TRAFD1 induced activation of CD8 + T cell immune response and application in treatment of pancreatic cancer

Abstract

The invention belongs to the technical field of disease treatment, and discloses application of TRAFD1 in inducing and activating CD8 + T cell immune response and treating pancreatic cancer. According to the present invention, it is found that the TRAF-type zinc finger domain 1 gene (TRAF-type zinc finger domain 1 gene, TRAFD1) can be adopted as the molecular marker for predicting whether the pancreatic cancer patient can benefit from the immunotherapy or not; meanwhile, the TRAFD1 promotes the immunotherapy effect by influencing CD8 + T cell activation and effector functions, which is of great significance to promotion of pancreatic cancer immunotherapy.

Description

Technical Field

[0001] The present invention belongs to the technical field of disease treatment, and more specifically, relates to TRAFD1 inducing activation of CD8+T cell immune response and application in treating pancreatic cancer. Background Art

[0002] Pancreatic ductal carcinoma (PDAC) is a highly invasive and lethal malignancy with an average 5-year overall survival rate of less than 10%. Currently, immunotherapy, especially immune checkpoint blockade (ICB), has been shown to enhance T cell-mediated immune responses. In recent years, ICB has become the most promising treatment option for a variety of tumors such as advanced skin cancer, lung cancer, and colorectal cancer. However, due to the highly desmoplastic and immunosuppressive tumor microenvironment of pancreatic cancer, the results of multiple clinical trials have shown that pancreatic cancer has a low response rate to ICB. Therefore, finding safe and effective new strategies to enhance anti-tumor immunity is a key issue that urgently needs to be addressed.

[0003] Due to the limitations of traditional treatment options, immunotherapy is currently attracting much attention. The principle of immunotherapy is to use specific immune cells or drugs to regulate the body's immune system so that it can better identify and attack cancer cells. The therapeutic effect of PD-1 / PD-L1 immune checkpoint inhibitor therapy (hereinafter referred to as "immunotherapy") in a variety of solid tumors has shown a promising trend, and has even become a first-line treatment option in some solid tumors. However, except for a very small number of pancreatic cancers with microsatellite instability (MSI-H) characteristics that are more responsive to immunotherapy, the vast majority of pancreatic cancers are resistant to immunotherapy. The tumor microenvironment in which pancreatic cancer is located is highly immunosuppressive, which is an important factor leading to resistance to immunotherapy.

[0004] The tumor microenvironment is an important component of tumor tissue, including tumor cells, immune cells, stromal cells, extracellular matrix) and various soluble molecules, which play an important role in the occurrence and development of tumors. From the perspective of tissue structure, the immune microenvironment of pancreatic cancer is characterized by a dense matrix composed of various cells and non-cellular components. These matrices are also called profibrotic reactions or tumor microenvironment (TME). It contains a variety of immune cell types, such as myeloid-derived suppressor cells (MDSCs), tumor-associated macrophages (TAMs), tumor-associated fibroblasts (TAFs), regulatory T cells (Regulatory T cells, Treg), etc., while anti-tumor immune cells such as cytotoxic T cells (CD8+T) cells have less infiltration. Single-cell sequencing analysis results show that in pancreatic cancer tissue, most of the cells sorted out are immune cells, of which myeloid cells (including MDSCs, TAMs, etc.) account for 36.7%, T cells and NK cells account for 30.5%, and CAFs account for 6.2%; the abundant M2 TAMs, MDSCs, Tregs, and Th2 T cells in TME all indicate a poor prognosis for pancreatic cancer. The combined effects of the above multiple factors reshape the highly immunosuppressive microenvironment of pancreatic cancer.

[0005] CD8+T cells are the most important cells in anti-tumor immunity in pancreatic cancer. Studies have shown that CD8+T cells infiltrating the tumor microenvironment indicate a good prognosis for the tumor, and CD8+T cells are closely related to inhibiting the occurrence, development and metastasis of tumors, and promoting immunity. CD8+T cells promote caspase activation and apoptosis in tumor cells by secreting cytotoxic molecules such as granzyme B and perforin. CD8+T cells induce tumor cell death through the Fas / Fas ligand pathway. Therefore, exploring new genes that promote CD8+T cell activation in pancreatic cancer will provide new targets for immunotherapy of pancreatic cancer. Summary of the invention

[0006] In order to overcome the shortcomings of existing technologies, research has found that TRAF-type zinc finger domain containing 1Gene (TRAFD1) can be used as a molecular marker to predict whether pancreatic cancer patients can benefit from immunotherapy. At the same time, TRAFD1 promotes the effect of immunotherapy by affecting CD8+T cell activation and effector function, which is of great significance for the advancement of pancreatic cancer immunotherapy.

[0007] The primary purpose of the present invention is to provide the application of TRAFD1 gene and its expression products in developing and screening functional products for treating pancreatic cancer.

[0008] The second object of the present invention is to provide a functional product that has a promoting effect on the TRAFD1 gene and its expression product for use in the preparation of a product that promotes CD8+T cells to exert an immune response.

[0009] The third object of the present invention is to provide a functional product that has a promoting effect on the TRAFD1 gene and its expression product for use in preparing a product for treating pancreatic cancer.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] Application of the TRAFD1 gene and its expression products in the development and screening of functional products for treating pancreatic cancer, wherein the functional products have a promoting effect on the TRAFD1 gene and its expression products.

[0012] The present invention compares the TRAFD1 gene expression in pancreatic cancer cells and adjacent cells through public databases, and finds that TRAFD1 is lowly expressed in pancreatic cancer tissues; and this finding is verified by qPCR. Then, by constructing pancreatic cancer cells that overexpress TRAFD1 and co-culturing them with anti-tumor immune cell killer T cells (CD8+T) in vitro, it is found that after the KPC-OVA cell line overexpressing TRAFD1 is co-cultured with CD8+T cells, the proportion of GZMB+CD8 T cells and IFNG+CD8T cells is higher. This shows that TRAFD1 can be used as a molecular marker to predict whether pancreatic cancer patients can benefit from immunotherapy. At the same time, TRAFD1 promotes the effect of immunotherapy by affecting CD8+T cell activation and effector function. This conclusion was also verified in subsequent in vivo animal experiments.

[0013] Therefore, the present invention also protects the use of a functional product that has a promoting effect on the TRAFD1 gene and its expression product in the preparation of a product that promotes CD8+T cells to exert an immune response.

[0014] Preferably, the promotion of CD8+T cells to exert an immune response is manifested as one or more of the following:

[0015] (1) Promote CD8+ T cells to secrete granzyme B;

[0016] (2) Promote the secretion of IFNG protein by CD8+ T cells;

[0017] (3) The number of pancreatic cancer tumor cells killed by CD8+T cells increased;

[0018] (4) Combined immunotherapy drugs reduce the growth rate of pancreatic cancer tumors.

[0019] Preferably, the functional product having a promoting effect on the TRAFD1 gene and its expression product is selected from any one of the following:

[0020] (i) using TRAFD1 or TRAFD1 transcript as the target sequence and being able to enhance the expression of the TRAFD1 gene expression product;

[0021] (ii) a construct containing TRAFD1, or a TRAFD1 complementary sequence and capable of forming an enhanced TRAFD1 gene expression product after being introduced into the body;

[0022] (iii) immune-related cells, differentiated cells thereof or constructs thereof overexpressing the TRAFD1 gene sequence.

[0023] More preferably, the immunotherapy drug is PD-1, and the functional product is a recombinant plasmid or a recombinant cell overexpressing TRAFD1.

[0024] The present invention, through in vivo animal experiments, found that overexpression of TRAFD1 combined with anti-PD-1 monoclonal antibody significantly reduced the growth rate of pancreatic cancer tumors.

[0025] Therefore, the present invention also protects the use of a functional product that has a promoting effect on the TRAFD1 gene and its expression product in the preparation of a product for treating pancreatic cancer.

[0026] Preferably, the functional product having a promoting effect on the TRAFD1 gene and its expression product is selected from any one of the following:

[0027] (i) using TRAFD1 or TRAFD1 transcript as the target sequence and being able to enhance the expression of the TRAFD1 gene expression product;

[0028] (ii) a construct containing TRAFD1, or a TRAFD1 complementary sequence and capable of forming an enhanced TRAFD1 gene expression product after being introduced into the body;

[0029] (iii) immune-related cells, differentiated cells thereof or constructs thereof overexpressing the TRAFD1 gene sequence.

[0030] More preferably, the functional product is a recombinant plasmid or a recombinant cell overexpressing TRAFD1.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] The present invention found that TRAF-type zinc finger domain containing 1Gene (TRAFD1) can be used as a molecular marker to predict whether pancreatic cancer patients can benefit from immunotherapy. At the same time, TRAFD1 promotes the effect of immunotherapy by affecting CD8+T cell activation and effector function, which is of great significance for the advancement of pancreatic cancer immunotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The expression of TRAFD1 in pancreatic cancer tissues and normal pancreatic tissues in the TCGA database;

[0034] Figure 2 The mRNA level of TRAFD1 gene is differentially expressed in pancreatic cancer cells and pancreatic cells;

[0035] Figure 3 This is the plasmid map of pCMV-T7-MCS-3×FLAG-WPRE-Neo;

[0036] Figure 4 Verification after PCR amplification of the target fragment of transiently transfected overexpression plasmid;

[0037] Figure 5 It is the enzyme digestion verification of transient overexpression plasmid vector fragments; the markers from top to bottom are 10000bp, 8000bp, 6000bp, 5000bp, 4000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp;

[0038] Figure 6 For the verification of positive transformants of transient overexpression plasmids; the markers from top to bottom are 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp;

[0039] Figure 7 This is the plasmid map of pLV3-CMV-MCS-3×FLAG-CopGFP-Puro;

[0040] Figure 8 WB was used to verify the TRAFD1 protein level in pancreatic cancer cells after exogenous overexpression of TRAFD1;

[0041] Fig. 9 To verify the TRAFD1 protein level in pancreatic cancer cells after exogenous overexpression of TRAFD1 by qPCR;

[0042] Fig.10 Verification after PCR amplification of the target fragment of the stably overexpressed plasmid;

[0043] Fig.11 For enzyme digestion verification of stable overexpression plasmid vector fragments; the markers from top to bottom are 10000bp, 8000bp, 6000bp, 5000bp, 4000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp;

[0044] Fig.12 To verify the positive transformants of stable overexpression plasmid;

[0045] Fig.13 Flow cytometry was used to detect the proportion of GZMB and IFNG positive CD8+T cells after in vitro co-culture with pancreatic cancer cells overexpressing TRAFD1;

[0046] Fig.14 Shows the proportion of apoptotic tumor cells in pancreatic cancer cells overexpressing TRAFD1 after co-culture with CD8+ T cells;

[0047] Fig.15 This is the effect of overexpression of TRAFD1 combined with anti-PD-1 monoclonal antibody on the subcutaneous tumor volume in mice. DETAILED DESCRIPTION

[0048] In order to better illustrate the purpose, technical scheme and advantages of the present invention, the present invention will be further described below in conjunction with specific drawings and embodiments. In the embodiments, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all commercially available unless otherwise specified.

[0049] Example 1 Verification of the expression level of TRAFD1 in pancreatic cancer

[0050] 1. Public database analysis

[0051] This study downloaded the gene expression matrix of 179 pancreatic cancer tissues and 4 adjacent tissues from the TCGA database, read the annotation information of the file, converted the probe names into gene names, and used the aggregate function to remove duplicate genes. Figure 1 As shown, TRAFD1 was down-expressed in pancreatic cancer tissues compared with adjacent adjacent tissues.

[0052] 2. RT-qPCR assay to detect differential expression of TRAFD1 gene in pancreatic cancer cells and pancreatic cells

[0053] 2.1. Extraction of RNA

[0054] (1) Mouse pancreatic cancer cell lines PANC02, KPC, LTPA and mouse pancreatic ductal epithelial cell line MPDEpiC were inoculated into 6-well plates, 2 mL of culture medium was added to each well, and cultured until the density reached 80%;

[0055] (2) Aspirate the culture medium, wash twice with an appropriate amount of PBS, add 500 μL of Lysis Buffer to each well, and pipette 10 times. Add an equal volume of anhydrous ethanol to the lysed cells, mix well, and then transfer the liquid to the RNA purification column. Centrifuge at room temperature at 12000×g for 1 min and discard the waste liquid;

[0056] (3) Add 500 μL of Wash Buffer to the RNA centrifuge column and centrifuge at 12,000 × g for 1 min at room temperature. Discard the waste liquid.

[0057] (4) Place the RNA centrifuge column back into the collection tube, centrifuge the empty tube at 12,000 × g for 1 min at room temperature, and discard the waste liquid;

[0058] (5) Transfer the RNA centrifuge column into a clean 1.5 mL centrifuge tube free of RNase and air dry it for 2 min with the lid open;

[0059] (6) Add 20-30 μl of Elution Buffer to the center of the RNA centrifuge column membrane and let it stand at room temperature for 2 min. Centrifuge at 12,000 rpm for 1 min at room temperature and measure the concentration of the product.

[0060] 2.2 Reverse transcription

[0061] The separated RNA was reversibly transcribed into cDNA using a reverse transcription kit. The reverse transcription system and reverse transcription procedure are shown in Tables 1 and 2.

[0062] Table 1

[0063]

[0064] Table 2

[0065] Reverse transcription procedure time 37℃ 15min 85℃ 5sec 4℃ Hold

[0066] The transcription level of TRAFD1 was detected, and GAPDH was used as a control. The primer sequences were:

[0067] TRAFD1 primer sequence: 5′-3′: ATGGCCGAGTTTCGAGATGAC;

[0068] 3'-5': ACACACCAATGTTCCTTTGACAG;

[0069] GAPDH primer sequence: 5′-3′: AGGTCGGTGTGAACGGATTTG;

[0070] 3'-5': TGTAGACCATGTAGTTGAGGTCA.

[0071] 2.3 Real-time fluorescence quantitative PCR

[0072] (1) Prepare the qPCR reaction system as shown in Table 3.

[0073] Table 3

[0074]

[0075] (2) The amplification procedure is shown in Table 4.

[0076] Table 4

[0077]

[0078] The results are as follows Figure 2 As shown, TRAFD1 is lowly expressed in pancreatic cancer cells.

[0079] Example 2 Construction of KPC-OVA cell line transiently overexpressing TRAFD1

[0080] 1. Construction of TRAFD1 overexpression transient vector

[0081] 1.1 Plasmid design

[0082] Select a suitable vector pCMV-T7-MCS-3×FLAG-WPRE-Neo and transform it. The primer sequences used for the target fragment are:

[0083] F1:TTGGTACCGAGCTC GAATTC GCCACCATGGCCGAGTTTCGAGATGACCAG,

[0084] R1:TGGTCTTTGTAGTC GGATCC CTCCTCTTCCTCCTCCGCATCGCCTG.

[0085] In the above sequence, the bold is the Kozak sequence, the underlined font is the restriction site, the upstream restriction site is EcoRI, and the downstream restriction site is BamHI; the plasmid map is as follows Figure 3 shown.

[0086] 1.2 PCR reaction system and amplification conditions

[0087] Synthesize the target gene and use I-5 TMPCR amplification was performed using 2× High-Fidelity Master Mix. The specific reaction system and conditions are shown in Table 5, and the amplification program is shown in Table 6.

[0088] Table 5

[0089] <![CDATA[I-5 TM 2×High-Fidelity Master Mix]]> 12.5μL Primer F 1μL Primer R 1μL Plasmid template 1μL <![CDATA[ddH2O]]> 9.5μL Total volume 25μL

[0090] Table 6

[0091]

[0092] 1.3. Detection of PCR product size and product recovery

[0093] After the target fragment is PCR amplified, it is detected by electrophoresis using 1% agarose gel, and DNA Marker is used as a reference to determine the fragment size of the target gene. The results are as follows: Figure 4 As shown, the observed bands are consistent with the expected position, and the target fragment size is 1786 bp, indicating successful amplification. The above correct target bands were cut and recovered into sterile 1.5 mL EP tubes, and the DNA target fragments were recovered according to the instructions of the Rapid Agarose Gel DNA Recovery Kit.

[0094] 1.4. Enzyme digestion and recovery of vector

[0095] In a sterile 0.2 mL EP reaction tube, the vector pCMV-T7-MCS-3×FLAG-WPRE-Neo was digested with enzymes. The specific enzyme digestion system is shown in Table 7.

[0096] Table 7

[0097]

[0098] The results of vector digestion and recovery are the same as those in Section 1.3. According to the results of 1% agarose gel electrophoresis, the observed bands are consistent with the expected positions. After digestion of the vector pCMV-T7-MCS-3×FLAG-WPRE-Neo, a 6063 bp band is produced, indicating that the digestion is successful. Figure 5 shown.

[0099] 1.5 Homologous recombination reaction

[0100] The concentrations of the target fragment (P1 fragment) and the recovered fragment of the vector after double enzyme digestion were detected, and finally ligated with a reaction system of vector fragment: P1 fragment = 3:1. The ligation system is shown in Table 8.

[0101] Table 8

[0102]

[0103] Transform competent cells with ligation products: Take out DH5α competent cells from -80℃ refrigerator in advance and melt them on ice; add the recombinant product in 3.1.5 to 100μL DH5α competent cells (this step is performed on the clean bench), gently rotate to mix, and place on ice for 30min; heat shock in 42℃ water bath for 45s, then immediately place on ice for 2min; add 900μL antibiotic-free LB liquid culture medium (this step is performed on the clean bench), and resuscitate at 37℃, 180rpm for 30min; after recovery, centrifuge at 10000rpm for 1min, remove the upper bacterial liquid, add 100μL fresh culture medium, gently whip to mix, and evenly apply it on LB plate containing Amp antibiotic (100μg / mL), and place at room temperature until the liquid is absorbed; transfer the plate to a 37℃ biochemical incubator, invert, and culture overnight.

[0104] Identification of positive transformants by colony PCR: Four single colonies were picked for PCR identification of the constructed vectors, and the forward identification primers were: D1: CCCATTGACGTCAATGGGAG, D2: tgcatttacaggtcacctgac; wherein D1 was located on the CMV promoter of the vector, and D2 was located downstream of the target gene; the reaction system was shown in Table 9, and the amplification conditions were shown in Table 10.

[0105] Table 9

[0106] Colony Monoclonal Upstream primer D1 0.5μL Downstream primer D2 0.5μL TaKaRaTaqMax 5μL <![CDATA[ddH2O]]> 4μL Total volume 10μL

[0107] Table 10

[0108]

[0109] 1% agarose gel electrophoresis was used for detection, and DNA Marker was used as a reference. Figure 6 The results showed that the observed bands were consistent with the expected positions and the size of the identified product was 453 bp, indicating that the colony contained the target gene.

[0110] 1.6. Plasmid identification and sequencing

[0111] Inoculate single clones (at least 2) that meet the target fragment size into LB liquid medium containing 1‰ Amp resistance for overnight culture and extract plasmids as follows:

[0112] (1) Centrifuge the bacterial solution at 13,000 rpm for 1 min and discard the waste liquid.

[0113] (2) Use 500 μL Buffer P1 and 5 μL C WBlue to fully lyse the bacterial precipitate.

[0114] (3) Add 500 μL Buffer P2 and lyse at room temperature for 5 min.

[0115] (4) Column equilibration: Add 200 μL of Buffer PS to the adsorption column (Spin Columns DL) loaded in the collection tube, centrifuge at 13,000 rpm for 2 min, and discard the waste liquid.

[0116] (5) Add 500 μL of Buffer E3 and immediately mix by inverting the tube for 8-10 times until a white flocculent precipitate appears. Leave the tube at room temperature for 5 min.

[0117] (6) Centrifuge at 13,000 rpm for 5 min, aspirate the supernatant, add the supernatant to a filter column (Endo-Remover FM), centrifuge at 13,000 rpm for 1 min, and transfer the filtrate in the collection tube to a centrifuge tube.

[0118] (7) Add 0.3 times the volume of isopropanol to the supernatant and mix well. Transfer the mixed solution to a Spin Columns DL adsorption column.

[0119] (8) Centrifuge at 13,000 rpm for 1 min and discard the waste liquid.

[0120] (9) Add 750 μL Buffer PW, centrifuge at 13,000 rpm for 1 min, discard the waste liquid in the collection tube, and centrifuge again for 1 min.

[0121] (10) Prepare a 1.5 mL centrifuge tube and add 100 μL of Buffer EB to the adsorption column. Incubate at room temperature for 5 min and centrifuge at 13,000 rpm for 2 min. Store the plasmid at -20°C.

[0122] The sequencing results of TRAFD1 sequence in the recombinant plasmid are shown below, and the sequence comparison proves that the recombinant plasmid constructed by the present invention is correct.

[0123] TRAFD1 sequence: atggccgagtt tcgagatgac caggcttcta ggctgtgtga caactgcaagaaggaaattc ctgtatttaa ttttaccatc catgaaatcc actgtcaaag gaacattggt gtgtgccctgtctgcaagga accgttcccc aaatctgaca tggacattcacatggctgca gagcactgtc aggtgacctgtaaatgcaac aagaagttgg agaagaggca gttaaagcag catgcggagacagagtgtcc cctgcggctcgccgtctgcc agcactgtga tctggagctt tctgttgtca agttgaagga gcatgaggattactgtggagcccggacaga gctgtgtggc agctgtgggc gcaacgtgct tgtgaaggag ctgaagactcaccccgaagt ctgtgggagagtggaggagg aaaagagaac ggaggctgcc atccctccgg aggcttacgacgagccctgg agtcaggaca gaatctggatcgcatcccag ctcctcagac aaatcgaggc tctggacccgcccatgaggc tccctggaag gcccctgcaa gcctttgaggcagacccctt ctacagtagg actaccagccagaggagcat ggcagcccag tttccagttc aaaataatct ttttgaagaa caagaaaggcaggaaaggaacagaagccgg cagtccccaa aggacagcgc tgagaataac gcacacttgg acttcatgttggccttgagtctgcagaatg agggacaggc caccagcatg gtagagcagg gcttctggga gtctgtgcctgaggctgatc cggctcgtgctgggcccaca tctctaggtg acataaaggg tgctgctgac gagattctgctgccgtgtga gttctgtgag gagctgtacc cagaggaactgctcattgaccatcagacaa gctgcaacccttctcatgcc ttacgttcac tcaatacggg cagctcttcc atcaggggtg tggaagatcctggtaccatcttccagaact ttctacaaca agcaacaagt aaccagtttg acactttaat gggcctgagc agttcagctgctgtggaagacagcatcatc atcccctgtg agttctgtgg ggtgcagctg gaagaggagg tgctgttctaccatcaggac cagtgtgaccaacgcccagc cacagcaaac caccgtgcag tggagggcat cccagcccaggattcgcagc cagaaaacac ttcagcagagctgtccagga ggcgggtcaa acaccaggga gacctgtcatctggttacat ggatgatgtc aagccggaat cagtgaaaggccccacctac tcgatgtctc ctaacaggaccatgaacaat gtggcttcct gcaaccgact gttgaactta ccgtcagggc ccaggtctgactgccagcgtagccctcccg gtgtgctgaa actcaacaac tctgatagcc aggacatccg tgggcagatgcggggcagccagaatgggcc catagcatcc gggcacgctc cagtgatcca ctctattcaa aatctctatccagaaaactt tgcgccctct tttcctcatggatcccctgg gaggtacgga gctgg.

[0124] 1.7 Plasmid transfection into pancreatic cancer cells

[0125] One day in advance, the KPC-OVA cell line (denoted as KPC-OVA-TRAFD1, and a control group KPC-OVA-Vector) was inoculated into a 6-well plate. The next day, when the cell line grew to 70% to 80%, it was ready for transfection. The specific steps are as follows:

[0126] (1) Transfect at a ratio of 1:2 between plasmid and liposome. Take two 1.5 mL EP tubes and add 250 μL Opti-MEM to each tube. Add 10 μg of liposome transfection reagent to tube A and 5 μg of the above-mentioned plasmid to be transfected to tube B. Add the solution in tube A to the solution in tube B, mix well and let stand at room temperature for 20 min.

[0127] (2) Discard the old culture medium from each well, add fresh culture medium, and then drop the mixed solution from step (1) into the well. After 6 hours, replace the medium with serum-containing culture medium. After 48 hours, obtain a pancreatic cancer cell line overexpressing TRAFD1.

[0128] 1.8. Detection of TRAFD1 protein levels in pancreatic cancer cells after exogenous overexpression of TRAFD1

[0129] The overexpression efficiency of TRAFD1 in KPC-OVA cells was detected by Western blot. The specific steps are as follows:

[0130] 1.8.1. Protein sample extraction and preparation

[0131] (1) KPC-OVA-Vector and KPC-OVA-TRAFD1 pancreatic cancer cells were plated in 6-well plates, 2 mL of culture medium was added to each well, and cultured until the density reached 80%.

[0132] (2) Use a cell scraper and RIPA lysis buffer to scrape the adherent cells from the culture dish, then transfer the cell suspension to a 1.5 mL EP tube and lyse on ice for 30 min.

[0133] (3) Centrifuge at 12,000 rpm for 20 min at 4°C. Transfer the supernatant to a new centrifuge tube.

[0134] 1.8.2 BCA protein quantification

[0135] Prepare standard systems of different concentrations according to the BCA manual, add them to the corresponding wells according to the gradient, and each gradient has 3 replicates. Add the samples to be tested to the corresponding wells. After adding the BCA mixture, incubate at 37°C for 30 minutes to measure the protein concentration, dilute the protein to a uniform concentration with 5× Loading Buffer and ddH2O, boil at 98°C for 10 minutes, cool to room temperature, and store at -20°C.

[0136] 1.8.3 Electrophoresis

[0137] Prepare 1× electrophoresis solution, add 3-5μL marker to the gel wells, keep the sample loading volume of the control group and the experimental group consistent, and adjust the parameters to 80V for 30min and 120V for 60min.

[0138] 1.8.4. Transfer

[0139] Pour transfer solution to completely soak the filter paper and sponge. Take a 0.45μm PVDF membrane and put it in methanol for activation for 5 minutes. Put the sponge, filter paper, gel, PVDF membrane, filter paper, and sponge in the transfer folder in sequence, and put the transfer folder into the transfer tank, red against white, black against black. Pour 1x transfer solution, 250mA for 90 minutes.

[0140] 1.8.5. Closure

[0141] Block with TBST containing 5% skim milk, place on a shaker, and shake slowly at room temperature for 1 h.

[0142] 1.8.6 Antibody incubation

[0143] (1) Anti-TRAFD1 antibody was diluted to 1:1000 and anti-GAPDH antibody to 1:8000 in primary antibody diluent and incubated at 4°C overnight.

[0144] (2) Wash three times with TBST, dilute the secondary antibody at a ratio of 1:5000, and incubate at room temperature for 1 h.

[0145] 1.8.7 Exposure and Development

[0146] Wash with TBST three times, prepare ECL colorimetric solution in a 1:1 ratio, and expose using a chemiluminescent imager.

[0147] Western blot results showed that the overexpression efficiency of TRAFD1 in pancreatic cancer cells in the TRAFD1 overexpression group was at a high level ( Figure 8 right).

[0148] 1.9. Detection of TRAFD1 mRNA levels in pancreatic cancer cells after exogenous overexpression of TRAFD1

[0149] The overexpression efficiency of TRAFD1 in KPC-OVA cells was detected by qPCR. The specific steps are as follows:

[0150] 1.9.1. Extraction of RNA

[0151] (1) KPC-OVA-Vector and KPC-OVA-TRAFD1 pancreatic cancer cells were plated in 6-well plates, 2 mL of culture medium was added to each well, and cultured until the density reached 80%.

[0152] (2) The RNA extraction step is the same as 2.1 of Example 1.

[0153] 1.9.2 Reverse transcription

[0154] The isolated RNA was reversibly transcribed into cDNA using a reverse transcription kit. The reverse transcription system and reverse transcription procedure were the same as step 2.2 of Example 1.

[0155] 1.9.3 Real-time fluorescence quantitative PCR

[0156] The primers, qPCR reaction system and amplification procedure used were the same as step 2.3 of Example 1.

[0157] The TRAFD1 mRNA expression in the TRAFD1 overexpression group increased significantly, proving that the overexpression was successful ( Fig. 9 A).

[0158] Example 3 Construction of KPC stable cell line overexpressing TRAFD1

[0159] 1. Construction of TRAFD1 overexpression vector

[0160] 1.1 Plasmid design

[0161] Select a suitable vector pLV3-CMV-MCS-3×FLAG-CopGFP-Puro and transform it. The primer sequences used for the target fragment are:

[0162] F1:CTGATACGAACTCG GAATTC GCCACCATGGCCGAGTTTCGAGATGACCAG,

[0163] R1:TGGTCTTTGTAGTC GGATCC CTCCTCTCTCTCTCCCCGCATCGCCTG;

[0164] Note: The underlined sequence is the homology arm, the bold is the Kozak sequence, the underlined font is the restriction site, the upstream restriction site is EcoRI, and the downstream restriction site is BamHI.

[0165] 1.2 PCR reaction conditions

[0166] Synthesize the target gene and use I-5 TM PCR amplification was performed using 2× High-Fidelity Master Mix. The specific reaction system and conditions are shown in Table 5, and the amplification program is shown in Table 6.

[0167] 1.3. PCR product size and recovery

[0168] After the target fragment is PCR amplified, it is detected by electrophoresis using 1% agarose gel, and the DNA marker is used as a reference to determine the fragment size of the target gene. The above correct target bands are cut and recovered into sterile 1.5mL EP tubes, and the DNA target fragments are recovered according to the instructions of the rapid agarose gel DNA recovery kit. The specific steps refer to the instructions of the kit, and finally the purified target gene product is obtained. According to the results of 1% agarose gel electrophoresis, the observed bands are consistent with the expected positions, and the sizes of the target fragments are 1786bp, such as Fig.10 As shown, it proves that the PCR amplification of the target fragment is successful.

[0169] 1.4. Enzyme digestion and recovery of vector

[0170] In a sterile 0.2 mL EP reaction tube, the vector pLV3-CMV-MCS-3×FLAG-CopGFP-Puro was digested with enzymes. The specific enzyme digestion system is shown in Table 7. According to the results of 1% agarose gel electrophoresis, the observed bands were consistent with the expected positions. After the vector pLV3-CMV-MCS-3×FLAG-CopGFP-Puro was digested, a band of 8278 bp was generated. Fig.11 shown.

[0171] 1.5 Homologous recombination reaction

[0172] The target fragment (P1 fragment) recovered in Section 1.3 and the vector fragment recovered in Section 1.4 were ligated in a reaction system of vector fragment:target fragment=3:1. The reaction system is shown in Table 8.

[0173] Transform competent cells with ligation products: (1) Take out the DH5α competent cells from the -80℃ refrigerator in advance and thaw them on ice; (2) Add the recombinant product in 4.1.5 to 100μL of DH5α competent cells, gently rotate to mix, and place on ice for 30 minutes; (3) Heat shock in a 42℃ water bath for 45 seconds, then immediately place on ice for 2 minutes; (4) Add 900μL of antibiotic-free LB liquid culture medium and resuscitate at 37℃, 180rpm for 30 minutes; (5) After recovery, centrifuge at 10000rpm for 1 minute, remove the supernatant, add 100μL of fresh culture medium, gently whip to mix, and evenly spread on an LB plate containing Amp antibiotic (100μg / mL), and leave at room temperature until the liquid is absorbed; (6) Transfer the plate to a 37℃ biochemical incubator, invert, and culture overnight.

[0174] Colony PCR identification of positive transformants: Four single colonies were selected for the above-mentioned constructed vectors for PCR identification. The specific steps were the same as those in Section 1.5 of Example 2. According to the results of 1% agarose gel electrophoresis, the observed bands were consistent with the expected positions, and the sizes of the identified products were 433 bp, such as Fig.12 As shown, it proves that the colony contains the target fragment.

[0175] 1.6. Plasmid identification and sequencing

[0176] Single clones (at least 2) that meet the target fragment size are inoculated into LB liquid culture medium containing 1‰ Amp resistance for overnight culture, and the plasmid is extracted in the same steps as in Example 2.

[0177] The sequencing results of TRAFD1 sequence in the recombinant plasmid are shown below, and the sequence comparison proves that the recombinant plasmid constructed by the present invention is correct.

[0178] TRAFD1 sequence: atggccgagtt tcgagatgac caggcttcta ggctgtgtga caactgcaagaaggaaattc ctgtatttaa ttttaccatc catgaaatcc actgtcaaag gaacattggt gtgtgccctgtctgcaagga accgttcccc aaatctgaca tggacattcacatggctgca gagcactgtc aggtgacctgtaaatgcaac aagaagttgg agaagaggca gttaaagcag catgcggagacagagtgtcc cctgcggctcgccgtctgcc agcactgtga tctggagctt tctgttgtca agttgaagga gcatgaggattactgtggagcccggacaga gctgtgtggc agctgtgggc gcaacgtgct tgtgaaggag ctgaagactcaccccgaagt ctgtgggagagtggaggagg aaaagagaac ggaggctgcc atccctccgg aggcttacgacgagccctgg agtcaggaca gaatctggatcgcatcccag ctcctcagac aaatcgaggc tctggacccgcccatgaggc tccctggaag gcccctgcaa gcctttgaggcagacccctt ctacagtagg actaccagccagaggagcat ggcagcccag tttccagttc aaaataatct ttttgaagaa caagaaaggcaggaaaggaacagaagccgg cagtccccaa aggacagcgc tgagaataac gcacacttgg acttcatgttggccttgagtctgcagaatg agggacaggc caccagcatg gtagagcagg gcttctggga gtctgtgcctgaggctgatc cggctcgtgctgggcccaca tctctaggtg acataaaggg tgctgctgac gagattctgctgccgtgtga gttctgtgag gagctgtacc cagaggaactgctcattgaccatcagacaa gctgcaacccttctcatgcc ttacgttcac tcaatacggg cagctcttcc atcaggggtg tggaagatcctggtaccatcttccagaact ttctacaaca agcaacaagt aaccagtttg acactttaat gggcctgagc agttcagctgctgtggaagacagcatcatc atcccctgtg agttctgtgg ggtgcagctg gaagaggagg tgctgttctaccatcaggac cagtgtgaccaacgcccagc cacagcaaac caccgtgcag tggagggcat cccagcccaggattcgcagc cagaaaacac ttcagcagagctgtccagga ggcgggtcaa acaccaggga gacctgtcatctggttacat ggatgatgtc aagccggaat cagtgaaaggccccacctac tcgatgtctc ctaacaggaccatgaacaat gtggcttcct gcaaccgact gttgaactta ccgtcagggc ccaggtctgactgccagcgtagccctcccg gtgtgctgaa actcaacaac tctgatagcc aggacatccg tgggcagatgcggggcagccagaatgggcc catagcatcc gggcacgctc cagtgatcca ctctattcaa aatctctatccagaaaactt tgcgccctct tttcctcatggatcccctgg gaggtacgga gctgg.

[0179] 2. Virus infection of pancreatic cancer cells

[0180] 2.1 Lentivirus packaging

[0181] When the density of HEK293T cells in a 10 cm culture dish reaches about 90%, transfection is performed. The specific steps are as follows:

[0182] (1) According to the amount of transfection reagent required for each dish of cells, take 60ul of liposome transfection reagent and 1.5mL Opti-MEM into centrifuge tube A, mix gently, and let stand at room temperature for 5min;

[0183] (2) Take 15 μg of the target gene plasmid, 10 μg of the psPAX2 plasmid, 5 μg of the pMD2.G plasmid, and 1.5 mL of Opti-MEM into centrifuge tube B and mix well;

[0184] (3) adding the solution of step (1) to the plasmid mixed solution of step (2) and incubating at room temperature for 20 minutes;

[0185] (4) Discard the old culture medium in the culture dish, add 12 mL of fresh culture medium, and slowly drop the transfection complex from step (3) into the culture medium;

[0186] (5) 48 h after transfection, collect the cell culture medium, filter it through a 0.45 μm microporous filter membrane, dispense 2 mL into each tube, measure the virus titer, and freeze it at -80°C.

[0187] 2.2 Virus infection of KPC cells

[0188] (1) The cells to be infected were inoculated into a 6-well plate, and complete culture medium was added for culture. Transfection was started when the cell confluence reached 30-40%;

[0189] (2) Aspirate the culture medium, add 1 mL of fresh culture medium and 2.4 μL of polybrene (10 μg / μL) to each well, then add 2 mL of the lentiviral solution obtained above, mix gently, and after culturing for 48 h, add 3 μg / mL puromycin to select the cells. After 72 h, the cell line KPC-TRAFD1-OE stably expressing TRAFD1 and the control cell line KPC-Vector were obtained.

[0190] 2.3. Detection of TRAFD1 protein levels in pancreatic cancer cells after stable overexpression of TRAFD1

[0191] The overexpression efficiency of TRAFD1 in KPC cells was detected by Western blot. The specific steps are as follows:

[0192] 2.3.1. Protein sample extraction and preparation

[0193] (1) The pancreatic cancer cells obtained in step 2.2 were plated in 6-well plates, 2 mL of culture medium was added to each well, and the cells were cultured until the density reached 80%.

[0194] (2) The protein sample extraction and preparation were the same as in 1.8.1 of Example 2.

[0195] 2.3.2, BCA protein quantification, electrophoresis, membrane transfer, blocking, antibody incubation, exposure and development are the same as step 1.8 of Example 2;

[0196] Western blot results showed that the overexpression efficiency of TRAFD1 in pancreatic cancer cells in the TRAFD1 overexpression group was at a high level ( Figure 8 left).

[0197] 2.4. Detection of TRAFD1 mRNA levels in pancreatic cancer cells after exogenous overexpression of TRAFD1

[0198] The overexpression efficiency of TRAFD1 in KPC-OVA cells was detected by qPCR. The specific steps are as follows:

[0199] 1.9.1. Extraction of RNA

[0200] (1) The pancreatic cancer cells obtained in step 2.2 were plated in 6-well plates, 2 mL of culture medium was added to each well, and cultured until the density reached 80%;

[0201] (2) The RNA extraction step is the same as 2.1 of Example 1.

[0202] 1.9.2 Reverse transcription

[0203] The isolated RNA was reversibly transcribed into cDNA using a reverse transcription kit. The reverse transcription system and reverse transcription procedure were the same as step 2.2 of Example 1.

[0204] 1.9.3 Real-time fluorescence quantitative PCR

[0205] The primers, qPCR reaction system and amplification procedure used were the same as step 2.3 of Example 1; the expression of TRAFD1 mRNA in the TRAFD1 overexpression group increased significantly, proving that the overexpression was successful ( Fig. 9 B).

[0206] Example 4 Activation and cytotoxicity changes of CD8+T cells after in vitro co-culture with cells overexpressing TRAFD1

[0207] 1. Isolation of CD8+T cells from spleen of OT-1 mice: (1) Sterilize surgical instruments, gun tips, centrifuge tubes, etc. under high pressure; (2) Sacrifice OT-1 mice and soak them in alcohol for disinfection. In the clean bench, cut open the mouse abdominal cavity, remove the spleen, place it in a flat dish, grind the mouse spleen with a 20mL syringe stopper, rinse the cell screen with pre-cooled PBS, collect the filtrate, centrifuge at 400g for 5 minutes, and discard the supernatant; (3) Resuspend the spleen cells in 2mL red blood cell lysis buffer, lyse at room temperature for 5min, add 10mL PBS, centrifuge at 400g for 5min, and discard the supernatant; (4) Filter again with a 70μm filter, collect the filtrate into a 50mL centrifuge tube, filter again with a 40um filter, collect the filtrate, centrifuge at 400g for 5min, resuspend in PBS, and count; (5) Add 500μL cell suspension (5×107 (6) Add 100 μL of washed TBD-Streptavidin, mix well and incubate at 4°C for 10 min. Add 1 mL of PBS, mix up and down 5 times with a pipette to mix well, place the sorting flow tube containing the cells on a magnetic rack and let it stand for 5 min. (7) Pipette the supernatant into a new EP tube and centrifuge at 400 g for 5 min. (8) After centrifugation, discard the supernatant and collect the cells. The obtained cells were placed in an incubator at 37°C with 5% CO2 for later use. The culture medium was RPMI1640 containing 10% FBS, 500 μM β-mercaptoethanol, 10 mM HEPES, 1% penicillin and streptomycin, IL-2 (50 U / mL). At the same time, the obtained OT-1 mouse CD8+T cells were cultured with Dynabeads TM Mouse T-Activator CD3 / CD28 activation.

[0208] 2. Flow cytometry verified that KPC-OVA cell line overexpressing TRAFD1 promoted CD8+ T cell activation by co-culture with CD8+ T cells in vitro

[0209] KPC-OVA tumor cells were transfected with TRAFD1 transient overexpression plasmid for 48 hours, and then the pretreated cells were co-cultured with OT-IT cells at a ratio of 1:2.5 for 24 hours. After 24 hours, the expression of GZMB and IFNG in CD8+T cells was detected. The present invention detects the expression of GZMB and IFNG by flow cytometry, and the specific operation steps are as follows:

[0210] (1) Collect the cell culture supernatant of different groups, centrifuge at 400g for 5 min to collect the cell pellet, wash the cells twice with PBS, and finally resuspend the cells in 100 μL PBS;

[0211] (2) Add PE-anti-CD8 antibody and FITC-anti-CD3 antibody to the flow tube and incubate on ice for 30 min;

[0212] (3) Add 1 mL of Foxp3 fixation / permeabilization working solution to each tube and vortex. Incubate at 4°C or room temperature in the dark for 30-60 min. Add 2 mL of 1X permeabilization buffer to each tube. Centrifuge the sample at 300-400 g for 5 min at room temperature and discard the supernatant.

[0213] (4) Resuspend the cells in 100 μL 1X Permeabilization Buffer.

[0214] (5) Add APC / Cyanine7-anti-GZMB antibody and BV605-anti-IFNG antibody and incubate at room temperature in the dark for at least 30 min.

[0215] (6) Add 2 mL of 1X Permeabilization Buffer to each tube. Centrifuge the samples at 300-400 g for 5 min at room temperature and discard the supernatant.

[0216] (7) Add 2 mL of 1X Permeabilization Buffer or Flow Cytometry Staining Buffer to each tube.

[0217] (8) Centrifuge the sample at 300-400 g for 5 min at room temperature and discard the supernatant. Resuspend the stained cells with an appropriate amount of flow cytometry staining buffer and collect the sample on the flow cytometer.

[0218] The results are as follows Fig.13 As shown, Fig.13 Flow cytometry was used to detect the proportion of GZMB and IFNG positive CD8+T cells after co-culture with LLC cells in vitro. The results showed that compared with the control group, the proportion of GZMB+CD8 T cells and IFNG+CD8 T cells was higher after the KPC-OVA cell line overexpressing TRAFD1 was co-cultured with CD8+T cells.

[0219] 3. Apoptosis experiment verifies that co-culture of CD8+T cells with cells overexpressing TRAFD1 in vitro promotes CD8+T cell killing function

[0220] Experimental procedures: (1) KPC-OVA tumor cells were first transfected with TRAFD1 transient overexpression plasmid for 48 h; (2) The above two cells were co-cultured at a ratio of CD8+ T cells / tumor cells of 2.5:1 for 48 h; (3) The supernatant was removed, and the cells were digested with EDTA-free trypsin and centrifuged at 300g and 4℃ for 5 min to collect the cells. (4) The cells were washed twice, each time centrifuged at 300g and 4℃ for 5 min. 1×10 5 Cells. (5) Centrifuge, discard the supernatant, add 100uL 1×Binding Buffer to resuspend the cells. (6) Add 5uLAnnexinV-FITC and 10uLPI Staining Solution, and mix gently. (7) Protect from light and react at room temperature for 10-15min. (8) Add 400uL 1×Binding Buffer, mix well, and place on ice. Samples should be detected by flow cytometry or fluorescence microscope within 1h.

[0221] The results are as follows Fig.14 As shown, after co-culture with OT-1CD8+ T cells, the proportion of apoptotic tumor cells in TRAFD1-overexpressing cells was significantly increased.

[0222] Example 5 Effect of overexpression of TRAFD1 combined with anti-PD-1 monoclonal antibody on subcutaneous tumors in mice

[0223] 1. Establishment of subcutaneous tumor model in mice

[0224] 6 to 8 week old wild type C57 BL / 6J were used, 6 per group. When the KPC stable transfectant constructed in step 4 reached 70%-80% confluence, the mouse PDAC cells were washed, harvested and resuspended in PBS. Approximately 2.5×10 5 The cells were subcutaneously injected into the flank of C57 BL / 6 mice. One week after tumor inoculation, the tumors of mice were measured weekly, and the length and width of the tumors were recorded to draw the tumor growth curve.

[0225] 2. Effect of overexpression of TRAFD1 combined with anti-PD-1 monoclonal antibody on subcutaneous tumors in mice

[0226] When the maximum tumor length reached about 5.0 mm, the mice were randomly divided into four different treatment groups, including (i) KPC-Vector; (ii) KPC-Vector + anti-PD-1 mAb; (iii) KPC-TRAFD1-OE; (iv) KPC-TRAFD1-OE + anti-PD-1 mAb. Fig.15 A, Mice received intraperitoneal injection of anti-PD-1 monoclonal antibody (200 μg / mouse) every 2 days for 3 consecutive times, and the tumors were removed and weighed on the 16th day.

[0227] The results are as follows Fig.15 As shown in B and 15C, as the time after injection increases, overexpression of TRAFD1 combined with anti-PD-1 monoclonal antibody significantly reduces the tumor growth rate.

[0228] Example 6 Detection of activation ratio of tumor-infiltrating CD8+ T cells after overexpression of TRAFD1

[0229] 1. Digestion of tumor tissue

[0230] (1) The tumor tissues of the KPC-Vector and KPC-TRAFD1-OE groups were removed and placed in a flat dish. The tissues were minced into 0.1 mm pieces using scissors. 3 , add to the culture medium containing DNAse I (0.2 mg / mL), type IV collagenase (1 mg / ml), and hyaluronidase (0.2 mg / ml), and perform circular digestion at 37°C for 1 to 2 h.

[0231] (2) Collect the filtrate and filter it once with a 70 μm filter. Then, filter it again with a 40 μm filter and centrifuge at 500 g for 5 min.

[0232] (3) Add 5 mL of red blood cell lysis buffer to resuspend the cells and lyse them at room temperature for 10 min.

[0233] (4) Centrifuge at 500 g for 5 min and resuspend in PBS.

[0234] 2. Isolation of lymphocytes

[0235] (1) Slowly add the cell suspension and Percoll in a volume ratio of 2:1 into a centrifuge tube pre-filled with Percoll working solution and centrifuge at 20°C for 20 min.

[0236] (2) After density gradient sorting, take the layered cells and count them.

[0237] 3. Flow staining and detection

[0238] (1) Prepare each flow cytometry tube containing 1×10 6 100uL cell suspension of each cell was prepared, and single staining tubes for each antibody were set up, namely: anti-CD3-, anti-CD8-, anti-GZMB-PE-Cy7, and Zombie Aqua FixableViability.

[0239] (2) Staining: Use Zombie Aqua Fixable Viability staining for 15 min, add FACS buffer, and centrifuge at 300 g for 5 min;

[0240] (3) Blocking: Add 0.5 μg TruStain fcX to each tube TM Pre-incubate cells with (anti-mouse CD16 / 32) Antibody on ice for 10 min.

[0241] (4) Extracellular staining: Add fluorescently labeled primary antibodies (BV421-CD45, PE-anti-CD8 antibody, FITC-anti-CD3 antibody) to the prepared cell suspension. Incubate on ice in the dark for 30 min. Add FACS buffer for washing, 300g for 5 min.

[0242] (5) Fixation and permeabilization: Fix and permeabilize the cell suspension according to the ThermoFisher fixation and permeabilization kit. Add 1 mL of Foxp3 fixation / permeabilization working solution to each tube, vortex and incubate at 4°C in the dark for 30-60 min. Add 2 mL of 1X permeabilization buffer to each tube, centrifuge the sample at 300-400 g for 5 min at room temperature, and discard the supernatant. Resuspend the cells with 100 ul of 1X permeabilization buffer.

[0243] (6) Add fluorescently labeled antibody APC / Cyanine7-anti-GZMB antibody to detect intracellular antigens and incubate at room temperature in the dark for at least 30 min.

[0244] (7) Add 2 mL of 1X Permeabilization Buffer to each tube. Centrifuge the samples at 300-400 g for 5 min at room temperature and discard the supernatant.

[0245] (8) Add 2 mL of 1X permeabilization buffer or flow cytometry staining buffer to each tube. Centrifuge the samples at 300 g for 5 min at room temperature and discard the supernatant.

[0246] (9) Resuspend the stained cells with an appropriate amount of flow cytometry staining buffer and collect samples on a flow cytometer.

[0247] The results are as follows Fig.15 As shown in D, CD8+ T cells in tumor tissues of TRAFD1-overexpressing mice have a higher activation level.

[0248] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. Application of TRAFD1 gene and its expression product in developing and screening functional products for treating pancreatic cancer, characterized in that: The functional product has a promoting effect on the TRAFD1 gene and its expression product.

2. Application of functional products that promote the TRAFD1 gene and its expression products in the preparation of products that promote CD8+T cells to exert immune response.

3. The use according to claim 2, characterized in that: The promotion of CD8+T cells to exert immune response is manifested as one or more of the following: (1) Promote CD8+ T cells to secrete granzyme B; (2) Promote the secretion of IFNG protein by CD8+ T cells; (3) The number of tumor cells killed by CD8+T cells increases; (4) Combined immunotherapy drugs reduce tumor growth rate.

4. The use according to claim 2, characterized in that: The functional product having a promoting effect on the TRAFD1 gene and its expression product is selected from any one of the following: (i) using TRAFD1 or TRAFD1 transcript as the target sequence and being able to enhance the expression of the TRAFD1 gene expression product; (ii) a construct containing TRAFD1, or a TRAFD1 complementary sequence and capable of forming an enhanced TRAFD1 gene expression product after being introduced into the body; (iii) immune-related cells, differentiated cells thereof or constructs thereof overexpressing the TRAFD1 gene sequence.

5. The use according to claim 4, characterized in that: The immunotherapy drug is PD-1, and the functional product is a recombinant plasmid or recombinant cell that overexpresses TRAFD1.

6. Application of a functional product that promotes the TRAFD1 gene and its expression product in the preparation of a product for the treatment of pancreatic cancer.

7. The use according to claim 6, characterized in that: The functional product having a promoting effect on the TRAFD1 gene and its expression product is selected from any one of the following: (i) using TRAFD1 or TRAFD1 transcript as the target sequence and being able to enhance the expression of the TRAFD1 gene expression product; (ii) a construct containing TRAFD1, or a TRAFD1 complementary sequence and capable of forming an enhanced TRAFD1 gene expression product after being introduced into the body; (iii) immune-related cells, differentiated cells thereof or constructs thereof overexpressing the TRAFD1 gene sequence.

8. The use according to claim 7, characterized in that: The functional product is a recombinant plasmid or a recombinant cell that overexpresses TRAFD1.

Images