Preparation method and application of engineered hybrid cell membrane particles

Abstract

The invention relates to the field of biomedicine, in particular to a preparation method and application of engineered hybrid cell membrane particles. According to the preparation method provided by the invention, a cancer cell and CAFs dual-targeting packaging carrier is adopted, and carboplatin and siRNA targeting p65 are entrapped; therefore, tumor cells, CAFs, immune cells and extracellular matrixes in a tumor microenvironment can be targeted at the same time, and further optimization of the tumor microenvironment and enhancement of treatment sensitivity are achieved. According to the present invention, the cell membranes of cancer cells and CAFs derived from autologous tumor tissues are subjected to PH20 engineering overexpression modification treatment, and then the cell membranes are obtained, such that the ECM in the compact tumor microenvironment can be degraded and permeated, and the dual-targeting ability on the cancer cells and the CAFs is represented; the invention provides an efficient and high-targeting carrier guarantee for drug permeation of tumor tissues, and has positive significance and potential application value in the field of ovarian cancer treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a preparation method and application of engineered hybrid cell membrane particles. Background Art

[0002] Epithelial ovarian cancer (EOC) is one of the most lethal gynecological malignancies. According to statistics in 2022, there were 324,603 new cases of EOC and 206,956 deaths worldwide. At present, surgical treatment combined with platinum and paclitaxel chemotherapy is a commonly used treatment method in clinical practice. In the early stages of treatment, most patients can achieve certain therapeutic effects. However, its therapeutic effect has obvious limitations. Nearly half of the patients will experience multiple recurrences, some patients will also have tumor metastasis, and some patients will develop platinum resistance and cannot benefit from chemotherapy. This urgently requires the development of new treatment methods to completely eliminate cancer cells and effectively prevent and treat the recurrence and metastasis of EOC to meet current medical needs.

[0003] In recent years, the key role of the tumor microenvironment in the occurrence and development of tumors has received increasing attention. The tumor microenvironment is composed of multiple components such as tumor cells, stromal cells (such as cancer-associated fibroblasts, CAFs), immune cells and their secreted factors, and extracellular matrix (ECM). Many studies have shown that the tumor microenvironment is an important cause of tumor progression, immunosuppression, chemotherapy resistance, and recurrence and metastasis. For example, cytotoxic drug treatment targeting CAFs, whether it is to eliminate CAFs or reprogram them, can inhibit tumor recurrence and metastasis to a certain extent; immune checkpoint blockade therapy strategies targeting immune cells in the tumor microenvironment can transform the immune response from a tumor-promoting type to a tumor-suppressing type, significantly improving the prognosis and survival of tumor patients; neutralizing antibody therapy targeting the extracellular matrix can effectively improve immune cell infiltration and promote drug delivery.

[0004] Although the above-mentioned treatment methods for various components of the tumor microenvironment have achieved positive effects to a certain extent, due to the multi-level and complex characteristics of the tumor microenvironment, single treatment plans often have many problems. In most cases, tumors will dynamically evolve through compensatory feedback mechanisms, thereby blocking the effect of immunotherapy, generating drug resistance, and even leading to tumor progression, making it difficult for the treatment results to achieve the expected goals. If a variety of drugs are used in combination, it will face difficulties such as the difficulty in accurately selecting the drug action time window, increasing the burden on the patient's body, and the superposition of side effects. In addition, how to efficiently target and enter cells with drugs is still a difficult problem to be overcome. Therefore, there is currently a lack of a multi-dimensional integrated treatment system that can simultaneously target tumor cells, CAFs, immune cells, and extracellular matrix in the tumor microenvironment, thereby effectively improving the tumor microenvironment and increasing treatment sensitivity. Summary of the invention

[0005] In view of this, the present invention proposes a preparation method and application of engineered hybrid cell membrane particles. In the preparation method, a dual-targeting packaging carrier of cancer cells and CAFs (cancer-associated fibroblasts) is used to encapsulate carboplatin (CBP) and siRNA targeting p65 (i.e., sip65); thereby providing a multi-dimensional integrated treatment strategy that can simultaneously target tumor cells, CAFs, immune cells and extracellular matrix in the tumor microenvironment, thereby achieving optimization of the tumor microenvironment and enhancement of treatment sensitivity.

[0006] Specifically, the present invention first targets the cell membranes of cancer cells and CAFs derived from autologous tumor tissues, performs an engineered overexpression modification process of PH20 (hyaluronidase), and then obtains the cell membranes through extraction operations, so that it can not only degrade and permeate the ECM in the dense tumor microenvironment, but also show dual-targeting capabilities for cancer cells and CAFs. Therefore, the present invention provides an efficient and highly targeted carrier guarantee for drug penetration in tumor tissues, and has positive significance and potential application value in the field of ovarian cancer treatment.

[0007] The technical solution of the present invention is achieved in this way:

[0008] In a first aspect, the present invention provides a method for preparing engineered hybrid cell membrane particles, comprising the following steps:

[0009] S1 used PDDA to modify the surface of Ti2C3 MXene, a two-dimensional nanosheet structure material, to obtain PMxene;

[0010] Platinum is loaded onto the surface of PMxene to synthesize PMCS; wherein the sip65 is siRNA targeting P65;

[0011] S2 constructed ovarian cancer cells overexpressing PH20;

[0012] S3 extracted tumor cell membranes and ovarian cancer CAFs cell membranes respectively;

[0013] S4 extrude the ovarian cancer cells, tumor cell membranes and ovarian cancer CAFs cell membranes overexpressing PH20, and PMCS loaded with sip65 and carboplatin through a liposome extruder.

[0014] Preferably, in some specific embodiments, in step S1, 50 mL of 2 wt.% PDDA is slowly dripped into 10 mL of 1 mg / mL MXene dispersion; then the mixture is stirred under an air atmosphere and washed with deionized water.

[0015] Preferably, in some specific embodiments, in the step S1, the targeting sequence of sip65 comprises one of SEQ ID NOs: 1-4.

[0016] The sip65 sequence includes h_sip65#1, h_sip65#2, m_sip65#3 or m_sip65#4. Among them, h_sip65#1 and h_sip65#2 are human sip65 sequences, and m_sip65#3 and m_sip65#4 are mouse sip65 sequences, respectively as follows:

[0017] siRNA Targeted sequences (5'→3') SEQ ID NO h_sip65#1 CCGGATTGAGGAGAAACGTAAAA 1 h_sip65#2 AACGTAAAAGGACATATGAGACC 2 m_sip65#3 AAGACATTGAGGTGTATTTCACG 3 m_sip65#4 TTGAAGAGAAGCGCAAAAGGACC 4

[0018] Preferably, in some specific embodiments, the step S1 further includes the following steps:

[0019] (a1) 10 mg of PMXene powder was dissolved in 100 mL of sterile double distilled water, and the resulting mixture was stirred for 12 h.

[0020] The resulting mixture was subjected to ultrasonic treatment for 30 min to disperse the PMXene powder into individual particles;

[0021] (a2) 30 mg of carboplatin and 250 μg of SIP65 were mixed to form a mixed solution, and the mixed solution was added to 100 mL of a 0.1 mg / mL PMXene solution, and stirred at 4° C. for 12 h to obtain PMCS nanoparticles;

[0022] (a3) The nanoparticles prepared above are washed, centrifuged and resuspended multiple times to remove unadsorbed carboplatin and SIP65.

[0023] Preferably, in some specific embodiments, the step S2 further includes the following steps:

[0024] (b1) transfecting a human PH20 gene overexpression plasmid into SKOV3 cells, Caov-3 cells or A2780 cells to obtain PH20 overexpressing SKOV3 cells;

[0025] (b2) The mouse PH20 gene overexpression plasmid was transfected into ID8 cells or OVHM cells to obtain PH20 overexpressing ID8 cells.

[0026] Preferably, in some specific embodiments, the step S3 further includes the following steps:

[0027] (c1) Tumor cells were added to membrane protein extraction reagent, fully ground in a grinder for 50 times, centrifuged at 33000g for 10 min, and the supernatant was taken and centrifuged again at 17000g for 50 min. The solution was resuspended in PBS to obtain tumor cell membrane solution. The protein content was determined by BCA method. The membrane mass was taken as the protein content.

[0028] The mass of the cell membrane is calculated as twice the mass;

[0029] (c2) CAFs extracted from tumor tissue were added to membrane protein extraction reagent, fully ground in a grinder 50 times, centrifuged at 33000g for 10 min, and the supernatant was centrifuged again at 17000g for 50 min, resuspended in PBS to obtain tumor cell membrane solution, and the protein content was determined by BCA method.

[0030] The cell membrane mass was calculated as twice the protein mass.

[0031] Preferably, in some specific embodiments, the step S4 further includes the following steps:

[0032] (d1) Obtain ovarian cancer cell membranes overexpressing PH20 and ovarian cancer CAFs cell membranes and mix them at a mass ratio of 1:1.

[0033] After the mixture is combined, it is resuspended in a resuspension solution to a concentration of 3.2 μg / ml to obtain a membrane solution;

[0034] (d2) PMCS loaded with SIP65 and carboplatin and having a PMXene concentration of 0.1 mg / ml was provided, and 1 ml of the membrane solution was co-extruded with the PMCS through a liposome extruder 22 times.

[0035] In a second aspect, the present invention provides a product, including engineered hybrid cell membrane particles prepared by any of the preparation methods described.

[0036] In a third aspect, the present invention provides an application of any one of the preparation methods or products described, wherein the application is non-disease diagnosis or treatment.

[0037] The beneficial effects of the present invention include at least the following:

[0038] The engineered hybrid cell membrane particles (named PH20 / CCM@PMCS) provided by the present invention can achieve efficient drug penetration in the extracellular matrix of tumor tissues, and its structure and performance can effectively increase the concentration of drugs in local tumor tissues and enhance the effect of drugs. The PH20 / CCM@PMCS has the ability to target CAFs and cancer cells at the same time, and through a specific molecular recognition mechanism, it tightly binds to the target cells, thereby significantly inhibiting the proliferation of cancer cells and slowing down the growth and spread of cancer cells.

[0039] In addition, PH20 / CCM@PMCS can effectively reduce the secretion of immunosuppressive factors, angiogenic factors, and matrix remodeling factors. This regulatory effect on the secretion function of CAFs helps to increase the sensitivity of cancer cells to drugs, making cancer cells more susceptible to drugs during chemotherapy; at the same time, it can promote the infiltration of immune cells in tumor tissues, improve the immune status in the tumor microenvironment, and enhance the body's immune defense against tumors.

[0040] The present invention provides an integrated strategy for the treatment of ovarian cancer with high efficiency, specificity and targeting, which has positive significance and potential application value in the field of ovarian cancer treatment, and is expected to provide strong support for improving the treatment effect and prognosis of ovarian cancer patients.

[0041]

Term Explanation

[0042] Epithelial ovarian cancer (EOC) is a malignant tumor that occurs in the epithelial tissue of the ovary.

[0043] Cancer-associated fibroblasts (CAFs) are fibroblasts with specific functions and properties in the tumor microenvironment.

[0044] Tumor microenvironment remodeling (TME): The microenvironment surrounding the tumor is transformed or adjusted to affect the growth, invasion, and metastasis of the tumor.

[0045] Carboplatin (CBP): Its chemical name is 1,1-cyclobutanedicarboxylic acid diamine platinum (II). Its structure is based on the cisplatin template, in which the amine ligand is replaced by a monodentate or bidentate ligand to regulate the electronic, spatial and alkalinity effects. It is commonly used in the treatment of ovarian cancer and lung cancer, and is also used in a series of other tumors, such as cervical cancer, testicular cancer, breast cancer, head and neck cancer, endometrial cancer and bladder cancer.

[0046] NF-κB pathway (Nuclear factor kappa B, NF-κB): an important signal transduction pathway that is involved in regulating a variety of biological processes, such as inflammatory response, immune response and cell proliferation.

[0047] Cancer cell and CAFs dual-targeting packaging vector: A packaging vector that can simultaneously target cancer cells and cancer-associated fibroblasts (CAFs) for use in drug delivery or gene therapy, etc.

[0048] Conditioned medium (CM): The culture medium collected after cell culture, which contains factors and proteins secreted by cells.

[0049] Extracellular matrix (ECM): A complex network structure secreted by cells and surrounding cells, which has an important influence on cell growth, differentiation and function.

[0050] Fibroblast activation protein alpha (FAP): A protein expressed on activated fibroblasts that is associated with tumor growth and invasion.

[0051] Poly(dimethyl diallyl ammonium chloride) (PDDA) is a cationic polymer used to modify the surface properties of nanomaterials.

[0052] Hyaluronidase (Hyaluronoglucosaminidase PH-20, PH20): An enzyme that can degrade hyaluronic acid and is related to tumor infiltration and metastasis.

[0053] PH20-overexpressingCAF-cancerhybrid-cell membrane PH20 / CCM ): A fusion cell membrane of tumor cells and CAFs that have been genetically engineered to express hyaluronidase PH20.

[0054] PH20-overexpressing ID8 membrane (PH20 / ID8): A tumor cell membrane in which the ID8 tumor cell line has been genetically engineered to overexpress the PH20 enzyme.

[0055] Carboplatin-loaded PMXene (PMXene@CBP, PMC): PDDA-modified MXene nanomaterials loaded with carboplatin.

[0056] siRNA targeting p65 (sip65): a siRNA that can specifically silence the expression of the p65 gene. p65 refers to a key protein subunit in the NF-κB signaling pathway.

[0057] PMXene loaded with carboplatin and sip65 (PMXene@CBP-sip65, PMCS): Based on the PDDA-modified MXene nanomaterial loaded with carboplatin, a complex with sip65 is additionally loaded.

[0058] PMXene loaded with SIP65 (PMXene@SIP65, PMS): PDDA-modified MXene nanomaterials loaded with SIP65.

[0059] PDDA-modified MXene (PMXene): A MXene nanomaterial modified with polydiallyldimethylammonium chloride. MXene is a new type of two-dimensional layered nanomaterial with a general chemical formula of M n+1 X n T x (n=1, 2, 3 or 4; M is a transition metal, such as titanium, vanadium, niobium, molybdenum, scandium, yttrium, zirconium, hafnium, tantalum, chromium, tungsten, etc.; X is C and / or N; T x are surface modification groups, such as –OH, =O, =S, –F, –Cl, –Br, –Se, –NH, –Te, etc.).

[0060] PH20 / CCM@PMCS:

[0061] PH20 / CCM@PMCS is a complex whose carrier is a fusion cell membrane of tumor cells and CAFs that have been genetically engineered to express PH20 at the same time (i.e., PH20 / CCM), and which is loaded with PDDA-modified MXene nanomaterials loaded with carboplatin (i.e., PMXene@CBP, referred to as PMCS).

[0062] In some specific embodiments of the present application, the engineered hybrid cell membrane particles provided in the present application are named PH20 / CCM@PMCS; and can also be referred to as "engineered cancer / CAFs hybrid cell membrane coated therapeutic system". That is, in the present application, PH20 / CCM@PMCS, (a) engineered hybrid cell membrane particles and engineered cancer / CAFs hybrid cell membrane coated therapeutic system have the same meaning and can be synonymously replaced with each other. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0064] Figure 1 Schematic diagram of the construction method of PH20 / CCM@PMCS of the present invention;

[0065] Figure 2 The results of Western blot detection of specific proteins (E-cadherin, fibroblast activation protein α and PH20) of tumor cell membrane vesicles, CAF membrane vesicles and PH20 / CCM of the present invention;

[0066] Figure 3 This is the UV-visible absorption spectrum test result of PH20 / CCM@PMCS of the present invention;

[0067] Figure 4 TEM (transmission electron microscope) test results of PH20 / CCM@PMCS of the present invention;

[0068] Figure 5 The cell internalization test results of PH20 / CCM@PMCS of the present invention are shown; the internalization test results of PMCS wrapped by different cell membranes and ID8 or CAF cells are shown respectively;

[0069] Figure 6 The results of the in vivo targeting validation of PH20 / CCM@PMCS of the present invention are shown; the experimental results conducted in C57BL / 6 ovarian orthotopic transplanted tumor model mice, including the distribution of PMC, CCM@PMCS, PH20 / CCM@PMCS, etc. in mice, especially the fluorescence tracking results in the tumor area and major organs (heart, liver, spleen, lung, kidney);

[0070] Figure 7 This is the test result of the inhibitory effect of PH20 / CCM@PMCS on ID8 cell proliferation;

[0071] Figure 8 The flow cytometer test results of the effect of PH20 / CCM@PMCS of the present invention on promoting apoptosis of ID8 cells;

[0072] Fig. 9 The effect of different conditioned medium (CM) of the present invention on T cell differentiation, wherein the bar graph represents the percentage of CD8+T cells in different conditioned medium;

[0073] Fig.10 The effect of different conditioned medium (CM) of the present invention on the angiogenesis of vascular endothelial cells MAEC; wherein the bar graph represents the percentage of segments formed by MAEC under different conditioned medium

[0074] Fig.11 The figure shows the influence of different conditioned medium (CM) of the present invention on the migration of vascular endothelial cells MAEC; wherein the bar graph shows the migration rate percentage of MAEC under different conditioned medium;

[0075] Fig.12 It is an evaluation of the tumor killing effect of different treatment groups of the present invention at the animal level; wherein, the tumor volume bar graph represents the statistical results of the tumor volume of different treatment groups;

[0076] Fig.13 The blood biochemical test results of mice in different treatment groups of the present invention specifically include four indicators: alanine aminotransferase (ALT), albumin (Albumin), total protein (Total Protein) and aspartate aminotransferase (AST);

[0077] Fig.14 The right figure shows the relationship between the hemolysis rate of different treatment groups and the PH20 / CCM@PMCS concentration. DETAILED DESCRIPTION

[0078] In order to make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme in the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially. The acquisition methods of various biological materials described in the embodiments only provide an experimental acquisition method to achieve the specific disclosed purpose, and should not be a limitation on the source of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and moral ethics can be replaced and used according to the prompts in the embodiments.

[0079] The sources of reagents, materials and instruments in the embodiments of the present invention include the following:

[0080] source Item No. / Information PDDA Sigma, USA 409014 MXene Beike Nanotechnology Co., Ltd. - Carboplatin Selleck, USA S1215, purity 99.98% PH20 overexpression plasmid Shanghai Jiman Biotechnology Co., Ltd. NM_001079875.2 (NCBI accession number) Membrane protein extraction reagents Shanghai Bio-Tech Biotechnology Co., Ltd. P0033-1 Liposome Extruder AVANTI, USA 610000 Rabbitanti-SPAM1(antibody) Abclonal, China A22178 Rabbitanti-FAP(antibody) Abclonal, China A23789 Rabbitanti-E-caderin(antibody) Abclonal, China A20798 HRPGoatAnti-RabbitIgG(H+L)(Antibody) Abclonal, China AS014

[0081] Example 1 Preparation of engineered hybrid cell membrane particles PH20 / CCM@PMCS (Construction of engineered cancer / CAFs hybrid cell membrane-coated therapeutic system)

[0082] Schematic diagram of the preparation method of PH20 / CCM@PMCS Figure 1 As shown, the specific steps include:

[0083] 1. Design and synthesis of PMCS

[0084] (1) PMxene was obtained by surface modification of the two-dimensional nanosheet structure material Ti2C3 MXene using PDDA.

[0085] 50 mL of PDDA (2 wt.%) was slowly dripped into 10 mL of 1 mg / mL MXene dispersion. The mixture was then stirred for 24 h under air atmosphere. After washing three times with deionized water, PMXene was obtained.

[0086] (2) Design siRNA targeting P65 (i.e., sip65) and load carboplatin onto the PMxene surface using electrostatic adsorption to synthesize PMCS.

[0087] The sip65 sequence includes h_sip65#1, h_sip65#2, m_sip65#3 or m_sip65#4. Among them, h_sip65#1 and h_sip65#2 are human sip65 sequences, and m_sip65#3 and m_sip65#4 are mouse sip65 sequences, respectively as follows:

[0088] siRNA Targeted sequences (5'→3') SEQ ID NO h_sip65#1 CCGGATTGAGGAGAAACGTAAAA 1 h_sip65#2 AACGTAAAAGGACATATGAGACC 2 m_sip65#3 AAGACATTGAGGTGTATTTCACG 3 m_sip65#4 TTGAAGAGAAGCGCAAAAGGACC 4

[0089] In some specific embodiments of the present invention, taking m_sip65#3 as sip65 as an example, the method is as follows:

[0090] A. 10 mg of PMXene powder was dissolved in 100 mL of sterile double distilled water, and the resulting mixture was stirred for 12 h, followed by ultrasonic treatment of the stirred mixture for 30 min to disperse the PMXene powder into individual particles;

[0091] B. Preparation of PMC nanoparticles: Add 30 mg of carboplatin to 100 mL of 0.1 mg / mL PMXene solution and stir at 4°C for 12 h; Preparation of PMS nanoparticles: Add 250 μg of sip65 to 100 mL of 0.1 mg / mL PMXene solution and stir at 4°C for 12 h; Preparation of PMCS nanoparticles: Mix 30 mg of carboplatin and 250 μg of sip65 to form a mixed solution, add the mixed solution to 100 mL of 0.1 mg / mL PMXene solution and stir at 4°C for 12 h;

[0092] C. The nanoparticles prepared above were subjected to multiple washing, centrifugation and resuspension operations to remove unadsorbed carboplatin and SIP65.

[0093] 2. Construction of engineered ovarian cancer cells with high expression of PH20

[0094] The PH20 (NCBI number: NM_001079875.2) overexpression plasmid was transfected into ID8 ovarian cancer cells to construct PH20 overexpression ID8 ovarian cancer cells. The specific operation is as follows:

[0095] ID8 tumor cells were inoculated into six-well plates, with 200,000 cells in each well. After the cell growth density reached 70%, the PH20 overexpression plasmid and Neofect transfection reagent (purchased from Lingke Chuangzhi Biotechnology Co., Ltd.) were mixed and added to the cell culture medium according to the manufacturer's instructions. After 24 hours of culture in a cell culture incubator, DMEM / F12 complete medium (purchased from Shanghai Yuanpei Biotechnology Co., Ltd.) was replaced. The PH20 overexpression plasmid carries a puromycin resistance gene, and a complete medium containing puromycin is used for subsequent cell culture: on the third day after the addition of the plasmid, a culture medium with 3μg / ml puromycin is added until there is no obvious cell floating death, that is, a PH20 stable transfection cell line is established.

[0096] 3. Tumor cell membrane extraction

[0097] ID8 tumor cells derived from ovarian epithelial cells of C57BL / 6 mice (purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd.) were added with membrane protein extraction reagent, fully ground in a grinder 50 times, centrifuged at 33000g for 10 min, and the supernatant was taken and centrifuged again at 17000g for 50 min, resuspended in PBS to obtain tumor cell membrane solution, and the protein content was determined by the BCA method, and the cell membrane mass was calculated as twice the protein mass.

[0098] 4. Extraction of CAFs cell membrane

[0099] CAFs extracted from tumor tissue were added to membrane protein extraction reagent, fully ground in a grinder 50 times, centrifuged at 33000g for 10min, and the supernatant was taken and centrifuged again at 17000g for 50min. The solution was resuspended in PBS to obtain tumor cell membrane solution. The protein content was determined by BCA method, and the cell membrane mass was calculated as twice the protein mass.

[0100] Among them, CAFs in tumor tissues are derived from the constructed C57BL / 6 ovarian orthotopic transplanted tumor model, and the construction steps are as follows:

[0101] Establishment of C57BL / 6 ovarian orthotopic transplant tumor model:

[0102] First, the mice were anesthetized with 0.3% m / v pentobarbital at a dose of 150 μL / 10 g. Then, 1×10 8 ID8 tumor cell suspension of 100 μL / 200 μL. Three weeks after tumor inoculation, mice were anesthetized again with 0.3% m / v pentobarbital at a dose of 150 μL / 10 g, and then euthanized by cervical dislocation. Tumor tissue was then removed by dissection in a clean bench, and the tumor tissue was rinsed at least twice with PBS buffer containing 1% double antibody until no blood remained.

[0103] Tumor tissue processing and CAFs isolation and acquisition:

[0104] Use sterile scissors to cut the tissue into pieces in a small dish. The scissors are burned with an alcohol lamp and cooled before use. Then move the cut tissue into a 1.5ml EP tube, add an appropriate amount (covering the tissue) of 0.5-1mg / ml collagenase (purchased from Sewell Bio, China), and place it in a 37-degree water bath for 1 hour. During this period, shake it every ten minutes. Then use 70um and 40um filters to filter the tissue blocks digested by collagenase, collect the filtrate and centrifuge it at 1500rpm for 5min. Finally, resuspend the precipitate, and the obtained CAFs in the tumor tissue are inoculated in a cell culture dish and cultured with DMEM / F12 medium (purchased from Yuanpei Bio, China).

[0105] 5. Construction of PH20 / CCM@PMCS (engineered cancer / CAFs hybrid cell membrane-coated therapeutic system)

[0106] Obtaining ovarian cancer cell membranes and ovarian cancer CAFs cell membranes that overexpress PH20, mixing the two at a mass ratio of 1:1, and resuspending them to a concentration of 3.2 μg / ml using a resuspension solution to obtain a membrane solution;

[0107] PMCS loaded with sip65 and carboplatin and having a PMXene concentration of 0.1 mg / ml was provided, and 1 ml of the membrane solution and the PMCS were co-extruded 22 times through a liposome extruder to obtain PH20 / CCM@PMCS (engineered cancer / CAFs hybrid cell membrane-coated therapeutic system).

[0108] The cell membrane of ovarian cancer CAFs and nanoparticle PMCS loaded with carboplatin and RNAi were co-extruded 22 times through a liposome extruder to obtain CAF-M@PMCS (PMCS wrapped in CAFs cell membrane).

[0109] Example 2 Identification of PH20 / CCM@PMCS

[0110] 1. Western Blot showed the presence of specific proteins on tumor cell membrane vesicles, CAF membrane vesicles and PH20 / CCM, including E-cadherin, fibroblast activation protein α (FAP) and PH20 (like Figure 2 (shown) . This indicates that the functionalized membrane protein is retained in the membrane vesicles and co-expressed on the hybrid membrane vesicles after membrane hybridization. Among them, the specific operation of Western Blot is: separate the protein sample to be detected by SDS-PAGE electrophoresis, and transfer the separated protein to a PVDF membrane. Seal the membrane with 5% skim milk for 1 hour, and then incubate with a specific primary antibody at 4°C overnight. Add a secondary antibody that binds to the primary antibody. Use ECL detection reagent to detect the chemiluminescent signal.

[0111] 2. PH20 / CCM@PMCS was constructed as described in Example 1. UV-visible absorption spectroscopy was used to analyze the main components of PMCS. like Figure 3 Shown , PMCS exhibited strong absorption peaks around 229 nm and 260 nm, corresponding to CBP and siRNA, respectively.

[0112] TEM (transmission electron microscopy) images show that PH20 / CCM@PMCS exhibits a core-shell structure, and a dark-bright-dark cell membrane structure is observed on the surface, indicating that the hybrid membrane coating is successful. (like Figure 4 (shown) .

[0113] Example 3 Targeting verification of PH20 / CCM@PMCS

[0114] 1. Fluorescence labeling of PMxene

[0115] (1) Preparation of hydroxylated MXene: 1 g of MXene was added to 100 mL of 50 mg / mL NaOH solution (Sigma, USA) and stirred at 20 °C for 4 h. After the reaction, the solution was repeatedly washed with deionized water until it was neutral, and then vacuum dried at 60 °C.

[0116] (2) Preparation of aminated MXene: The hydroxylated MXene powder obtained above was added to 100 mL of deionized water and subjected to ultrasonic dispersion treatment. Then, 10 mL of APTES (purchased from Sigma-Aldrich, USA) was added and stirred for 6 h. After stirring, the precipitate was washed with deionized water several times and finally dried in vacuum at 60 °C to obtain aminated MXene.

[0117] (3) FITC-labeled aminated MXene: 100 mg of aminated MXene was dispersed in 5 mL of deionized water. 2.5 mg of hydrophilic FITC-NHS (purchased from Biolite, China) was dissolved in 5 mL of deionized water and then added to the aminated MXene solution and stirred for 2 h. After stirring, the solution was centrifuged and the product was lyophilized.

[0118] 2. Preparation and internalization experiments of PMCS wrapped in different cell membranes

[0119] (1) Preparation of PMCS wrapped with different cell membranes: PMCS wrapped with ID8 cell membrane, PMCS wrapped with CAF cell membrane and PMCS wrapped with fusion membrane of CAF and ID8 cell membrane were prepared according to the method of Example 1.

[0120] (2) Internalization experiment: PMCS wrapped by ID8 cell membrane, PMCS wrapped by CAF cell membrane, and PMCS wrapped by fusion membrane of CAF and ID8 cell membrane were added into ID8 or CAF cell culture dishes, respectively.

[0121] The experimental results show (such as Figure 5 shown): PMCS wrapped by ID8 cell membrane can be internalized by ID8 cells, but not by CAF cells. PMCS wrapped by CAF cell membrane can be internalized by CAF cells, but not by ID8 cells. PMCS wrapped by ID8 and CAF hybrid membrane can be internalized by both CAF cells and ID8 cells. This indicates that PH20 / CCM@PMCS has the ability to dually target CAF and tumor cells.

[0122] Example 4 Targeting Verification of PH20 / CCM@PMCS

[0123] 1. Construction of C57BL / 6 ovarian orthotopic transplanted tumor model

[0124] Experimental animals: Four-week-old female C57BL / 6 mice were purchased from Vital River (Beijing, China) and housed in a separately ventilated SPF animal facility.

[0125] 1) Establishment of C57BL / 6 ovarian orthotopic transplanted tumor model: Mice were anesthetized with pentobarbital (concentration of 0.3% m / v, at a dose of 150 μL / 10 g). Subsequently, 1×10 8 ID8 tumor cell suspension of 100 μL / 200 μL.

[0126] 2) Experimental grouping and drug administration: Three weeks after tumor inoculation, mice were randomly divided into groups. On days 0, 4, 8, 12, 16, and 20, mice were injected through the tail vein. The drugs included PMC, PMS, PMCS, CCM@PMCS, and PH20 / CCM@PMCS. The injection dose was 5 mg / kg body weight (calculated based on PMXene concentration) and the injection volume was the same. A control group was set up to inject the same volume of sterile saline.

[0127] 3) Fluorescence tracking and imaging: On day 21 (i.e., 24 h after the last injection), the mice were anesthetized again with 0.3% (m / v) pentobarbital. The anesthetized mice were placed in a SKYSCAN (purchased from Bruker Corporation, Germany) instrument for fluorescence tracking, with the emission wavelength set at 750 nm and the receiving wavelength set at 790 nm, to obtain in vitro fluorescence images of the main organs and tumors removed 24 h after injection.

[0128] 2. Experimental results

[0129] 1) Fluorescence signal in tumor area: Results like Figure 6 As shown in the figure, concentrated fluorescent signals appeared in the tumor area of ​​mice in the PH20 / CCM@PMCS group, and the concentration in the tumor tissue of the PH20 / CCM@PMCS group was higher than that of the CCM@PMCS group. This indicates that PH20 / CCM@PMCS can effectively penetrate the physical barriers in the tumor tissue and achieve deep treatment of the tumor.

[0130] 2) Organ fluorescence accumulation: 24 hours after intravenous injection of CCM@PMCS and PH20 / CCM@PMCS, the heart and spleen showed no obvious fluorescence accumulation, and the liver, lungs and kidneys showed almost no fluorescence. This indicates that the cell membrane-encapsulated nanoparticles have tumor targeting ability.

[0131] Example 5 Evaluation of PH20 / CCM@PMCS tumor inhibition ability in vivo and in vitro

[0132] 1. Verification of tumor killing effect at the cell level:

[0133] The PH20 / CCM@PMCS obtained in Example 1 was added to tumor cells ID8 to verify the proliferation and Apoptotic phenotype, to explore the mechanism by which PH20 / CCM@PMCS promotes cell death.

[0134] 1) Cell proliferation: Resuspend the digested cells at a concentration of 5000 cells / mL. Add 100 μL of the cell suspension to a 3.5 cm culture dish. After 15 days, when cell clusters are visible, the culture should be stopped. Fix with 4% paraformaldehyde, stain with 0.2% (m / v) crystal violet, and then take pictures with a camera. like Figure 7 As shown, PH20 / CCM@PMCS significantly inhibited the proliferation of ID8 cells.

[0135] 2) Cell apoptosis: ID8 cells were inoculated into 6-well plates for conventional culture. When the cells reached 80% fusion, intervention culture was performed. After 24 h of culture, the cells were collected and the apoptosis level was detected by flow cytometry.

[0136] result like Figure 8 As shown, PH20 / CCM@PMCS significantly promoted the apoptosis of ID8 cells.

[0137] The PH20 / CCM@PMCS obtained in Example 1 was added to CAFs and then co-cultured with immune cells. Analysis of immune cell activation. The specific operations are as follows:

[0138] Obtaining conditioned medium: Add the PH20 / CCM@PMCS obtained in Example 1 to CAFs, culture the CAFs in a cell culture incubator for 48 h, and then collect the supernatant in the CAFs culture dish as CM (conditioned medium).

[0139] Mouse T cells were isolated from the spleen of C57BL / 6 mice using a mouse CD3+T cell sorting kit (purchased from Selleck, China). The isolated T cells were incubated with CM from different groups for 72 h, and then the T cells were collected, stained with APC rat anti-mouse CD4 antibody (purchased from Becton, Dickinson and Company, USA) and PE rat anti-mouse CD8a antibody (purchased from Becton, Dickinson and Company, USA), and analyzed by flow cytometry. Results like Fig. 9 As shown, the supernatant of CAFs treated with PH20 / CCM@PMCS significantly promoted the differentiation of T cells into CD8+ T cells.

[0140] The PH20 / CCM@PMCS obtained in Example 1 was added to CAFs and then reacted with vascular endothelial cells MAEC. Co-culture and analysis of angiogenesis. The specific operations are as follows:

[0141] Matrigel (purchased from Corning, USA) was diluted 1:1 and polymerized on a 24-well plate at 37°C for 30 minutes. Vascular endothelial cells MAEC were then added to a 48-well plate at a density of 100,000 cells per well, and conditioned medium from CAFs with different treatments was added. Tubule formation was observed after incubation for 6-8 hours. MAECs were seeded into six-well plates. Three straight lines were drawn using the tip of a micropipette. Conditioned medium from CAFs with different treatments was added. After incubation for 24 hours, the scratch area was recorded. Results like Fig.10 , 11 As shown, the supernatant of CAFs treated with PH20 / CCM@PMCS significantly promoted the angiogenesis and migration of vascular endothelial cells MAECs.

[0142] 2. Evaluation of tumor killing effect at animal level:

[0143] The C57BL / 6 ovarian orthotopic transplant tumor model was constructed (same as in Example 4). PH20 / CCM@PMCS was injected into the tail vein The tumor-bearing mice were treated by radiotherapy, and the tumor size of each group of mice was different. The specific operations are as follows:

[0144] Four-week-old female C57BL / 6 mice were purchased from Vital River (Beijing, China) and housed in a separate ventilated SPF animal facility. The mice were anesthetized with pentobarbital (0.3%, 150 μL / 10 g) and then injected with 1×10 ID8 tumor cell suspension into the left ovary of the mice. 8 / 200μL. Three weeks later, the mice were randomly divided into different groups and treated with the same volume of PMC, PMS, PMCS CCM@PMCS, PH20 / CCM@PMCS or sterile saline injected at 5mg / kg body weight (PMXene concentration) through the tail vein on days 0, 4, 8, 12, 16, and 20. After three weeks of treatment, all tumor-bearing mice were euthanized, and the tumors were collected and photographed. Results like Fig.12 As shown, after treatment with PH20 / CCM@PMCS, the tumors of mice were significantly reduced, proving its tumor-killing effect at the animal level.

[0145] Example 6 Biosafety Inspection

[0146] 1) Mice C57BL / 6 ovarian orthotopic transplant tumor model The establishment is the same as Example 4.

[0147] 2) Blood biochemical test: Infraorbital venous blood was collected from the mice in Example 4, and the blood was allowed to coagulate at room temperature for 20 min, centrifuged at 2500 rpm for 15 min, and the supernatant was collected. A biochemical detection kit (purchased from Mindray, China) was used, and the samples were processed according to the manufacturer's instructions. The test was performed using a fully automatic biochemical analyzer (purchased from Toshiba, Japan). Results like Fig.13 As shown, the liver and kidney functions of mice in each group were within the normal range.

[0148] 3) Hemolysis experiment: 1 mL of blood was collected from the orbital vein of C57BL / 6 mice. The blood was then centrifuged at 600g for 5 min at 4°C. The washed precipitate was dissolved in 10 mL of PBS. Each group of RBC (Red Blood Cells) solution was incubated with 0.8 mL of pure water (positive control), PBS (negative control) or different concentrations of PH20 / CCM@PMCS (PMXene concentration ranged from 10 μg / mL to 10000 μg / mL) for 4 h, and then centrifuged at 12000g for 5 min. The absorbance of the supernatant was measured at 541 nm using an ELISA reader, and the hemolysis rate of different groups was calculated (the calculation formula is as follows).

[0149]

[0150] result like Fig.14 As shown, in the PH20 / CCM@PMCS treatment groups with different concentrations, there were red blood cell sediments at the bottom of the centrifuge tube and the supernatant was clear, indicating that almost no hemolysis occurred at these concentrations. As the PH20 / CCM@PMCS concentration increased from 10μg / mL to 10000μg / mL, the hemolysis rate was almost 0, indicating that at these working concentrations, PH20 / CCM@PMCS caused almost no hemolysis.

[0151] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for preparing engineered hybrid cell membrane particles, characterized in that: The steps include: S1 uses PDDA to modify the surface of Ti2C3 MXene, a two-dimensional nanosheet structure material, to obtain PMxene; sip65 and carboplatin are loaded onto the surface of PMxene to synthesize PMCS; wherein the sip65 is siRNA targeting P65; S2 constructed ovarian cancer cells overexpressing PH20; S3 extracted tumor cell membranes and ovarian cancer CAFs cell membranes respectively; S4 extruded the cell membranes of ovarian cancer cells and ovarian cancer CAFs overexpressing PH20 and PMCS loaded with SIP65 and carboplatin through a liposome extruder.

2. The preparation method according to claim 1, characterized in that: Also includes: In step S1, 50 mL of 2 wt.% PDDA is slowly dripped into 10 mL of 1 mg / mL MXene dispersion; The mixture was then stirred under an air atmosphere and washed with deionized water.

3. The preparation method according to claim 1, characterized in that: Also includes: In the step S1, the targeting sequence of sip65 includes one of SEQ ID NOs: 1-4.

4. The preparation method according to claim 3, characterized in that: The step S1 further includes the following steps: (a1) 10 mg of PMXene powder was dissolved in 100 mL of sterile double distilled water, and the resulting mixture was stirred for 12 h, followed by ultrasonic treatment of the stirred mixture for 30 min to disperse the PMXene powder into individual particles; (a2) 30 mg of carboplatin and 250 μg of SIP65 were mixed to form a mixed solution, and the mixed solution was added to 100 mL of a 0.1 mg / mL PMXene solution, and stirred at 4° C. for 12 h to obtain PMCS nanoparticles; (a3) The nanoparticles prepared above are washed, centrifuged and resuspended multiple times to remove unadsorbed carboplatin and SIP65.

5. The preparation method according to claim 1, characterized in that: The step S2 further includes the following steps: (b1) transfecting a human PH20 gene overexpression plasmid into SKOV3 cells, Caov-3 cells or A2780 cells to obtain PH20 overexpressing SKOV3 cells, PH20 overexpressing Caov-3 cells or PH20 overexpressing A2780 cells; (b2) The mouse PH20 gene overexpression plasmid was transfected into ID8 cells or OVHM cells to obtain PH20 overexpression ID8 cells and PH20 overexpression OVHM cells.

6. The preparation method according to claim 1, characterized in that: The step S3 further includes the following steps: (c1) Tumor cells were added to membrane protein extraction reagent, fully ground in a grinder for 50 times, centrifuged at 33,000 g for 10 min, the supernatant was taken and centrifuged again at 17,000 g for 50 min, and resuspended in PBS to obtain tumor cell membrane solution. The protein content was determined by the BCA method, and the cell membrane mass was calculated as twice the protein mass; (c2) CAFs extracted from tumor tissue were added to membrane protein extraction reagent, fully ground in a grinder 50 times, and centrifuged at 33000g. After 10 min, the supernatant was taken and centrifuged again at 17000g for 50 min, and resuspended in PBS to obtain tumor cell membrane solution. The protein content was determined by BCA method. The cell membrane mass was calculated as twice the protein mass.

7. The preparation method according to claim 1, characterized in that: The step S4 further includes the following steps: (d1) obtaining ovarian cancer cell membranes and ovarian cancer CAFs cell membranes that overexpress PH20, mixing the two at a mass ratio of 1:1, and resuspending them in a resuspension solution to a concentration of 3.2 μg / ml to obtain a membrane solution; (d2) PMCS loaded with SIP65 and carboplatin and having a PMXene concentration of 0.1 mg / ml was provided, and 1 ml of the membrane solution was co-extruded with the PMCS through a liposome extruder 22 times.

8. A product, characterized in that Including engineered hybrid cell membrane particles prepared by the preparation method according to any one of claims 1-7.

9. The preparation method according to any one of claims 1 to 7 or the use of the product according to claim 8, characterized in that: The application is not disease diagnosis or treatment.

10. The use according to claim 9, characterized in that: Include at least one of the following: (c1) preparing products for the treatment or adjuvant treatment of epithelial ovarian cancer; (c2) preparing a product for preventing epithelial ovarian cancer; (c3) Preparing a product for the prognosis of epithelial ovarian cancer.

Images