of ABM disease molecular phenotype and cell proliferation ability of human induced neural progenitor cells (iNPCs) stably expressing MN1:BEND2 or MN1:CXXC5 fusion genes

[0152] (I) Verification of the expression of ABM characteristic genes in iNPC obtained in Example 1 by RNA-seq

[0153] iNPCs expressing the fusion gene MN1:BEND2 or MN1:CXXC5 obtained in Example 1 were placed in a STEMdiff TM After 48 h of culture in Neural Progenitor Medium, cells were collected and RNA was extracted using the TRIZOL method. The integrity of total RNA was assessed using a Bioanalyzer 2100 or 2200 (Agilent). Subsequently, the library was constructed using the VAHTS Universal V6 RNA-seq Library Preparation Kit (Vazyme) and sequenced on the Illumina Novoseq platform in 150 bp double-end sequencing mode.

[0154] The RNA-Seq data processing pipeline is as follows: First, the RNA-Seq reads of transgenic human iNPCs were aligned to the human reference genome GRCh38 using Hisat2; next, Samtools was used for data conversion and sorting; featureCounts was used to calculate the transcript per million counts (TPM) expression of each gene; when using the EdgeR package for differential expression analysis, genes with less than 10 reads were excluded; and Pheatmap was used to generate heat maps to display changes in gene expression.

[0155] The results are as follows Figure 8 shown. Figure 8It was shown that compared with iNPCs stably expressing mNeonGreen (i.e., eGFPCtrl in the figure), MN1 exon 1 (i.e., MN1 e1 in the figure), and BEND2 exons 7-14 (i.e., BEND2 e7-14 in the figure), the transcription levels of oncogenes associated with ABM disease were significantly upregulated in iNPCs stably expressing the fusion genes MN1:BEND2 and MN1:CXXC5. This result indicates that iNPC cells overexpressing the fusion genes MN1:BEND2 and MN1:CXXC5 have the molecular phenotype of ABM disease.

[0156] (II) Determination of the cell proliferation ability of iNPC obtained in Example 1

[0157] The iNPCs expressing the fusion gene MN1:BEND2 or MN1:CXXC5 obtained in Example 1 were seeded into a 24-well plate at a density of 10^5 cells / well and incubated in a STEMdiff medium containing 1 μg / ml doxycycline. TM The cells were cultured in Neural Progenitor Medium, and the cell numbers were counted on days 1, 3, and 5, and a growth curve was prepared.

[0158] The results are as follows Fig. 9 shown. Fig. 9 The results show that compared with iNPCs stably transfected with mNeonGreen (i.e., Ctrl iNPC in the figure), the proliferation rate of iNPCs stably transfected with fusion genes MN1:BEND2 and MN1:CXXC5 (i.e., MN1:BEND2 KI iNPC and MN1:CXXC5KI iNPC in the figure) was significantly increased, indicating that the MN1 fusion gene caused abnormal cell proliferation, which is consistent with the proliferation characteristics of ABM.

[0159] Example 3: Transplantation of human induced neural progenitor cells (iNPC) in mice stably expressing MN1:BEND2 or MN1:CXXC5 fusion genes

[0160] The iNPCs expressing the fusion gene MN1:BEND2 or MN1:CXXC5 obtained in Example 1 were cultured according to the above method. iNPCs were digested, collected and kept on ice. NSG mice aged 8-9 days were anesthetized with 2.5% pentobarbital (avertin) and fixed on a stereotaxic instrument (RWD brand), to which a microliter syringe (Shanghai Gaoge Industry and Trade Co., Ltd., 10 μL specification) and a syringe pump (KD Scientific #788130) were connected. The injection needle was inserted into the brain at a depth of 0.8 mm at a 40-degree angle. A total of 200,000 to 400,000 iNPCs expressing the fusion protein MN1:BEND2 or MN1:CXXC5 obtained in Example 1 (i.e., KI iNPC in the figure) or control iNPCs (i.e., Ctrl iNPC in the figure, in which a control plasmid containing only mNeonGreen was stably transferred) were suspended in 2 μL of PBS and slowly injected into the cerebral cortex. Starting from the third day after surgery, the animals were intraperitoneally injected with 50 mg / kg of doxycycline (Beyotime#ST039A) every day. Two weeks after transplantation, the whole brain tissue was removed, and the removed brain tissue was fixed, dehydrated, embedded, and frozen in sequence, and then sliced ​​into 30 μm thick brain tissue slices using a freezing microtome, and then immunofluorescence staining was used to detect the transplantation effect of iNPCs and their proliferation status in the brain tissue after transplantation.

[0161] The specific operation of immunofluorescence staining is as follows:

[0162] The frozen brain tissue sections were blocked with 5% donkey serum and then stained. The staining process was as follows: staining with primary antibodies HA-rabbit (1:500), mNeonGreen-mouse (1:200), and KI67-rat (1:500) at 4°C overnight, then washing the primary antibodies, adding secondary antibodies donkey anti rabbit Alexa Fluor 647 (1:500), donkey anti mouse Alexa Fluor 488 (1:500), and donkey anti rat Cyanine cy3 (1:500) for staining at room temperature for 2 hours, washing the secondary antibodies, and sealing with sealing agent, and then scanning with a Leica inverted confocal, and the image scanning magnification was 40 times.

[0163] Through the above procedures, the expression of mNeonGreen, fusion gene MN1:BEND2 or MN1:CXXC5HA, and KI67 protein in cells were detected respectively. Among them, since all stable plasmids carry the mNeonGreen fluorescent gene, its fluorescent signal (green) will indicate the distribution and survival of iNPCs transplanted cells containing stable plasmids in the brain; since the expression plasmids of fusion protein MN1:BEND2 or MN1:CXXC5HA contain HA tags, the expression level of fusion protein can be indicated by the fluorescent signal (blue) of HA tag antibody; in addition, KI67 protein is a nuclear protein that can be used as a marker to indicate the level of cell proliferation, and its fluorescent signal is red.

[0164] Immunofluorescence staining results Fig.10 shown.

[0165] Fig.10 The results showed that control iNPCs can effectively differentiate into post-proliferative cells after transplantation into the mouse cerebral cortex, as shown by their expression of KI67; while iNPCs overexpressing MN1:BEND2 or MN1:CXXC5 maintain a highly proliferative state, as shown by strong expression of KI67 and the formation of rosette structures. These observations are consistent with the proliferation characteristics and tissue morphology of MN1 fusion gene mutant ABM tumors, that is, the iNPCs expressing the fusion gene MN1:BEND2 or MN1:CXXC5 of the present invention can still well simulate the characteristics of ABM tumors after transplantation into the animal brain, thereby providing an in vitro or in vivo screening platform for ABM therapeutic drug screening.

[0166] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An astroblastoma cell model, characterized in that: The astroblastoma cell model is a human induced neural progenitor cell that carries and can express MN1:BEND2 and / or MN1:CXXC5 fusion gene.

2. The astroblastoma cell model according to claim 1, characterized in that The MN1:BEND2 fusion gene expresses any of the following proteins: A1) a protein with an amino acid sequence as shown in SEQ ID NO: 1; A2) a derivative protein of the protein shown in A1) obtained by substitution and / or deletion and / or addition of one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 1, which has more than 80% identity with the protein shown in A1); And / or, the MN1:CXXC5 fusion gene expresses any of the following proteins: B1) a protein with an amino acid sequence as shown in SEQ ID NO: 3; B2) A derivative protein of the protein shown in B1) having more than 80% identity with the protein shown in B1) obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO:

3.

3. The astroblastoma cell model according to claim 2, characterized in that: The MN1:BEND2 fusion gene has a nucleotide sequence selected from the following: a1) the nucleotide sequence shown in SEQ ID NO: 2; a2) having more than 80% identity with the nucleotide sequence shown in SEQ ID NO: 2, and encoding a nucleotide sequence of the protein shown in A1) or A2) in claim 2; And / or, the MN1:CXXC5 fusion gene has a nucleotide sequence selected from the following: b1) the nucleotide sequence shown in SEQ ID NO:4; b2) has more than 80% identity with the nucleotide sequence shown in SEQ ID NO: 4, and encodes the nucleotide sequence of the protein shown in B1) or B2) in claim 2.

4. The method for constructing an astroblastoma cell model according to any one of claims 1 to 3, characterized in that: The construction method comprises: introducing the MN1:BEND2 and / or the MN1:CXXC5 fusion gene into human embryonic stem cells through the PiggyBac transposon system, and inducing the differentiation of the human embryonic stem cells stably expressing the MN1:BEND2 and / or the MN1:CXXC5 fusion gene into human induced neural progenitor cells.

5. The construction method according to claim 4, characterized in that: The construction method comprises the following steps: 1) constructing a piggyBac transposon plasmid containing the MN1:BEND2 and / or the MN1:CXXC5 fusion gene; 2) co-transfecting human embryonic stem cells with a piggyBac transposon vector containing the MN1:BEND2 and / or the MN1:CXXC5 fusion gene, a TET-On regulatory element plasmid, and a transposase plasmid, and screening human embryonic stem cell clones that stably express the MN1:BEND2 and / or the MN1:CXXC5 fusion gene; 3) Using a neural induction medium, inducing the differentiation of human embryonic stem cell clones stably expressing the MN1:BEND2 and / or the MN1:CXXC5 fusion gene into human induced neural progenitor cells.

6. The construction method according to claim 5, characterized in that: In step 1), the vector of the PiggyBac transposon plasmid is a PB-TRE3G-P2A-mNeonGreen vector.

7. The construction method according to claim 5 or 6, characterized in that: In step 2), the TET-On regulatory element plasmid is PB-EF1a-TET3G, and the transposase plasmid is pCAG-CMV-PBase; And / or, the mass ratio of the piggyBac transposon plasmid, the TET-On regulatory element plasmid and the transposase plasmid used for co-transfection is 1:(0.8-1.2):(0.8-1.2), preferably 1:1:

1.

8. The construction method according to any one of claims 5 to 7, characterized in that: In step 3), the neural induction medium is SMADi neural induction medium.

9. The construction method according to any one of claims 5 to 8, characterized in that: The construction method also includes: 4) detecting the protein expression of the MN1:BEND2 and / or the MN1:CXXC5 fusion gene in the obtained human induced neural progenitor cells and / or the cell differentiation state, and when it is detected that the MN1:BEND2 and / or the MN1:CXXC5 fusion gene stably expresses protein and the cells differentiate into human induced neural progenitor cells, the astroblastoma cell model is obtained; and, optionally, 5) Verify the proliferation characteristics, tissue morphology and expression of characteristic genes of astroblastoma of the obtained astroblastoma cell model; Preferably, in step 4), the cell differentiation state is detected by detecting the expression of human induced neural progenitor cell markers sox2, nestin, and sox1.

10. Use of the astroblastoma cell model according to any one of claims 1 to 3 or the astroblastoma cell model constructed by the construction method according to any one of claims 4 to 9 in screening drugs for treating astroblastoma.

Images