A lncRNA associated with sheep resistance to F17 Escherichia coli diarrhea and its application
By identifying and validating the lncRNA DRB1-AS1 associated with sheep F17 Escherichia coli diarrhea, the problem of unclear molecular regulatory mechanisms of sheep diarrhea was solved, the resistance of sheep to F17 Escherichia coli was improved, and a theoretical basis for molecular therapy and breeding was provided.
Patent Information
- Application Number
- CN202410943147.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-15
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-07-15
AI Technical Summary
In existing technologies, research on the genetic regulatory mechanisms of Escherichia coli diarrhea in sheep mainly focuses on host gene expression and immune pathway activation. The function and molecular regulatory mechanisms of non-coding RNA, especially long non-coding RNA, in E. coli diarrhea are unclear, making it difficult to effectively enhance resistance.
A lncRNA, DRB1-AS1, associated with sheep resistance to F17 Escherichia coli diarrhea was identified and provided. Its full-length sequence is SEQ ID NO.1. The significant upregulation of DRB1-AS1 expression in sheep small intestinal epithelial cells infected with F17 Escherichia coli was verified by high-throughput sequencing and real-time quantitative PCR. The DRB1-AS1 siRNA fragment was synthesized and transfected to detect its effect on resistance.
Downregulation of DRB1-AS1 expression can reduce the adhesion resistance of sheep primary small intestinal epithelial cells to F17 Escherichia coli, participate in the host immune protection mechanism in the occurrence and development of sheep diarrhea, and provide a theoretical basis for molecular treatment of sheep diarrhea and disease-resistant breeding.
Smart Images

Figure CN118667814B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of animal husbandry and veterinary technology, specifically relating to a lncRNA related to sheep's resistance to F17 Escherichia coli diarrhea and its application. Background Technology
[0002] Diarrhea is a common problem in sheep farming, frequently affecting newborn lambs and significantly impacting their survival rate and growth efficiency, resulting in substantial economic losses for the sheep industry. Escherichia coli F17 (E. coli F17) is one of the main pathogens causing diarrhea in lambs. Epidemiological surveys show that E. coli F17 is widely prevalent in lambs and calves worldwide, exhibiting high detection and mortality rates. Furthermore, drug resistance in E. coli F17 is severe. Therefore, improving the host's own immunity and resistance to E. coli F17 from a genetic perspective is the most effective way to address the problem of E. coli infection in sheep.
[0003] Diarrhea caused by F17 Escherichia coli is the result of interactions between the pathogen, host, and environment, and its occurrence and development involve the regulation of numerous factors such as non-coding RNAs, genes, signaling pathways, and metabolites. Current research on the genetic regulatory mechanisms of F17 Escherichia coli diarrhea mainly focuses on host gene expression, immune pathway activation, and host gene-F17 Escherichia coli interactions. However, the function and related molecular regulatory mechanisms of non-coding RNAs, especially long non-coding RNAs (lncRNAs), in the occurrence and development of F17 Escherichia coli diarrhea remain unclear.
[0004] Although a large number of lncRNAs involved in the regulation of diarrheal disease occurrence and development have been discovered and identified in species such as humans, mice, pigs, and dairy cows, such as FUT3-AS1, IALNCR, and XR_001779380, there are still few reports on the identification and functional analysis of sheep diarrheal disease-related lncRNAs. Summary of the Invention
[0005] This invention addresses the technical problem at hand and overcomes the shortcomings of existing technologies by providing a lncRNA related to sheep's resistance to F17 Escherichia coli diarrhea and its application.
[0006] One of the objectives of this invention is to provide a lncRNA associated with sheep resistance to F17 Escherichia coli diarrhea, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0007] A lncRNA associated with sheep resistance to F17 Escherichia coli diarrhea was named lncRNA DRB1-AS1. Its expression in the jejunum of F17 E. coli-antagonistic sheep was significantly higher than that in F17 E. coli-susceptible sheep, and its expression was significantly upregulated in a primary small intestinal epithelial cell model challenged with F17 E. coli. This indicates that lncRNA DRB1-AS1 is induced during F17 E. coli infection of the sheep small intestine and, to some extent, enhances sheep's resistance to F17 E. coli, participating in the host immune protection mechanism during the occurrence and development of sheep diarrhea. The discovery of lncRNA DRB1-AS1 contributes to understanding the molecular regulatory mechanisms of sheep resistance to F17 E. coli and the development of diarrhea, laying a theoretical foundation for developing molecular therapeutic targets and disease-resistant breeding sites for sheep diarrhea, and has significant application prospects.
[0008] The second objective of this invention is to provide a method for preparing lncRNA related to sheep resistance to F17 Escherichia coli diarrhea, comprising: using Total RNA from normal sheep small intestinal tissue as a template, and performing full-length amplification of the lncRNA DRB1-AS1 related to sheep resistance to F17 Escherichia coli diarrhea.
[0009] The further optimized technical solution of this invention is as follows:
[0010] The lncRNA related to sheep F17 Escherichia coli diarrhea provided by this invention is named DRB1-AS1, and its full-length sequence is shown in SEQ ID NO.1. The amplification primer pair for the full-length DRB1-AS1 sequence is P1, and its nucleotide sequence is as follows:
[0011] Upstream primer P1-F: AAGCTTGAGGAGATGTCTACACCTGCCG;
[0012] Downstream primer P1-R: GGATCCGATCTCAGAGGAACAGGCTGACA.
[0013] In the above method for preparing lncRNA related to sheep resistance to F17 Escherichia coli diarrhea, the sample tested by the reagents was normal sheep small intestinal tissue.
[0014] The above-mentioned method for preparing lncRNA related to sheep resistance to F17 Escherichia coli diarrhea is as follows: sheep small intestinal epithelial tissue is cultured in primary culture, purified, and passaged to obtain sheep primary small intestinal epithelial cells. The siRNA of sheep F17 Escherichia coli diarrhea resistance-related lncRNA is transfected into the sheep primary small intestinal epithelial cells, and the cellular RNA is extracted to obtain knocked-down sheep resistance to F17 Escherichia coli diarrhea-related lncRNA.
[0015] The above-mentioned method for preparing lncRNA related to sheep resistance to F17 Escherichia coli diarrhea, wherein the nucleotide sequence of the siRNA is as follows:
[0016]
[0017] This invention provides interfering siRNA for lncRNA DRB1-AS1, with the sequence P3, for detecting the immune protective function of lncRNA DRB1-AS1 in sheep's resistance to F17 Escherichia coli and in the occurrence and development of diarrheal diseases.
[0018] A third objective of this invention is to provide a detection amplification primer for detecting the expression level of lncRNA related to resistance to Escherichia coli diarrhea in sheep F17, the nucleotide sequence of which is as follows:
[0019] Upstream primer P2-F: ACCCCAGCCTCCAGAGTCCC;
[0020] Downstream primer P2-R: CACGAAGCCCCCAACACCAC.
[0021] This invention detected the expression level of lncRNA DRB1-AS1, and the primer pair for real-time quantitative PCR amplification was P2. Preferably, the samples tested by the reagent were F17 Escherichia coli antagonistic sheep small intestine tissue and F17 Escherichia coli susceptible sheep small intestine tissue.
[0022] The fourth objective of this invention is to provide a real-time quantitative primer pair for detecting the expression level of a pathogenic factor associated with sheep F17 Escherichia coli, wherein the pathogenic factor associated with sheep F17 Escherichia coli is the adhesion subunit F17G; the real-time quantitative primer pair for the adhesion subunit F17G includes:
[0023] Upstream primer P4-F: CTGGGAAATTATCTATCAACG;
[0024] Downstream primer P4-R: TGTTGATATTCCGTTAACCGTAC.
[0025] This invention detected the expression level of the adhesion subunit F17G, a pathogenic factor associated with F17 Escherichia coli, using the P4 primer sequence for real-time quantitative PCR. Preferably, the sample tested was sheep primary small intestinal epithelial cells; more preferably, sheep primary small intestinal epithelial cells were transfected with lncRNA DRB1-AS1 siRNA for 36 hours.
[0026] The present invention also provides the application of the lncRNA related to sheep resistance to F17 Escherichia coli diarrhea in the prevention or treatment of sheep F17 Escherichia coli diarrhea.
[0027] The present invention also provides the application of the lncRNA related to sheep resistance to F17 Escherichia coli diarrhea in the preparation of anti-inflammatory drugs for sheep diarrhea.
[0028] The present invention also provides the application of the lncRNA related to sheep resistance to F17 Escherichia coli diarrhea in sheep diarrhea resistance breeding.
[0029] The beneficial effects of the present invention are as follows:
[0030] This invention utilizes high-throughput sequencing technology to analyze and compare the differences in gene expression profiles between F17 Escherichia coli antagonistic sheep jejunal tissue and F17 Escherichia coli susceptible sheep jejunal tissue. A key lncRNA was identified and screened, which was significantly upregulated in F17 Escherichia coli antagonistic sheep jejunum. Real-time quantitative PCR experiments further verified that the lncRNA was significantly upregulated in a primary sheep small intestinal epithelial cell model infected with F17 Escherichia coli. The full-length sequence of the lncRNA was amplified and named DRB1-AS1 (DRB1 antisense RNA 1).
[0031] Subsequently, this invention further synthesized the lncRNA DRB1-AS1 siRNA fragment, transfected it into sheep primary small intestinal epithelial cells, and challenged them with F17 Escherichia coli. The effect of DRB1-AS1 knockdown on the resistance of sheep primary small intestinal epithelial cells to F17 E. coli was examined. It was found that downregulation of lncRNA DRB1-AS1 expression reduced the adhesion resistance of sheep primary small intestinal epithelial cells to F17 E. coli. The results indicate that lncRNA DRB1-AS1 is induced during F17 E. coli infection of the sheep small intestine and, to some extent, enhances sheep's resistance to F17 E. coli, participating in the host immune protection mechanism during the occurrence and development of sheep diarrhea.
[0032] Therefore, the discovery of lncRNA DRB1-AS1 in this invention helps to understand the molecular regulatory mechanism of sheep's resistance to Escherichia coli F17 and the occurrence and development of diarrheal diseases, and lays a theoretical foundation for the development of molecular therapeutic targets and disease-resistant breeding sites for sheep diarrheal diseases, which has important application prospects. Attached Figure Description
[0033] Figure 1 These are animal and small intestinal tissue models of sheep with F17 Escherichia coli antagonistic type (A) and F17 Escherichia coli susceptible type (B) in this invention.
[0034] Figure 2 This is a distribution map of differentially expressed lncRNAs in F17 Escherichia coli antagonistic sheep small intestinal tissue and F17 Escherichia coli susceptible sheep small intestinal tissue, screened by high-throughput sequencing technology in this invention.
[0035] Figure 3 This is a gel electrophoresis image showing the full-length amplification results of lncRNA in this invention.
[0036] Figure 4 This diagram illustrates the expression levels of lncRNADRB1-AS1 in F17 Escherichia coli antagonistic sheep small intestinal tissue (AN) and F17 Escherichia coli susceptible sheep small intestinal tissue (SE) in this invention.
[0037] Figure 5 This diagram illustrates the expression levels of lncRNADRB1-AS1 in primary sheep small intestinal epithelial cells challenged with E. coli F17 and untreated primary sheep small intestinal epithelial cells (NC) in this invention.
[0038] Figure 6 This diagram illustrates the effect of interfering with lncRNA DRB1-AS1 on the adhesion of F17 Escherichia coli to sheep primary small intestinal epithelial cells in this invention. In the diagram, A represents the expression of the F17G adhesion subunit, a pathogenic factor of F17 Escherichia coli; B represents the colony count of F17 Escherichia coli adhering to sheep primary small intestinal epithelial cells; and C represents immunofluorescence staining of F17 Escherichia coli (100x magnification). Detailed Implementation
[0039] The technical solution of the present invention will be further described in detail below with reference to the embodiments: This embodiment is implemented under the premise of the technical solution of the present invention, and provides detailed implementation methods and specific operation processes, but the protection scope of the present invention is not limited to the following embodiments.
[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0041] Unless otherwise specified, the reagents and materials involved in the following examples can be obtained by the public from domestic and foreign commercial channels or other free channels, and will not be described in detail here.
[0042] The invention relates to, such as Figure 1The F17 E. coli antagonistic sheep and F17 E. coli susceptible sheep animal and small intestinal tissue models shown were successfully constructed and preserved in our laboratory in the previous period. For details on the construction methods of the F17 E. coli antagonistic sheep and F17 E. coli susceptible sheep animal and small intestinal tissue models, please refer to Changes in long non-coding RNA expression profiles related to the antagonistic effects of Escherichiacoli F17 on lamb spleens (Jin, C., Bao, J., Wang, Y. et al. Changes in long non-coding RNA expression profiles related to the antagonistic effects of Escherichia coli F17 on lamb spleens. Sci Rep 8, 16514 (2018). https: / / doi.org / 10.1038 / s41598-018-34291-0, https: / / www.nature.com / articles / s41598-018-34291-0).
[0043] Example 1: Extraction of total RNA and synthesis of first-strand cDNA from samples
[0044] 1. After slaughtering sheep, small intestinal tissue samples were quickly collected, cut into small pieces, and placed into 2mL cryovials. These samples were then frozen in liquid nitrogen and transferred to a -80℃ freezer for long-term storage for total RNA extraction. lncRNAs in the small intestinal tissues of F17 Escherichia coli antagonistic and F17 Escherichia coli susceptible sheep were identified, and the lncRNA expression profiles in the small intestinal tissues were analyzed. Six replicates were set for each sample. Results are as follows: Figure 2 As shown.
[0045] 2. Total RNA was extracted from sheep small intestine tissue using the TRNzol Universal Total RNA Extraction Reagent (catalog number DP424) from Tiangen Biotech (Beijing) Co., Ltd., following these steps:
[0046] (1) Take 100 mg of jejunal tissue into a mortar and grind the sample into powder using a pestle while continuously adding liquid nitrogen. Then add the powder into a 2 mL enzyme-free centrifuge tube.
[0047] (2) Add 1 mL of Trizol to lyse the sample and let it stand at 4°C for 5 min;
[0048] (3) Add 500 μL of chloroform to the centrifuge tube, shake for 20 seconds until the liquid becomes milky, let stand on ice for 5 minutes, and then centrifuge at 12000 rpm for 15 min in a pre-cooled centrifuge at 4℃.
[0049] (4) Transfer the upper aqueous phase to a new 1.5 mL centrifuge tube and add the same volume of -20 °C pre-cooled isopropanol. Let stand at room temperature for 10 minutes.
[0050] (5) Centrifuge at 12000 rpm for 10 min in a centrifuge pre-cooled at 4℃, and discard the supernatant;
[0051] (6) Add 1 mL of 75% ethanol pre-cooled at -20℃ for washing, centrifuge at 7500 rpm for 5 min in a centrifuge pre-cooled at 4℃, and discard the supernatant.
[0052] (7) Use a pipette to remove the residual ethanol, and place the centrifuge tube containing the precipitate on ice to dry for 5 minutes.
[0053] (8) Add 100 μL of RNase-free water and dissolve thoroughly;
[0054] (9) The concentration and purity of RNA in the solution were measured by a micro-ultraviolet spectrophotometer, and the integrity of RNA was checked by 1.5% agarose gel electrophoresis. The RNA was stored at -80℃ for later use.
[0055] 3. Using extracted small intestinal tissue RNA as a template, cDNA first-strand synthesis was performed (on ice) according to the FastKing one-step genomic cDNA first-strand synthesis premix reagent (catalog number KR118) from Tiangen Biotech (Beijing) Co., Ltd., as follows:
[0056] (1) Prepare the gDNA removal reaction system mixture
[0057]
[0058] Mix the mixture thoroughly, centrifuge briefly, place at 42°C for 3 minutes, and then place on ice.
[0059] (2) Configure the reverse transcription reaction system
[0060]
[0061] (3) Add the reaction solution from step (2) to the mixture from step (1) and mix thoroughly.
[0062] (4) Incubate at 42℃ for 15 min; at 95℃ for 3 min, place on ice for subsequent RT-qPCR detection.
[0063] Example 2: Full-length amplification of lncRNA DRB1-AS1
[0064] 1. Using sheep small intestine tissue cDNA as a template, the full-length DRB1-AS1 sequence was obtained by PCR amplification: referring to Primer from Baori Biotechnology (Beijing) Co., Ltd. PCR amplification was performed using Max DNA Polymerase (catalog number R045Q) reagent, following these steps:
[0065] (1) Preparation of the reaction system mixture
[0066] PCR reaction system (50 μL):
[0067]
[0068]
[0069] (2) PCR reaction
[0070] PCR reaction conditions: 98℃ for 10s, 58℃ for 5s, 72℃ for 5s, 34 cycles.
[0071] 2. Agarose gel electrophoresis
[0072] 5 μL of the PCR product was subjected to agarose gel electrophoresis, and the results are as follows. Figure 3 As shown.
[0073] Example 3: Expression level of lncRNA DRB1-AS1
[0074] 1. Detection of lncRNA DRB1-AS1 expression level in jejunal tissue of F17 Escherichia coli susceptible / antagonistic lambs
[0075] 1.1 Take out the stored F17 Escherichia coli susceptible / antagonistic lamb jejunal tissue RNA sample and perform cDNA first strand synthesis. The specific steps are the same as in Example 1.
[0076] 1.2 Using tissue cDNA as a template, the expression level of lncRNA DRB1-AS1 was detected by RT-qPCR using the SuperReal Quantitative Real-Time Premixed Reagent Enhanced Version (SYBR Green) reagent (catalog number FP205) from Tiangen Biotech (Beijing) Co., Ltd. The steps are as follows:
[0077] (1) Primer design
[0078] In the above reaction, the primer for DRB1-AS1 is P2, and its sequence and the primer sequence for the internal reference gene GAPDH are as follows:
[0079] P2-F:GATGTGATAGGGACCAGGCG
[0080] P2-R:CCTGTCTCAAGCGTCACCAT
[0081] GAPDH-F:GTCGGAGTGAACGGATTTGG
[0082] GAPDH-R:CATTGATGACGAGCTTCCCG
[0083] (2) Preparation of the reaction system mixture
[0084]
[0085]
[0086] (3) RT-PCR reaction
[0087] RT-PCR reaction conditions: pre-denaturation at 95℃ for 5 min, followed by 40 cycles of reaction (95℃ for 10 s, 60℃ for 30 s).
[0088] SYBR Green was used as a fluorescent label, and PCR reactions were performed on a real-time quantitative PCR instrument. The target band was determined by melting curve analysis and electrophoresis. -ΔΔ(CT) The method is used for relative quantitative analysis.
[0089] (4) Statistical methods
[0090] The experiment was performed in six replicates. Results are presented as mean ± standard error. All data were analyzed using SPSS software (v25.0), and differences were tested using the T-test. A p-value < 0.05 was considered statistically significant. Results are as follows: Figure 4 As shown.
[0091] 2. Detection of lncRNA DRB1-AS1 expression level in jejunal tissue of F17 Escherichia coli susceptible / antagonistic lambs
[0092] 2.1 Primary Culture of Sheep Small Intestinal Epithelial Cells
[0093] Primary culture of sheep small intestinal epithelial cells was performed using the tissue block culture method. The specific steps are as follows:
[0094] (1) Select healthy newborn lambs aged 3-5 days, euthanize them, cut about 5g of small intestine tissue, put it into the prepared DMEM / F12 complete culture medium (30% fetal bovine serum, 150U / mL penicillin and streptomycin), and quickly bring it back to the laboratory for further processing.
[0095] (2) Rinse the intestinal tissue repeatedly with PBS buffer (150 U / mL penicillin and streptomycin), remove intestinal contents, connective tissue, and adipose tissue using sterile forceps, transfer the tissue to a new culture dish, and then wash the tissue repeatedly with serum-free DMEM / F12 medium until the supernatant is clear and free of impurities. Cut the tissue into pieces <1 mm with small scissors. 3 Fragments.
[0096] (3) Transfer the tissue to a 2mL centrifuge tube, centrifuge at 130g for 5min, discard the supernatant, and repeat the above process 2-3 times until the supernatant is clear.
[0097] (4) Add DMEM / F12 complete culture medium containing 10% fetal bovine serum to suspend the tissue blocks, and use a flared pipette to transfer the tissue blocks into a T25 cell culture flask. Incubate with 5% CO2. 2 The cells are cultured in a saturated humidity incubator, with the medium changed every other day.
[0098] (5) After the cells have grown out of the tissue block, remove the tissue block.
[0099] Based on the different sensitivities of small intestinal epithelial cells and fibroblasts to pancreatic digestive enzymes, and the different adhesion rates of these two cells, a time-differential digestion / adhesion method was used to purify primary sheep small intestinal epithelial cells. The specific steps are as follows:
[0100] (1) When the primary sheep small intestinal epithelial cells reach 80% growth density, discard the culture medium and wash the cells 1-2 times with Ca2+- and Mg2+-free PBS. Then add a mixture of trypsin and EDTA to digest the cells for 2 minutes.
[0101] (2) Discard the digestion solution, rinse the cells 1-2 times with PBS free of Ca2+ and Mg2+, add the mixed digestion solution of trypsin and EDTA again, and stop digestion after 3-5 minutes of digestion.
[0102] (3) Transfer the cell suspension into a T25 cell culture flask and place it in a 5% CO2 atmosphere. 2 The cells were cultured in a saturated humidity incubator and the cell suspension was removed after 15 minutes.
[0103] (4) Transfer the cell suspension back into a new T25 cell culture flask and place it in 5% CO2. 2 The cells are cultured in a saturated humidity incubator, with the medium changed every other day.
[0104] (5) Repeat steps (1)-(4) 3-5 times to obtain purified sheep primary small intestinal epithelial cells.
[0105] 2.2 F17 Escherichia coli cell challenge experiment
[0106] Purified sheep primary small intestinal epithelial cells were used to challenge F17 Escherichia coli cells. The specific steps are as follows:
[0107] (1) Take the frozen F17 Escherichia coli (DN1401, fimbrial structure subtype: F17b, fimbrial adhesion subtype: type II) out of the ultra-low temperature freezer, thaw it in an ice bath, take 1 μL of bacterial solution, spread it evenly on the pre-sterilized solid LB medium, and put it in a constant temperature incubator for overnight inversion at 37°C.
[0108] (2) Using a sterile pipette tip, pick a single colony of F17 Escherichia coli and transfer it into a 2 mL sterile centrifuge tube containing antibiotic-free liquid LB medium. Incubate at 37°C and 200 rpm for 2–4 hours in a constant temperature shaker.
[0109] (3) Small intestinal epithelial cells were starved for 8 hours in DMEM / F12 medium without FBS and antibiotics.
[0110] (4) Add F17 Escherichia coli culture to the treatment wells at a multiplicity of infection (MOI) of 1:100, incubate at 37°C for 3 hours, then extract RNA and reverse transcribe it into cDNA first strand. The specific steps are the same as in Example 1.
[0111] 2.3 Detection of DRB1-AS1 expression
[0112] Using cDNA from F17 challenged sheep primary small intestinal epithelial cells and untreated sheep primary small intestinal epithelial cells as templates, RT-qPCR was used to detect DRB1-AS1 expression. The specific steps were the same as in Part 1 of Example 3, and the results are as follows. Figure 5 As shown.
[0113] The expression detection results of DRB1-AS1 showed that DRB1-AS1 was significantly upregulated in the jejunum of sheep infected with F17 Escherichia coli. Real-time quantitative PCR experiments further verified that the lncRNA was significantly upregulated in the sheep primary small intestinal epithelial cell model infected with F17 Escherichia coli. This indicates that lncRNA DRB1-AS1 is induced to express during the infection of sheep small intestine by F17 Escherichia coli and, to a certain extent, enhances the resistance of sheep to F17 Escherichia coli, participating in the host immune protection mechanism in the occurrence and development of sheep diarrhea.
[0114] Example 4: Synthesis and Transfection of lncRNA DRB1-AS1 siRNA
[0115] 1. Design and synthesis of lncRNA DRB1-AS1 siRNA
[0116] Based on the full-length lncRNA BMNCR sequence, lncRNA BMNCR siRNA sequences were designed. All siRNAs were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd., and the nucleotide sequences are P4 sequences, as follows:
[0117]
[0118] 2. Transfection experiment of sheep primary small intestinal epithelial cells
[0119] The specific steps for the recovery and culture of primary sheep small intestinal epithelial cells are as follows:
[0120] (1) Remove the frozen small intestinal epithelial cells from liquid nitrogen and quickly place them in a 37°C constant temperature water bath, shaking them continuously until they thaw.
[0121] (2) Transfer the thawed cells (~1 mL) to a sterile 2 mL centrifuge tube, add an equal volume of complete culture medium (DMEM / F12 containing 10% FBS and 1% penicillin-streptomycin antibiotics), gently pipette to mix, then centrifuge at 1200 rpm at room temperature for 10 min and discard the supernatant.
[0122] (3) Add 1 mL of complete culture medium to the centrifuge tube, resuspend the cells, transfer them evenly to the T25 cell culture flask, and then add 4 mL of complete culture medium.
[0123] (4) Place the culture flask in a 37°C constant temperature cell culture incubator (5% CO2) and change the culture medium every 24 hours.
[0124] (5) When the cells grow to a density of 80% to 90%, passage them, discard the culture medium, gently wash the cells with PBS buffer containing 1% penicillin-streptomycin, and discard the PBS.
[0125] (6) Add 1 mL of trypsin, place in a cell culture incubator to digest for 5 min, then add an equal volume of complete culture medium to stop digestion, and gently blow the adherent cells until they detach.
[0126] (7) Transfer all the liquid to a 2mL sterile centrifuge tube, centrifuge at 1200rpm for 10min at room temperature, and discard the supernatant.
[0127] After resuscitation, sheep small intestinal epithelial cells were transferred to 6-well cell culture plates and cultured to approximately 70% confluency. siRNA transfection was then performed, following these steps:
[0128] (1) Dissolve 20 pmol siRNA in 50 μL serum-free culture medium (preheated to 37°C before use).
[0129] (2) Dissolve 1 μL of Lipo2000 in 50 μL of serum-free culture medium (preheated at 37°C before use), mix well and let stand at room temperature for 5 min.
[0130] (3) Mix the diluted siRNA and lipo2000 in the two tubes above, let stand at room temperature for 20 minutes, and then gently add them to a 6-well cell culture plate.
[0131] (4) After culturing for 6 hours, replace with complete culture medium containing serum.
[0132] (5) The inhibition effect of lncRNADRB1-AS1 was detected by RT-qPCR method, and the RT-qPCR method in Example 3 is referred to in detail.
[0133] Example 5: Effect of interfering with lncRNA DRB1-AS1 on the adhesion of F17 Escherichia coli to sheep primary small intestinal epithelial cells
[0134] 1. F17 Escherichia coli challenge DRB1-AS1 knockdown in sheep primary small intestinal epithelial cells
[0135] According to Example 4, sheep primary small intestinal epithelial cells were transfected with lncRNA DRB1-AS1 siRNA for 36 hours, and then challenged with F17 Escherichia coli cells. The specific steps were the same as in Example 3.
[0136] DNA was extracted from F17 Escherichia coli adhering to sheep small intestinal epithelial cells using the bacterial genomic DNA extraction kit (catalog number DP302) from Tiangen Biotech (Beijing) Co., Ltd. The specific steps are as follows:
[0137] (1) Discard the liquid in the cell culture plate, gently rinse 3 times with PBS buffer to remove floating bacteria, 5 min each time.
[0138] (2) Add 1 mL of PBST solution (0.5% Triton X-100, dissolved in PBS) to each well and permeate the small intestinal epithelial cells in a constant temperature incubator at 37°C for 30 min, so that the F17 Escherichia coli adhering to the sheep small intestinal epithelial cells can enter the lysis buffer.
[0139] (3) After permeabilization, transfer all liquid to a 2 mL sterile centrifuge tube, wash the remaining part in the well three times with 1 mL PBS buffer, transfer it to a centrifuge tube, centrifuge at 10,000 rpm for 1 min, and discard the supernatant.
[0140] (4) Add 200 μL of buffer GA to the precipitate and shake until completely suspended.
[0141] (5) Add 20 μL of Proteinase K solution to the centrifuge tube and mix well.
[0142] (6) Add 220 μL of buffer GB, shake for 15 seconds, place at 70°C for 10 minutes. The solution should become clear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.
[0143] (7) Add 220 μL of anhydrous ethanol and shake well for 15 seconds. At this time, flocculent precipitate may appear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.
[0144] (8) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (place the adsorption column in the collection tube), centrifuge at 12,000 rpm (~13,400 x g) for 30 s, discard the waste liquid, and place the adsorption column CB3 into the collection tube.
[0145] (9) Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and put the adsorption column CB3 into the collection tube.
[0146] (10) Add 600 μL of washing solution PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and put the adsorption column CB3 into the collection tube.
[0147] (11) Repeat step (10).
[0148] (12) Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to thoroughly dry any remaining rinsing liquid in the adsorption material.
[0149] (13) Transfer the adsorption column CB3 into a clean centrifuge tube, add 50-200 μL of elution buffer TE to the middle of the adsorption membrane, let it stand at room temperature for 2-5 min, centrifuge at 12,000 rpm (~13,400 x g) for 2 min, and collect the solution into the centrifuge tube.
[0150] (14) Use a spectrophotometer to detect the concentration of the extracted DNA.
[0151] 2. Effects of DRB1-AS1 knockdown on resistance of sheep primary small intestinal epithelial cells to F17 Escherichia coli
[0152] 2.1 Detection of the expression of the F17G adhesion subunit of the pathogenic factor in Escherichia coli.
[0153] Using the F17 E. coli DNA extracted in Part 1 as a template, the expression of the F17G adhesion subunit, a pathogenic factor of F17 E. coli, was detected. The specific steps are as follows:
[0154] (1) The adhesion subunit F17G of E. coli F17 was quantified using RT-qPCR, with GAPDH as the internal reference gene. Primers were used as described in Example 3. The specific nucleotide sequences of the F17G primers are as follows:
[0155]
[0156] (2) The specific steps and statistical methods for the RT-qPCR reaction were as described in Example 3, and the results are as follows: Figure 6 As shown in A.
[0157] 2.2 F17 Escherichia coli colony count
[0158] The specific steps for counting colonies of F17 Escherichia coli adhering to sheep primary small intestinal epithelial cells are as follows:
[0159] (1) Discard the liquid in the cell culture plate, gently rinse 3 times with PBS buffer to remove floating bacteria, 5 min each time.
[0160] (2) Add 1 mL of PBST solution (0.5% Triton X-100, dissolved in PBS) to each well, and permeate the small intestinal epithelial cells in a 37°C incubator for 30 min to allow the F17 Escherichia coli adhering to the sheep small intestinal epithelial cells to enter the lysis buffer.
[0161] (3) After permeabilization, transfer all liquid to a 2mL sterile centrifuge tube, then wash the remaining part in the well three times with 1mL PBS buffer and transfer it to a centrifuge tube.
[0162] (4) The collected liquid was serially diluted (10 times) 7 (Multiplier), take 10 μL and spread it onto LB agar plates, incubate at 37°C, and count the colonies after 16 hours. Each sample was tested in triplicate, and the mean colony count was calculated. The results are as follows: Figure 6 As shown in B.
[0163] 2.3 Immunofluorescence observation of Escherichia coli F17
[0164] The specific steps for immunofluorescence staining are as follows:
[0165] (1) Discard the liquid in the cell culture plate, gently rinse 3 times with PBS buffer to remove floating bacteria, 5 min each time.
[0166] (2) Fix with 4% paraformaldehyde for 15 min, then gently rinse three times with PBS buffer for 5 min each time.
[0167] (3) Add 1 mL of PBST solution (0.5% Triton X-100, dissolved in PBS) to each well and permeate for 10 min. Then gently rinse once with PBS buffer for 5 min.
[0168] (4) Add 1 mL of PBST solution containing 10% goat serum to each well and block at room temperature for 45 min.
[0169] (5) Dilute the E. coli primary antibody in PBST solution containing 10% goat serum according to its instructions, add it to each well, and incubate overnight at 4°C.
[0170] (6) Gently rinse three times with BSA solution (1% bovine serum albumin, dissolved in PBS), each time for 5 minutes.
[0171] (7) Dilute the fluorescent secondary antibody in PBST solution containing 10% goat serum according to its instructions, add it to each well, incubate at 37°C in the dark for 1 hour, and gently rinse 3 times with PBS buffer for 5 minutes each time.
[0172] (8) Add 1 mL of DAPI to each well, incubate at room temperature for 5 min, and gently rinse 3 times with PBS buffer for 5 min each time.
[0173] (9) Imaging was performed using a fluorescence inverted microscope, and the results are as follows: Figure 6 As shown in C.
[0174] The expression of the F17 coli pathogenic factor adhesion subunit F17G showed that, compared with the empty vector group (NC group), the expression of the F17 fimbriae adhesion subunit F17G in the DRB1-AS1 interference group (siDRB1-AS1 group) was 4 times that in the NC group, which was significantly higher than that in the NC cells (P<0.01). This indicates that downregulation of DRB1-AS1 expression can increase the expression of the F17 fimbriae adhesion subunit F17G.
[0175] The colony count results of F17 Escherichia coli adhering to sheep primary small intestinal epithelial cells showed that, compared with the empty vector group (NC group), the number of F17 Escherichia coli adhering to the DRB1-AS1 interference group (siDRB1-AS1 group) was about 1.5 times that adhering to the NC group, which was significantly higher than that of the empty vector group (P<0.01).
[0176] Immunofluorescence staining results showed that, compared with the empty vector group (NC group), a large number of F17 Escherichia coli adhered and a large number of apoptotic cells were observed in the DRB1-AS1 interference group (siDRB1-AS1 group).
[0177] In summary, lncRNA DRB1-AS1 is induced to express during E. coli infection of the sheep small intestine and participates in the host immune protection mechanism during the occurrence and development of sheep diarrhea. Furthermore, downregulation of DRB1-AS1 expression can reduce the adhesion resistance of sheep primary small intestinal epithelial cells to E. coli F17.
[0178] This invention, through high-throughput sequencing and in vitro validation experiments, discovered that DRB1-AS1 is induced to express during E. coli infection of the sheep small intestine, participating in the host immune protection mechanism during the occurrence and development of sheep diarrhea. It demonstrates that downregulation of DRB1-AS1 expression can reduce the adhesion resistance of sheep primary small intestinal epithelial cells to E. coli. The discovery of DRB1-AS1 contributes to understanding the molecular regulatory mechanisms of sheep resistance to E. coli and the development of diarrhea, laying a theoretical foundation for developing molecular therapeutic targets and disease-resistant breeding sites for sheep diarrhea. This invention provides a DRB1-AS1 associated with sheep resistance to E. coli diarrhea. Furthermore, it provides methods for preparing and applying DRB1-AS1 in the prevention or treatment of sheep E. coli diarrhea, anti-inflammatory drug development, or disease-resistant breeding of sheep diarrhea, demonstrating extremely high market potential.
[0179] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any transformations or substitutions that can be conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. A lncRNA associated with sheep resistance to F17 Escherichia coli diarrhea, characterized in that, The nucleotide sequence of the lncRNA DRB1-AS1, which is associated with sheep resistance to F17 Escherichia coli diarrhea, is shown in SEQ ID NO.
1.
2. The method for preparing lncRNA related to sheep resistance to F17 Escherichia coli diarrhea as described in claim 1, characterized in that, Using total RNA from normal sheep small intestinal tissue as a template, the full-length LncRNA DRB1-AS1, which is related to sheep's resistance to F17 Escherichia coli diarrhea, was amplified.
3. A method for preparing lncRNA related to sheep resistance to F17 Escherichia coli diarrhea according to claim 2, characterized in that, The primer pair used to amplify LncRNA DRB1-AS1 has the following nucleotide sequence: Upstream primer P1-F: AAGCTTGAGGAGATGTCTACACCTGCCG; Downstream primer P1-R: GGATCCGATCTCAGAGGAACAGGCTGACA.
4. The method for preparing lncRNA related to sheep resistance to F17 Escherichia coli diarrhea according to claim 2, characterized in that, After primary culture, purification, and passage culture of sheep small intestinal epithelial tissue, sheep primary small intestinal epithelial cells were obtained. The cells were then transfected with siRNA containing lncRNA related to resistance to Escherichia coli F17 diarrheal disease. Cellular RNA was extracted to obtain knocked-down sheep lncRNA related to resistance to E. coli F17 diarrheal disease.
5. The method for preparing lncRNA related to sheep resistance to F17 Escherichia coli diarrhea according to claim 4, characterized in that, The nucleotide sequence of the siRNA is as follows: 。 6. A detection and amplification primer for detecting the expression level of lncRNA related to resistance to Escherichia coli diarrhea in sheep F17, characterized in that, The nucleotide sequences of the LncRNA detection amplification primers are as follows: Upstream primer P2-F: ACCCCAGCCTCCAGAGTCCC; Downstream primer P2-R: CACGAAGCCCCCAACACCAC.
7. The use of the sheep resistance-associated lncRNA to F17 Escherichia coli diarrhea as described in claim 2 or 6 in the preparation of drugs for the prevention or treatment of sheep F17 Escherichia coli diarrhea.
8. The use of the sheep resistance-associated lncRNA to F17 Escherichia coli diarrhea as described in claim 2 or 6 in the preparation of an anti-inflammatory drug for sheep diarrhea.
9. The use of the sheep resistance-associated lncRNA to F17 Escherichia coli diarrhea as described in claim 2 or 6 in the preparation of products for sheep diarrhea resistance breeding.