Application of MYC3 transcription factor in plant antagonism of low phosphorus stress

Abstract

The invention discloses an application of an MYC3 transcription factor in plant antagonism of low phosphorus stress, and relates to the technical field of screening of transcription factors related to low phosphorus stress. A bHLH family transcription factor MYC3 capable of interacting with MPK3 and MPK6 respectively is screened by utilizing a yeast two-hybrid system; through MYC3 deletion mutation and MYC3 overexpression, the effect of the transcription factor under low phosphorus stress is verified, and it is indicated that under low phosphorus stress, the transcription factor MYC3 induces expression of a WRKY75 promoter, so that plants cope with low phosphorus stress.

Description

Technical Field

[0001] The invention relates to the technical field of screening transcription factors related to low-phosphorus stress, and more specifically to the application of MYC3 transcription factor in plant antagonism to low-phosphorus stress. Background Art

[0002] Phosphorus (P) is one of the important macroelements in organisms. It is a key structural component and participates in intracellular signal transduction and energy metabolism. The phosphorus nutrition available to plants in the soil is extremely limited, which seriously restricts the development of agricultural production. In order to adapt to low-phosphorus stress, plants have evolved physiological and biochemical coping strategies and integrated phosphorus signal perception and transduction systems through complex mechanisms to maintain the balance of phosphorus metabolism in the body. In recent years, many important breakthroughs have been made in related research fields, mainly focusing on long-distance signals of low-phosphorus stress, signal transduction components and related regulatory elements. However, research on the mechanism of phosphorus signal receptors and signal transduction systems is still very limited.

[0003] Previous studies have found that the activation of the Arabidopsis MKK9-MPK3 / MPK6 cascade signaling system positively regulates phosphorus absorption in seedlings. The transcription factor WRKY75, which is induced during low-phosphorus stress, is downstream of this regulation process but is not a direct substrate of MPK3 / MPK6. MPK3 / MPK6 regulates many pathways, and its complex and diverse substrates and substrate recognition methods enable it to play a variety of functions and enhance plant adaptability. At present, the mechanism by which the MKK9-MPK3 / MPK6 cascade regulates WRKY75 promoter activity is still unclear.

[0004] Therefore, it is an urgent problem for those skilled in the art to screen for transcripts that can interact with MPK3 / MPK6 and explore whether the transcripts regulate the expression of the WRKY75 promoter. Summary of the invention

[0005] In view of this, the present invention provides the use of MYC3 transcription factor in plants antagonizing low-phosphorus stress.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] In one aspect, an embodiment of the present invention provides a use of MYC3 transcription factor, and the use includes the following aspects:

[0008] 1) Use of overexpressed MYC3 transcription factor in plants to antagonize low phosphorus stress;

[0009] 2) Overexpression of MYC3 transcription factor promotes the expression of WRKY75 gene under low-phosphorus conditions;

[0010] 3) Knocking out the MYC3 transcription factor reduced the plant's ability to resist low-phosphorus stress. Under low-phosphorus conditions, the expression level of the WRKY75 gene decreased.

[0011] Preferably, the CDS sequence of the MYC3 transcription factor is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO.2.

[0012] Preferably, the MYC3 transcription factor binds to the cis-acting element CACGTG in the sequence 1488 bp to 1696 bp upstream of the WRKY75 start codon.

[0013] A second aspect of an embodiment of the present invention provides a method for improving the ability of plants to resist low-phosphorus stress, wherein the MYC3 gene is transformed into competent cells, and then the plants are infected, so that the MYC3 gene in the plants is overexpressed.

[0014] Through the above technical solution, it can be seen that compared with the prior art, the present invention focuses on the mechanism of downstream substrates of the MKK9-MPK3 / MPK6 cascade regulating WRKY75 transcription in the low-phosphorus response process. In order to study the mechanism of MKK9-MPK3 / MPK6 cascade regulating WRKY75 promoter activity, MKK9 DD GUS histochemical staining and enzyme activity assay of transgenic plants (MKK9 constitutively activated mutation) showed that the WRKY75 gene was regulated by low phosphorus stress and MKK9. DD The induction of MKK9 under low phosphorus stress promoted the enhancement of WRKY75 promoter activity in lateral roots. The key element of MKK9 regulating WRKY75 promoter activity is located between 1488bp and 1696bp upstream of the gene start codon. The transcription factors that may be specifically bound by the cis-acting elements on this sequence were analyzed by bioinformatics methods. The results showed that 21 transcription factors had possible MAPK phosphorylation sites and were candidates. A bHLH family transcription factor MYC3 that can interact with MPK3 and MPK6 was screened using the yeast two-hybrid system, and the role of this transcription factor under low phosphorus stress was verified by MYC3 deletion mutation and overexpression of MYC3, indicating that under low phosphorus stress, the transcription factor MYC3 induces the expression of the WRKY75 promoter to enable plants to cope with low phosphorus stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0016] Figure 1 The attached figure is a diagram showing the interaction between transcription factor MYC3 and MPK3, MPK6.

[0017] Figure 2 The attached figures are characterization diagrams of the phenotypes of wild-type (wt) and myc3 mutant seedlings under MS and LP conditions (A), the expression level of WRKY75 in WT and myc3 under LP conditions (B), phosphorus accumulation (C), and anthocyanin accumulation (D).

[0018] Figure 3 The attached figures are representation diagrams of the cis-acting element (A) and the cis-acting element region (B) to which MYC3 binds.

[0019] Figure 4 The attached figure shows the characterization of phosphorus accumulation in the roots and crowns of plants in a low-phosphorus environment after overexpressing the MYC3 transcript. DETAILED DESCRIPTION

[0020] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] Example 1 Yeast two-hybrid screening for transcription factors interacting with MPK3 and MPK6

[0022] In order to find the phosphorylation substrates of MPK3 / MPK6, 21 candidate transcription factors that may contain MAPK phosphorylation sites were selected from the transcription factors predicted to bind to the sequence 1488bp to 1696bp upstream of the start codon of the WRKY75 gene, and the yeast two-hybrid technology was used to screen the transcription factors that can interact with MPK3 and MPK6.

[0023] First, these candidate transcription factor genes were cloned into the yeast expression vector pGADT7, and 18 transcription factors were successfully constructed. Then, they were co-transformed into the competent cells of yeast strain AH109 with MPK3 and MPK6 constructed on pGBKT7, and the interacting proteins were screened on the defective amino acid plate. Since the candidate transcription factors are self-activated when connected to the yeast expression vector pGADT7, a certain concentration of 3-AT must be added on the defective amino acid plate to inhibit their self-activation. After repeated experiments, a transcription factor MYC3 ( Figure 1 ). After analysis, MYC3 has two possible MAPK phosphorylation sites.

[0024] The CDS sequence of MYC3 is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0025]

[0026] , SEQ ID NO.2.

[0027] Example 2

[0028] In order to study whether MYC3 is involved in the response to low-phosphorus stress, a myc3 deletion mutant donated by Professor Song Susheng of Capital Normal University was used to conduct a low-phosphorus transplanting experiment to observe the phenotype and determine the phosphorus content and biomass of the seedling roots and crowns.

[0029] Physiological experimental evidence that MYC3 responds to low phosphorus stress

[0030] One strategy of Arabidopsis thaliana to tolerate low phosphorus is to increase root weight and surface area, increase phosphorus absorption, and increase the expression of low phosphorus stress response genes such as WRKY75. Under low phosphorus stress, in addition to changing the root structure and increasing the root-crown ratio, the plant body will also show a series of physiological and biochemical responses, such as the accumulation of anthocyanins and starch, increasing the secretion of organic acids and acid phosphatases, improving the function of phosphorus transporters, and changing lipid composition through phospholipid metabolism. Plants can displace phosphorus chelated by metal ions in the soil by promoting the secretion of organic acids on the surface of the root system; by secreting acid phosphatases, it is beneficial to promote the degradation of organic phosphorus in the soil, thereby increasing the concentration of free phosphate around the roots. Anthocyanins will accumulate in the aboveground parts of phosphorus-deficient plants to protect chloroplasts from light inhibition.

[0031] Low phosphorus phenotype detection

[0032] First, the seedlings grown on 1 / 2MS medium for 7 days were transferred to MS and LP medium for another 7 days, and the phenotypes of wild-type (WT) and myc3 mutant seedlings under MS and LP conditions were observed and compared. Figure 2 A) and the anthocyanin accumulation in the root crown was determined ( Figure 2 Middle D), the results showed that under MS conditions, the root and crown of the myc3 mutant were larger than those of the wild type, while under LP conditions, the plant size was not significantly different from that of the wild type, and the crown turned purple, showing signs of low-P intolerance.

[0033] Phosphorus content detection

[0034] To further explore whether MYC3 plays a role in the plant's response to low phosphorus, the phosphorus content of wild-type and myc3 mutant seedlings under MS and LP conditions was determined. The seedlings grown on 1 / 2MS medium for 7 days were transferred to MS and LP medium for further growth for 7 days, and then the root and crown materials were taken to determine the phosphorus content. Under MS and LP conditions, there was no significant difference in the phosphorus content of the roots and crowns of the mutants compared with the wild type. Under MS conditions, the phosphorus content of the roots and crowns of the mutants was significantly lower than that of the wild type, while under LP conditions, the phosphorus content of the crowns of the mutants was significantly lower than that of the wild type, and there was no significant difference in the phosphorus content of the roots compared with the wild type. The above results indicate that MYC3 is involved in regulating the accumulation of phosphorus in Arabidopsis seedlings ( Figure 2 C).

[0035] MYC3 regulates the expression of WRKY75

[0036] The results of the phosphorus content experiment and the phenotypic results all showed that the phosphorus accumulation ability of the myc3 mutant material was worse than that of the wild-type material. As a transcription factor, Arabidopsis WRKY75 is induced to express under low-phosphorus conditions, so the next step is to study whether the weakened phosphorus accumulation ability of the myc3 mutant is caused by the change in the expression level of WRKY75 in the body.

[0037] The wild-type and myc3 deletion mutant seedlings were grown on 1 / 2MS medium for 7 days and then continued to grow on MS and LP conditioned medium for 7 days. RNA was extracted and reverse transcribed into cDNA. Real-time PCR was used to detect the changes in the expression of WRKY75. The primer sequences are:

[0038] WRKY75 qPCR-F GATCAGAAGGTTGTTCGAAAAGC, SEQ ID NO.3;

[0039] WRKY75 qPCR-R CTCCTAGGGAACTTGTTGTTCTTGAC, SEQ ID NO.4.

[0040] The results showed that the expression level of WRKY75 in the wild type was very low under MS conditions, but significantly increased under LP conditions. Compared with the wild type, the low-phosphorus-induced expression of WRKY75 in the myc3 mutant was inhibited, and the expression level of WRKY75 under LP conditions was significantly lower than that of the wild type ( Figure 2 This suggests that MYC3 may regulate the expression of WRKY75, and the functions they play may not be completely consistent.

[0041] Arabidopsis MYC3 is a candidate transcription factor regulating WRKY75 expression

[0042] It has been reported that MYC3 is localized in the nucleus and can directly bind to MYB and regulate its transcription to perform its function. The above results show that MYC3 may be involved in the transcriptional regulation of WRKY75 in the process of low phosphorus response. So the first question to be solved is: as a transcription factor, can MYC3 directly bind to the promoter of WRKY75? According to the information consulted, the cis-acting element that MYC3 binds to is CACGTG ( Figure 3 A in the figure). Using the AthaMap website to analyze the sequence from the start codon of the WRKY75 gene to 2000 bp upstream, it was found that this sequence may contain three cis-acting elements CACGT G that bind to the MYC transcription factor, one of which is located between Δ1100 and Δ1300 ( Figure 3B). It can be seen that there are cis-acting elements on the promoter of WRKY75 that specifically bind to MYC3 and MYC4. In order to confirm this speculation, EMSA (gel retardation assay, a commonly used in vitro verification method to prove that proteins directly bind to DNA sequences) was used for verification.

[0043] First, the full-length CDS sequence of MYC3 was connected to the expression vector pET-28a with a His tag to form the pET28a(+)-MYC-His expression vector. The fusion protein obtained by prokaryotic purification was dissolved in a buffer containing a high concentration of imidazole, which may affect the subsequent EMSA reaction, so an ultrafiltration tube was used to dissolve the fusion protein in a buffer without imidazole.

[0044] According to the results of the previous analysis of the activity of promoter truncated fragments, the sequence from 1488 bp to 1696 bp upstream of the start codon of the WRKY75 gene was further truncated into three overlapping segments, and a sequence labeled with biotin at the 5' end was designed and synthesized. The double-stranded probes were annealed and named Labeled-E6, Labeled-E7 and Labeled-E8. After incubation with MYC3 protein, EMSA experiments were performed. The results showed that MYC3 could only bind to Labeled-E6 (EMSA6-LP: GATATAGAGGCTGCGAGATGTGAAAGAAAAAAAGTG AGATTGCAAAAGAACACGTGCGTCTTCCAAGAATTTTCTTAG, SEQ ID NO.5; EMSA6-RP: CTAAGAAAATTCTTGGAAGACGCACGTGTTCTTTTG CAATCTCACTTTTTTTCTTTCACATCTCGCAGCCTCTATATC, SEQ ID NO.6) A lagging band is formed instead of Labeled-E7 (EMSA7-LP: AATTTTCTTAGGGGTT ATATAATATTCAAACATTTGATCTCTTTGATAATTGTCCAACCTTTTCTT TTTACTTTGTGCT, SEQ ID NO.7; EMSA7-RP: AGCACAAAGTAAAAAG AAAAGGTTGGACAATTATCAAAGAGATCAAATGTTTGAATATTATATAACCCCTAAGAAAATT, SEQ ID NO.8) and Labeled-E8 (EMSA8-LP: CTTT GTGCTTTTGAATGGTCAATCAAACATGGACTAACAACAGTAAATGGTG AGCTACTTTTGTTTTCCTAATTGAAATTG, SEQ ID NO.9; EMSA8-RP: CAATTTCAATTAGGAAAACAAAAGTAGCTCACCATTTACTGTTGTTAGTCCATGTTTGATTGACCATTCAAAAGCACAAAG, SEQ ID NO.10), indicating that MYC3 can only bind to Labeled-E6 containing CACGTG. In order to prove that this binding is specific, the probe Unlabeled-E6 without biotin label was synthesized and competed with the mutant probe Unlabeled-E6m with CACGTG mutated to ACCACA.The results showed that the lagging band formed by MYC3 and Labeled-E6 could be competed by excess Unlabeled-E6, but could not be competed by the mutant probe Unlabeled-E6m in which CACGTG was mutated to ACCACA, indicating that MYC3 can specifically bind to the sequence 1488bp to 1696bp upstream of the start codon of the WRKY75 gene: cgagatgtgaaagaaaaaaagtgagattgcaaaagaacacgtgc gtcttccaagaattttcttaggggttatataatattcaaacatttgatctctttgataattgtccaaccttttctttttactttgtgct tttgaatggtcaatcaaacatggactaacaacagtaaatggtgagctacttttgttttcctaattgaaattgatta, SEQ ID NO.11.

[0045] Example 3 Overexpression of MYC3 to verify the involvement of the transcript MYC3 in plant resistance to low phosphorus stress Step 1 Construction of overexpression plants

[0046] 1. Seed surface disinfection

[0047] After the Arabidopsis seeds are dried, appropriate amount of seeds are dispensed into new EP tubes, opened and placed in a desiccator. 4 mL of concentrated hydrochloric acid is added to a beaker containing 200 mL of 6% sodium hypochlorite solution, and the desiccator is quickly sealed. After fumigation for 3-4 hours, the seeds are taken out from the clean bench and left to stand for 5-10 minutes. 1 mL of sterilized ddH 2 O, vortex the seeds and incubate at 4°C in the dark for 2 days.

[0048] 2. Arabidopsis seedling culture

[0049] The seeds used for transplanting experiments were evenly distributed on 1 / 2MS culture medium according to certain row spacing and spacing, and cultivated at a vertical tilt of 30°. The photoperiod was 16h / 8h, the temperature was kept at about 20℃, and the relative humidity was 50%-60%. After growing for 7 days, the seedlings with the same growth were selected in the clean bench and transplanted to MS and LP culture medium for further growth. According to the different materials, appropriate concentrations of DEX were added to the culture medium, and materials were collected at different time points according to the experimental requirements. The seeds used for soil culture were evenly distributed on 1 / 2MS culture medium, and after growing for 7 days in a light incubator (photoperiod 16h / 8h, temperature 22℃, relative humidity 50%-60%), they were transplanted to nutrient soil and continued to grow in a greenhouse (photoperiod 16h / 8h, temperature 22℃, relative humidity 50%-60%) for collecting experimental materials, hybridization, transgenic or breeding seeds.

[0050] 3. Construction of complementary vector

[0051] Using the genomic DNA of Col-0 as a template, the MYC3 genomic fragment containing a promoter of about 2.5 kb was amplified and connected to the cloning vector pBSK. After the sequencing was correct, the genomic fragment obtained by enzyme digestion was connected to the pCMBIA1300 vector.

[0052] The primer sequences used for the construction are as follows:

[0053] myc3 com-LP: GATCAATACTAAACTCGATGGGC, SEQ ID NO.12;

[0054] myc3 com-RP: GGATCCTCAATAGTTTTCTCCG, SEQ ID NO. 13.

[0055] 4. Construction of recombinant protein

[0056] Using the reverse transcribed cDNA of wild-type (Col-0) Arabidopsis seedlings mRNA as a template, the target gene fragment was obtained by PCR amplification using the target gene primers, and then the gene fragment was connected to the intermediate vector pGEM-Teasy, and the correct fragment was obtained by sequencing; the target gene fragment was cut out using the designed restriction sites and connected to the prokaryotic protein expression vector. The upstream and downstream restriction sites of MYC3 were BamHI and Sal I, respectively, and the recombinant protein expression construct was pET 28a(+)-MYC3-His.

[0057] 5. Construction of overexpression plant vector

[0058] The target gene fragment was fused to the intermediate vector pBSK plasmid with the correct sequencing. The gene fragment was cut out using the restriction site Nde I / SpeI and connected to the pBSK vector with an HA tag at the N-terminus with the same sticky ends. The gene fragment with the HA tag was then cut out using the restriction site Xho I / Spe I on the vector. After recovery, it was connected to the DEX-inducible plant expression vector pTA7002 with the same sticky ends. The correct plasmid was identified to transform the Agrobacterium competent GV3101. After correct colony PCR identification, it can be used to transform Arabidopsis thaliana.

[0059] 6. Plasmid transformation into Agrobacterium competent cells

[0060] 1) Take competent Agrobacterium GV3101, thaw it completely on ice, add 5 μL of plasmid and mix well;

[0061] 2) Ice bath for 5 min, quick freeze in liquid nitrogen for 5 min, 37°C water bath for 5 min, and stand on ice for 5 min;

[0062] 3) Add 700 μL of antibody-free LB and culture at 150 rpm and 28°C for 3 h;

[0063] 4) Centrifuge at 6000×g for 2 min, discard the supernatant, spread evenly on solid LB medium containing the corresponding resistance, and culture at 28℃ for 2 days. Single colonies with target bands identified by PCR were used for subsequent experiments.

[0064] 7. Agrobacterium infection of Arabidopsis

[0065] The constructed plant expression vector was transformed into Arabidopsis thaliana using the Agrobacterium-mediated flower bud immersion method (Clough and Bent, 1998).

[0066] 1) Transfer 3 mL of Agrobacterium culture solution that has been shaken overnight into 200 mL of liquid LB medium with corresponding antibiotics, and shake culture at 28°C;

[0067] 2) Bacterial liquid OD 600 When the cell density reaches about 1.5, centrifuge to collect the bacteria at 4000×g for 10 min and discard the supernatant;

[0068] 3) Resuspend the cells in 200 mL of transformation medium (1 / 2MS, 5% sucrose, 0.02% Silwet) and mix thoroughly; water the Arabidopsis to be transformed in advance, soak the unopened flower buds in the transformation medium for 5 minutes, culture in the dark for about 20 hours, and then culture under normal light.

[0069] 8. Screening and identification of transgenic Arabidopsis plants

[0070] Transgenic Arabidopsis T0 seeds were screened for resistant seedlings using 1 / 2MS solid medium containing hygromycin, transplanted into nutrient soil, and cultured in a greenhouse;

[0071] The rosette leaves of the resistant seedlings were injected with 20 μM DEX for overnight induction, and the protein was extracted and the expression of the transferred gene was identified by western analysis;

[0072] Resistant seedlings with high expression of target protein were retained, seeds were collected from individual plants, and the separation ratio of resistant seedlings was screened in a medium with a final concentration of 15 μg / mL hygromycin. For strains with a ratio of non-resistant seedlings to resistant seedlings close to 1:3, the resistant seedlings were transplanted into nutrient soil to detect protein expression;

[0073] Seeds were collected from each plant, and fully resistant strains were screened using hygromycin culture medium. Protein expression in 6 individual plants was randomly tested, and the strain with high and consistent expression of the target protein (3-OE) was used for subsequent experiments.

[0074] Phosphorus content detection

[0075] 1) Take the Arabidopsis seedlings of the above group treated with LP medium for 7 days, collect the materials from the root and crown, and wash them with distilled water;

[0076] 2) Place the sample in an oven and dry it at 60°C until constant weight is reached, then weigh the dry weight;

[0077] 3) Move the sample into a clean crucible, place it neatly into a muffle furnace, carbonize at 300℃ for 1h, ashed at 575℃ for about 6h, and close the muffle furnace;

[0078] 4) Take out the crucible and add 1 mL of 0.1 M HCl to fully dissolve the ashed sample;

[0079] 5) Centrifuge at room temperature, 12000×g, 5 min, take an appropriate amount of supernatant, dilute to 900 μL with 0.1M HCl, add 100 μL ammonium vanadate molybdate solution and mix well, react at room temperature for 15 min, measure the absorbance at 410 nm, and use 1 mM KH 2 PO 4 Prepare standard samples and calculate the phosphorus content of the samples based on the standard curve. Figure 4 ,Depend on Figure 4 It can be seen that the phosphorus content in the wild-type and Arabidopsis plants with introduced complementary genes is basically the same, while the phosphorus content in various parts of the plants overexpressing the MYC3 transcript is much higher than that of the wild-type. This shows that the MYC3 transcript is involved in the process of the plant's resistance to low-phosphorus stress. In a low-phosphorus environment, it can promote the plant's absorption of phosphorus and reverse low-phosphorus stress.

[0080] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0081] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The use of MYC3 transcription factor, characterized in that, The uses include the following aspects: 1) Use of overexpressed MYC3 transcription factor in plants to antagonize low phosphorus stress; 2) Overexpression of MYC3 transcription factor promotes the expression of WRKY75 gene under low-phosphorus conditions; 3) Knocking out the MYC3 transcription factor reduces the plant's ability to resist low-phosphorus stress. Under low-phosphorus conditions, the expression level of the WRKY75 gene is reduced.

2. The use according to claim 1, characterized in that The CDS sequence of the MYC3 transcription factor is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The MYC3 transcription factor binds to the cis-acting element CACGTG in the sequence 1488 bp to 1696 bp upstream of the WRKY75 start codon.

4. A method for improving the ability of plants to resist low phosphorus stress, characterized in that: The MYC3 gene is transformed into competent cells, and then the plants are infected, so that the MYC3 gene in the plants is overexpressed.

Images