Recombinant salmonella choleraesuis nuclease regulation vector as well as construction method and application thereof

Abstract

The invention discloses a recombinant salmonella choleraesuis nuclease regulation vector as well as a construction method and application thereof. After oral administration, the recombinant salmonella choleraesuis nuclease regulatory vector rSC0140 enters host immune cells, c-di-AMP is released, a host STING pathway is activated, and a broad-spectrum antiviral effect can be achieved; the recombinant strain rSC0140 is proved to be capable of activating STING pathways in macrophages and mice, causing antiviral states of the macrophages and the mice and resisting challenge of various influenza viruses; the recombinant strain has broad-spectrum antiviral efficacy and is suitable for preventing and treating various virus diseases clinically.

Description

Technical Field

[0001] The invention relates to a recombinant Salmonella choleraesuis nuclease regulating vector and a construction method and application thereof, belonging to the field of vector construction. Background Art

[0002] STING (stimulator of interferon genes) is a very popular target for drug development. STING agonists refer to compounds that can bind to STING proteins and activate their downstream innate immune responses. Such compounds are usually two molecules of nucleotides or adenylic acid polymers, such as c-di-GMP, c-di-AMP, etc. In recent years, STING agonists have been widely used in the field of anti-tumor. Studies by Emily P et al. showed that human and mouse STING agonist ADU-S100 reduced local and distal tumor burden in mice carrying pancreatic ductal adenocarcinoma (PDA). Although STING agonists have been widely studied in the field of tumor treatment, research and application of STING agonists in the field of antiviral treatment are rare. Tina M. Sali et al. used the synthetic STING agonist G10 to induce an antiviral state in human cells, allowing cells to resist the attack of alpha virus. This study showed that STING agonists have certain application and development potential in the field of anti-infection.

[0003] At present, the administration of STING agonists depends on the adjuvant or gene gun, which is related to the characteristics of STING protein. STING protein is an intracellular protein. When STING agonists are applied in vitro, STING agonists must be combined with STING proteins in cells to make the agonists work. This requires the use of adjuvants or media such as gene guns to transport STING agonists into cells so that the two can be combined to induce subsequent drug reactions. The methods commonly used to deliver STING agonists are cationic adjuvant encapsulation delivery or gene gun injection. Both methods have obvious defects. For cationic adjuvants, the adjuvant is usually a high-molecular nanomaterial. This material is difficult to be metabolized and excreted in the body, and has certain cytotoxicity, which increases the risk of administration. When using cationic adjuvants to present STING agonists, it will cause damage to the body's cells. As for gene guns, gene gun injection has a high technical threshold and high cost of administration. When combined with STING agonists, it has poor promotion and application. Especially in the field of veterinary medicine, the high cost is almost difficult to be accepted by the market. In addition, it is difficult to target natural immune cells using cationic adjuvants or gene guns. Most of these STING agonists are transported to the injection site or administration site, while STING protein is mainly present in dendritic cells and macrophages, two natural immune cells. The above two administration methods cannot target these two natural immune cells, which greatly reduces the effectiveness of STING agonists. Therefore, the development of a new technology for the delivery of STING agonists inexpensively and efficiently is of great significance for its application, especially in the veterinary field. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a recombinant Salmonella choleraesuis nuclease regulatory vector and its construction method and application, which can release CDA, activate the host STING pathway, and achieve a broad-spectrum antiviral effect.

[0005] Technical solution: To solve the above technical problems, the present invention provides a dacA gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0006] The invention also provides an expression box, a recombinant vector, a recombinant cell or a recombinant bacterium, which contains the dacA gene.

[0007] Wherein, the nucleotide sequence of the expression cassette is shown as SEQ ID NO.2.

[0008] The invention also provides a recombinant Salmonella choleraesuis nuclease regulatory vector, which contains the expression box.

[0009] The present invention also provides a method for constructing the recombinant Salmonella choleraesuis nuclease regulatory vector, and introducing the expression cassette into the rSC0118 strain.

[0010] Wherein, the specific preparation comprises the following steps:

[0011] (1) double-digesting the expression cassette gene fragment and the plasmid, connecting them and transforming competent cells to form a recombinant suicide vector;

[0012] (2) Using the suicide vector described in step (1), the expression cassette is introduced into the Salmonella choleraesuis nuclease regulatory vector strain rSC0118 to construct a recombinant Salmonella choleraesuis nuclease regulatory vector.

[0013] The present invention also provides the use of the dacA gene, expression cassette, recombinant vector, recombinant cell, recombinant bacteria or recombinant Salmonella choleraesuis nuclease regulatory vector in the preparation of drugs for synthesizing and / or delivering STING agonists.

[0014] The present invention also provides the use of the dacA gene, expression cassette, recombinant vector, recombinant cell, recombinant bacteria or recombinant Salmonella choleraesuis nuclease regulatory vector in the preparation of a drug for activating the STING pathway.

[0015] The present invention also provides the use of the dacA gene, expression cassette, recombinant vector, recombinant cell, recombinant bacteria or recombinant Salmonella choleraesuis nuclease regulatory vector in the preparation of a drug for inducing cells to express and / or secrete type I interferon.

[0016] The present invention also provides the use of the dacA gene, expression cassette, recombinant vector, recombinant cell, recombinant bacteria or recombinant Salmonella choleraesuis nuclease regulatory vector in the preparation of drugs for preventing and / or treating viral infections.

[0017] Among them, the viruses include H1N1, H5N1 and H7N9 viruses.

[0018] STING protein is mainly present in dendritic cells and macrophages, two natural immune cells, and the target cells of Salmonella are dendritic cells and macrophages. Therefore, the use of Salmonella to present STING agonists can target STING to these two natural immune cells, so that the STING agonist fully binds to the STING protein in the natural immune cells, thereby fully activating the downstream STING pathway and improving the utilization rate of the drug. In general, it is difficult for the active ingredients in recombinant bacterial vectors to pass through the bacterial cell wall and be released into the host cell to exert their effects. The Salmonella choleraesuis nuclease regulatory vector used to deliver the STING agonist in the present invention has a programmed lysis function. The present invention expresses the STING agonist in Salmonella through the strong targeting and invasion ability of Salmonella to immune cells and the function of programmed lysis, and releases it into the host cytoplasm through lysis, binds to the STING protein in the host cell, activates the STING pathway, and induces an antiviral innate immune response.

[0019] STING agonists have been widely studied in the field of tumor treatment, but the research and application of targeted delivery of STING agonists by Salmonella with attenuated lytic properties in the antiviral field are rare. The present invention uses a recombinant Salmonella choleraesuis nuclease regulatory vector to deliver STING agonists and evaluates the antiviral efficacy of the recombinant Salmonella choleraesuis nuclease regulatory vector in porcine macrophages and mice.

[0020] The working principle of the present invention Figure 1 ): The recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140 that delivers adenylate cyclase DacA is cultured in vitro. At this time, adenylate cyclase DacA is synthesized in the rSC0140 bacteria. Under the catalytic action of DacA, the ATP in the cell generates c-di-AMP. After the Salmonella containing a large amount of c-di-AMP is administered to cells or mice, the Salmonella enters the host cells, and through gene regulation, the vector bacteria undergoes programmed lysis, releasing c-di-AMP into the host cytoplasm. These c-di-AMPs bind to the STING protein and activate the STING pathway. When the STING pathway is activated, it will cause the host cells to release antiviral effector factors, which will kill viruses in the cells or environment, thereby achieving an antiviral effect.

[0021] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. After oral administration, the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140 enters the host immune cells, releases c-di-AMP, and activates the host STING pathway to achieve a broad-spectrum antiviral effect; 2. The recombinant strain rSC0140 has been proven to activate the STING pathway in macrophages and mice, causing the antiviral state of macrophages and mice, and can resist the attack of multiple influenza viruses; 3. The recombinant strain has a broad-spectrum antiviral effect and is suitable for the prevention and treatment of various viral diseases in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the working principle of the present invention;

[0023] Figure 2 The plasmid pRE112-ΔrecF:P lac dacA ACA- Double enzyme digestion identification diagram;

[0024] Figure 3 is ΔrecF:P lac dacA ACA Mutation pattern diagram;

[0025] Figure 4 This is the PCR identification result of the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140;

[0026] Figure 5 is the concentration of CDA in the culture supernatant of rSC0118 and rSC0140; **: p<0.01; ***: p<0.001;

[0027] Figure 6 The concentration of CDA in the supernatant of 3D4 / 21 cells treated with rSC0118 and rSC0140 at different time periods after infection; **: p<0.01; ***: p<0.001;

[0028] Figure 7 Western Blot was used to detect the expression of STING protein induced by rSC0118 and rSC0140 in 3D4 / 21 cells at different time periods after infection;

[0029] Figure 8 ELISA was used to detect the concentration of type I interferon in the culture supernatant of 3D4 / 21 cells treated with rSC0118 and rSC0140 at different time periods after infection; ***: p < 0.001;

[0030] Fig. 9 To detect the secretion level of type I interferon in mice infected with the corresponding strains by ELISA;

[0031] Fig.10 The viral titers of influenza viruses in cells inoculated with different ratios of recombinant Salmonella rSC0118 and rSC0140: A: viral titer of H1N1 virus; B: viral titer of H5N1 virus; C: viral titer of H7N9 virus. DETAILED DESCRIPTION

[0032] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0033] Example 1 Construction and identification of rSC0140

[0034] 1. pRE112-ΔrecF:P lac dacA ACA Plasmid construction and identification

[0035] The complete gene sequence of Listeria monocytogenes NH1 strain (Genbank ID: 1358004970) was used as a template to amplify the upstream and downstream homology arms of the recF gene of Salmonella choleraesuis. The dacA gene fragment (SEQ ID NO. 200) was amplified by fusion PCR (procedure: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 2 minutes; system: 10 μl of Norwegian Taq Master Mix enzyme (Cat. No.: P112-01); 1 μl of each upstream and downstream primer, 8 μl of water; primer sequence: upstream: SEQ ID NO.3: ATGGACTTTTCCAATATGAGTAT, downstream: SEQ ID NO.4: TCACTCGGA CTTACCTCCT).1: ATGGACTTTTCCAATATGAGTAT CCTTCACTATTTAGCGAATATTGTAGATATTTTGGTGGTTTGGTTCGTAATTTATAAGGTTATCATGCTTATCCGCGGCACGAAAGCCGTCCAGCTGTTGAAGGGGATTTTCATTATTATTGCCGTCAAGTTACTTAGCGGCTTCTTCGGATTGCAGACGGTGGAATGGATTACTGATCAAATGCTGACTTGGGGTTTCTTAGCCATTATCATTATCTTTCAACCGGAATTGCGTCGTGCCCTGGAGACTTTGGGGCGTGGCAATATCTTTACCCGCTATGGATCACGCATTGAGCGTGAGCAGCACCACCTTATTGAGTCTATTGAAAAGTCCACGCAATATATGGCGAAGCGTCGCATTGGAGCTTTGATCTCTGTGGCTCGTGATACCGGCATGGACGACTATATCGAGACTGGCATTCCGCTTAATGCGAAAATCTCATCGCAATTATTGATTAATATCTTCATCCCCAATACCCCTCTTCACGATGGCGCAGTGATCATTAAAGGTAACGAGATCGCGAGCGCTGCCAGTTATCTGCCATTGTCCGACTCGCCGTTTCTTTCTAAGGAGCTGGGAACTCGCCATCGTGCCGCATTAGGGATTTCCGAGGTGACCGATTCAATCACCATCGTTGTCAGCGAGGAAACGGGTGGGATTTCCCTTACGAAGGGAGGCGAACTGTTCCGTGATGTATCCGAAGAAGAATTGCATAAGATTTTGCTTAAAGAGCTGGTGACTGTCACGGCTAAAAAACCAAGCATTTTCTCCAAATGGAAAGGAGGTAAGTCCGAGTGA) was inserted into the upstream and downstream homologous arms of the recF gene to form ΔrecF:P. lac dacA ACA Expression cassette ( Figure 3lac dacA ACA The expression cassette gene fragment and the pRE112 plasmid were double-digested with Sac I and Kpn I (digestion system: 20 μl, including 10 μl of plasmid, 1 μl of Sac I and Kpn I, and 8 μl of water), and the digestion products were ligated with T4 ligase and transformed into χ7213 competent cells (kindly donated by Professor Roy Curtiss of the University of Florida; public article: PMID: 20479086; article name: Immune responses to recombinant pneumococcal PsaAantigen delivered byalive attenuated Salmonella vaccine;), and clones were picked and identified by double digestion and sequencing. The double digestion identification results are shown as follows Figure 2 Among them, 1, 2, and 3 are three parallel experiments. The clones that were correctly identified by double restriction digestion and sequencing were positive clones and named χ7213 (pRE112-ΔrecF:P lac dacA ACA ).

[0036] 2. Construction and identification of the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140

[0037] Recombinant bacterial vector vaccines have been widely used as carriers for delivering protective antigens and nucleic acid vaccines to prevent certain infectious diseases because of their ability to induce mucosal immunity, humoral immunity, and cellular immunity. However, the protective antigens and nucleic acids recombined into bacterial vector vaccines are difficult to pass through the bacterial cell wall and be released into the host cell to exert their effects. In order to solve this problem, the present invention introduces ΔrecF:P into rSC0118, a Salmonella choleraesuis nuclease regulatory vector that can programmatically lyse and release intracellular substances. lac dacA ACA- expression cassette, forming rSC0140.

[0038] To introduce ΔrecF:P into Salmonella choleraesuis rSC0118 (laboratory conservation; public article: PMID: 37867213; article name: Abacterial mRNA-lysis-mediated cargo release vaccine system for regulated cytosolic surveillance and optimized antigen delivery;) lac dacA ACA-The rSC0140 deletion strain was constructed by suicide vector-mediated homologous recombination technology. rSC0118 was used as the recipient bacterium and pRE112-ΔrecF:P lac dacA ACA- Suicide plasmid suicide vector χ7213 (pRE112-ΔrecF:P lac dacA ACA- ) is the donor bacteria. The above two bacterial strains were cultured to the logarithmic phase, and 50 microliters of each of the above two bacterial solutions were dripped onto the LB agar medium (hereinafter referred to as DAP agar medium) containing diaminopimelic acid (DAP, 50 ng / mL). The LB agar medium (containing DAP) to which the above two bacterial solutions were added was placed at 37°C for 12 hours. Then, the bacterial moss on the LB agar medium (containing DAP) was scraped, streaked on the LB agar medium (hereinafter referred to as Cm agar medium) containing a final concentration of 25 μg / mL chloramphenicol, and cultured at 37°C overnight. On the 2nd day, a single colony grown on the Cm agar medium was picked and purified once on the Cm agar medium. After the above colonies grow, a single colony was picked and cultured in LB liquid culture medium with shaking until the logarithmic growth phase. The above bacterial solutions were respectively subjected to 10 -4 Up to 10 -8 The multiple dilutions were spread on LB agar medium containing 5% sucrose (hereinafter referred to as sucrose agar medium), and placed in an incubator at 26°C for 2-3 days. Single colonies on the sucrose agar medium were picked for PCR identification (upstream primer: SEQ ID NO.5: 5'-TTATAGGCGATGCTATTG-3'; downstream primer: SEQ ID NO.6: 5'-AAGCGCCGTTTTCGAGAG-3'; program: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds; extension at 72°C for 2 minutes; system: 10 μL of Norwegian Taq Master Mix enzyme (Cat. No.: P112-01); 1 μL of upstream and downstream primers, 8 μL of water). The PCR identification was correct ( Figure 4 ) after the positive strains were frozen in a -70℃ refrigerator for future use. Among them, 1 to 5 are parallel experiments.

[0039] Example 2 rSC0140 synthesizes c-di-AMP (CDA) in vitro and releases CDA into the extracellular space

[0040] 1. rSC0140 synthesizes and releases the STING agonist CDA when grown in NB medium

[0041] In this example, an in vitro passage experiment was used to evaluate the ability of the Salmonella choleraesuis nuclease regulatory vector rSC0140 to synthesize and release CDA in vitro. rSC0118 and rSC0140 were taken out of a -70°C refrigerator and streaked on NB medium containing 0.2% arabinose for recovery. The above single colonies were then picked and subcultured in NB medium. Arabinose was added at a final concentration of 0.2% during the first passage, and no arabinose was added thereafter. CDA was extracted from the bacteria and the culture supernatant using methanol. CDA was separated and detected on a Vanquish UHPLC / TSQ Altis LC-MS / MS 6500 liquid spectrometer using a liquid chromatography-mass spectrometry method. The above samples were detected under the following detection conditions: the chromatographic column was EC 150 / 2.0NUCLEODUR C18Pyramid (3μm); the mobile phase A was 0.2% formic acid-water solution, and the mobile phase B was acetonitrile; the flow rate was 0.4mL / min, the column temperature was 35°C, and the injection volume was 5μL. Under the mobile phase conditions, each sample was analyzed within 8 minutes. The mass spectrometry ion source was an electrospray ion source (ESI), the detection method was multiple reaction monitoring (MRM), and the ionization method was positive ion scanning. Ion source parameters: curtain gas 20psi, spray voltage 5500V, nebulization temperature 550°C, nebulization gas 65psi, auxiliary gas 65psi, declustering voltage 90V, intake voltage 7V, quantitative ion pair: parent ion / daughter ion was 675 / 524, qualitative ion pair: parent ion / daughter ion was 675 / 506 or 675 / 136. The analysis was performed using an ACQUITY UPLC I-Class Plus chromatography-mass spectrometer, and the concentration of CDA was calculated using a 1 / X weighted linear 7-point standard curve (0.01-1000 ng / mL).

[0042] The results are as follows Figure 5 As shown in the figure, the level of CDA synthesized by the recombinant Salmonella choleraesuis nuclease-regulated vector rSC0140 was significantly higher than that of the common vector rSC0118. At the same time, as the number of passages increased, the concentration of arabinose in the culture environment decreased, and the concentration of CDA detected in the culture supernatant of rSC0140 also increased. The above results show that as the concentration of arabinose in the environment decreases, rSC0140 gradually undergoes programmed lysis and actively releases CDA in the cytoplasm. This mechanism of lysis and release of CDA allows CDA in the cytoplasm to cross the barrier of the cell wall and be released outside the cell.

[0043] 2. rSC0140 synthesizes and releases c-di-AMP in porcine lung macrophage cell line 3D4 / 21 cells

[0044] Take out the frozen rSC0118 and rSC0140 from the -70℃ refrigerator and streak them on LB medium containing 0.2% arabinose to revive. Then pick the above single colonies and culture them in LB medium containing 0.2% arabinose at 37℃ overnight. The overnight culture was inoculated into LB liquid medium containing 0.2% arabinose at a ratio of 1:100 and shaken to OD 600 =0.85, the bacteria were collected by centrifugation and used to infect 3D4 / 21 cells (kindly donated by Professor Zhu Jianzhong of Yangzhou University; public article: PMID: 32922386; article name: Porcine IFI16 Negatively Regulates cGAS Signaling Through the Restriction of DNA Binding and Stimulation). Cell infection experiments were performed using 1MOI rSC0118 and 1MOI rSC0140 and PBS control wells, respectively. After 1h, 6h, 12h, and 24h of infection, the cell membrane was permeabilized with digitonin, and the CDA in the cell culture supernatant was extracted with methanol (add an equal volume of methanol and shake to mix, centrifuge at 12000rmp for 10 minutes, and aspirate the supernatant), and the extract was separated and detected on the Vanquish UHPLC / TSQ Altis LC-MS / MS 6500 system (detection conditions are the same as above). The test results are shown in Figure 6 As shown: The CDA concentration in the cell culture supernatant of the rSC0140 group was significantly higher than that of the rSC0118 group. At the same time, as the infection time increased, the CDA concentration in the cell culture supernatant of the rSC0140 infection group also increased. However, CDA could not be detected in the cell culture supernatant of the rSC0118 group and the PBS control group. This shows that rSC0140 can synthesize a large amount of CDA after infecting 3D4 / 21 cells, and release the synthesized CDA into the cytoplasm of the host cells. This release mechanism can significantly increase the expression of CDA and ensure that it can efficiently bind to the STING protein in the cytoplasm to activate the STING pathway.

[0045] Example 3 rSC0140 activates the STING pathway in 3D4 / 21 cells

[0046] 1. rSC0140 upregulates the expression of STING in cGAS knockdown porcine lung macrophage cell line 3D4 / 21 cells

[0047] CDA can activate the STING pathway and upregulate the expression of STING protein. When Salmonella infects cells, its own DNA may upregulate the expression of cGAS and activate the subsequent STING pathway. Therefore, in order to prove that it is the influence of CDA catalyzed by DacA expressed by rSC0140 that activates the STING pathway, rather than the role of cGAS, this example knocks down the cGAS of the porcine macrophage cell line 3D4 / 21 cells by lentiviral infection, and explores the characteristics of rSC0140 activating the STING pathway. The 3D4 / 21 cells with cGAS knockdown (kindly donated by Professor Zhu Jianzhong of Yangzhou University; public article: PMID: 32922386; article name: PorcineIFI16 Negatively Regulates cGAS Signaling Through the Restriction of DNA Binding and Stimulation) were plated in a 24-well plate, with 2.5×10 6 After the cells were tightly attached to the wall, the culture was shaken to an OD of 600 =0.85, and the cells were collected by centrifugation. Recombinant Salmonella choleraesuis rSC0118 and rSC0140 with 1MOI were used for cell infection experiments. The cell suspension was collected at 1h, 6h, 12h, and 24h of infection, and the total cell protein was extracted. Anti-cGAS monoclonal antibody (manufacturer: Proteintech; catalog number: 26416-1-AP; dilution ratio: 1:5000, 1 ml) and Anti-pSTING (manufacturer: Cell Signaling Technology; catalog number: 50907; dilution ratio: 1:1000, 2 ml) monoclonal antibody were used as primary antibodies, and HRP-labeled goat anti-mouse antibody (manufacturer: Sigma; catalog number: 12-349; dilution ratio: 1:1000, 2 ml) was used as secondary antibody to perform Westren Blot experiments. Subsequently, Image J was used to analyze the concentrations of cGAS and pSTING proteins. The higher the corresponding protein concentration, the stronger the corresponding signal activity. The results are shown in Figure 7As shown in the figure, compared with rSC0118, rSC0140 infection significantly upregulated the expression of STING protein in porcine lung macrophages, and the expression of STING protein reached a peak at 12h. At this time, rSC0140 upregulated the expression of STING protein by 12.5 times that of the rSC0118 group (actin internal reference protein was used to correct the loading amount). This shows that as rSC0140 gradually synthesized and released CDA in 3D4 / 21 cells, the STING pathway was gradually activated, and compared with the non-nuclease regulatory vector, the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140 activated the STING pathway more significantly. Combined with the previous part of the study, it is confirmed that rSC0118 can actively program cleavage in host cells, and at the same time synthesize and release CDA in its own cytoplasm in large quantities. When CDA is released into the host cell, it fully binds to STING in the host cell cytoplasm, significantly upregulating the expression of STING and activating the STING pathway.

[0048] 2. rSC0140 upregulates the expression and secretion of type I interferon in cGAS-knockout porcine lung macrophage cell line 3D4 / 21 cells

[0049] Type I interferon is the main effector of antiviral innate immunity and has been shown to inhibit the infection of a variety of viruses. Therefore, type I interferon is widely used in clinical antiviral treatment.

[0050] Referring to the above method, a cell infection experiment was performed using recombinant Salmonella choleraesuis. The recombinant Salmonella nuclease regulatory vectors rSC0118 and rSC0140 were used to infect the cGAS knockout porcine lung macrophage cell line 3D4 / 21 cells, and the cell culture supernatant was collected at 1h, 6h, 12h, and 24h of infection, and the secretion characteristics of type I interferon IFN-β in the culture supernatant were detected by indirect ELISA. The results showed that at 6 hours, 12 hours, and 24 hours after infection, the concentration of type I interferon detected in the cell supernatant of the rSC0140 infection group was significantly higher than that of the rSC0118 infection group, which were approximately 3.6 times, 4.1 times, and 3.7 times, respectively. The above results show that ( Figure 8 ), compared with rSC0118, rSC0140 has a significantly enhanced ability to activate the STING pathway, inducing the expression and secretion of a large amount of type I interferon. This is because rSC0140 synthesizes and releases a large amount of CDA in cells, thereby inducing cells to secrete high levels of type I interferon.

[0051] Example 4 rSC0140 induces expression and secretion of type I interferon in Balb / C mice

[0052] Previous studies have shown (article title: A bacterial mRNA-lysis-mediated cargo release vaccine system for regulated cytosolic surveillance and optimized antigen delivery; author: Yu-an Li and Huoying Shi) that the Salmonella choleraesuis nuclease regulatory vector rSC0118 can colonize in the mouse lymphoid tissue and spread to the deep lymphoid tissue. This is conducive to the synthesis of a large amount of exogenous antigens or exogenous effectors carried by the nuclease regulatory vector, and fully activates host lymphocytes to induce excellent immune responses. Therefore, this example uses Balb / C mice as an animal model to further explore the ability of the recombinant Salmonella nuclease regulatory vector rSC0140 to induce type I interferon expression and secretion in animal bodies.

[0053] Thirty Babl / C mice (purchased from the Experimental Animal Center of Yangzhou University) were randomly divided into three groups. Each mouse in each group was orally administered with 1.2×10 9 CFU of rSC0118 and rSC0140 live bacterial suspension, and an oral PBS control group was set up. Serum was collected from each group of mice 24 hours after oral administration of the bacterial solution, and the concentration of IFN-β in the serum was detected by indirect ELISA. The results showed that ( Fig. 9 ): The concentrations of type I interferon in the liver, spleen, intestine, and serum of mice that were orally administered with rSC0140 were significantly higher than those of mice that were orally administered with rSC0118, which were 6.5 times, 4.7 times, 5.2 times, and 8.7 times higher than those of mice treated with rSC0118, respectively. Oral administration of the empty vector control rSC0118 also induced the production of a small amount of type I interferon in the liver, spleen, and intestine of mice and secreted it into the serum. This may be because the DNA released by the nuclease-regulated vector itself can also activate the expression of type I interferon in a trace amount in a cGAS-dependent manner. Type I interferon could not be detected within the sensitivity range in the liver, spleen, intestine (Peyer's nodes), and serum of mice that were orally administered with PBS (the kit sensitivity was 20pg / mL-5000pg / mL). The above results indicate that after rSC0140 fully activates the STING pathway, it induces the expression and secretion of a large amount of type I interferon. This may be because rSC0140 synthesizes and releases a large amount of CDA after colonization in mice, thereby inducing mice to secrete high levels of type I interferon.

[0054] Example 5 rSC0140 in cells against influenza virus infection

[0055] The recombinant Salmonella choleraesuis was prepared for cell infection experiments according to the method in the second part of Example 2, and experimental groups infected with rSC0118 and rSC0140 were set up respectively. 3D4 / 21 cells were cultured and digested and plated in 24-well plates, with 2.5×10 cells per well. 6 cells. Incubate overnight at 37C, 5% CO:, and perform bacterial infection experiments the next day; wash cells 2-3 times with PBS before infection, add blood-free and antibiotic-free DMEM to each well, and perform cell infection experiments using 0MOI, 0.01MOI, 0.1MOI, 0.5MOI, and 1MOI rSC0118 and rSC0140, respectively. 30 minutes after infection, remove the above growth medium, add 1.5mL of growth medium containing 100μg / mL dual antibody (gentamicin and amphotericin mixed at a concentration of 1:1) to each well, and quickly return to the incubator for continued culture. 24 hours after the above-mentioned Salmonella infection cells were inoculated with 1MOl H1N1 virus (TCID50=10 8.5 / mL), 1MOl H5N1 virus (TCID50=10 7.3 / mL) or 1MOl H7N9 virus (TCID50=10 6.5 / mL), and 24 hours later, the cells and cell supernatant were collected, and the virus was collected by filtration with a 0.45 filter after repeated freezing and thawing three times. The collected virus was then inoculated into MDCK cells at an inoculation dose of 1 MOI to detect the TCID50 of the virus solution. The results are shown in Fig.10 As shown: When the inoculation dose was 0.1MOI, 0.5MOI and 1MOI, the virus titer of H1N1 in the rSC0140 inoculation group was significantly lower than that in the rSC0118 inoculation group. When the inoculation dose was 0.5MOI and 1MOI, the virus titer of H5N1 in the rSC0140 inoculation group was significantly lower than that in the rSC0118 inoculation group. When the inoculation dose was 0.5MOI and 1MOI, the virus titer of H7N9 in the rSC0140 inoculation group was significantly lower than that in the rSC0118 inoculation group. When the inoculation dose was 0.01MOI, rSC0118 showed a slight inhibitory effect on H1N1, H5N1 and H7N9, and the decrease in virus titer was not significant. It is worth noting that as the inoculation concentration of rSC0140 gradually increased, the virus titers of H1N1, H5N1 and H7N9 gradually decreased. This suggests that the inhibitory effect of rSC0140 on the virus is positively correlated with its inoculation dose.

[0056] Example 6 rSC0140 protects Balb / C mice against influenza virus infection

[0057] In order to evaluate the antiviral efficacy of rSC0140 in animals, this example uses Balb / C mice as an animal model to conduct animal protection experiments. The following experimental groups were set up, oral rSC0118 and oral rSC0140 recombinant nuclease control vector groups, and oral PBS control group, and the antiviral efficacy of the strains administered to each group of mice was evaluated.

[0058] The rSC0118 and rSC0140 bacterial suspensions were prepared according to the method in Example 2. Thirty Balb / C mice were randomly divided into three groups. Each mouse in each group was orally administered with 1.2×10 9 CFU of the above bacterial suspension, and an oral PBS control group was set up at the same time. 24 hours after oral administration of the above bacterial suspension, the virus was challenged, and each mouse was intraperitoneally injected with 100 μL of H1N1, H5N1 and H7N9 influenza viruses (100×TCID50).

[0059] 48 hours after intraperitoneal injection of virus solution, mice orally administered with PBS and rSC0118 showed obvious clinical symptoms of H1N1 infection: rickets, tremor, mania, hyperactivity, and all died after 72 hours, with a protection efficiency of 0%. However, mice orally administered with rSC0140 showed no obvious clinical symptoms, and none of them died during the 30-day observation period, with a protection efficiency of 100% (Table 1).

[0060] Table 1 Survival of mice after influenza virus challenge

[0061]

[0062] The results showed that oral administration of rSC0140 to mice could reduce or eliminate the clinical lesions caused by influenza virus in mice and protect mice from attack by lethal doses of influenza virus.

[0063] In summary, the present invention constructs a recombinant expression cassette carrying adenylate cyclase ΔrecF:P lac dacA ACA-, the expression cassette was introduced into the Salmonella choleraesuis nuclease regulatory vector rSC0118 to form the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140. When DacA is expressed in the Salmonella choleraesuis nuclease regulatory vector, it catalyzes ATP to form CDA. After oral administration of rSC0140, the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140 enters the host lymphoid tissue, synthesizes and releases CDA. The released CDA interacts with the STING protein in the host cell, thereby activating the STING pathway and inducing cells or mice to secrete high levels of type I interferon to resist the attack of H1N1, H5N1 and H7N9 influenza viruses. The recombinant strain has a broad-spectrum antiviral effect and is suitable for the prevention and treatment of H1N1, H5N1 and H7N9 in clinical practice, reducing the harm of influenza viruses to human and animal health.

Claims

1. A dacA gene, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. An expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium, characterized in that: It contains the dacA gene according to claim 1.

3. The expression cassette according to claim 2, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

2.

4. A recombinant Salmonella choleraesuis nuclease regulatory vector, characterized in that: It contains the expression cassette according to claim 2 or 3.

5. A method for constructing the recombinant Salmonella choleraesuis nuclease regulatory vector according to claim 4, characterized in that: The expression cassette of claim 2 or 3 is introduced into the rSC0118 strain.

6. The construction method according to claim 5, characterized in that: The following steps are involved: (1) double-digesting the gene fragment of the expression cassette of claim 2 or 3 with the plasmid, connecting them and transforming competent cells to form a recombinant suicide vector; (2) Using the suicide vector described in step (1), the expression cassette was introduced into strain rSC0118 to construct a recombinant Salmonella choleraesuis nuclease regulatory vector.

7. Use of the dacA gene according to claim 1, the expression cassette, recombinant vector, recombinant cell or recombinant bacteria according to claim 2, or the recombinant Salmonella choleraesuis nuclease regulatory vector according to claim 4 in the preparation of a drug for synthesizing and / or delivering a STING agonist.

8. Use of the dacA gene according to claim 1, the expression cassette, recombinant vector, recombinant cell or recombinant bacteria according to claim 2, or the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140 according to claim 4 in the preparation of a drug for activating the STING pathway.

9. Use of the dacA gene according to claim 1, the expression cassette, recombinant vector, recombinant cell or recombinant bacteria according to claim 2 or the recombinant Salmonella choleraesuis nuclease regulatory vector according to claim 4 in the preparation of a drug for inducing cells to express and / or secrete type I interferon.

10. Use of the dacA gene according to claim 1, the expression cassette, recombinant vector, recombinant cell or recombinant bacteria according to claim 2 or the recombinant Salmonella choleraesuis nuclease regulatory vector according to claim 4 in the preparation of a drug for preventing and / or treating viral infection, characterized in that: The virus includes H1N1, H5N1 or H7N9 virus.

Images