New orange thermoascomycetes and application thereof

Abstract

The invention belongs to the technical field of fermentation of brewing microorganisms, and particularly relates to a novel orange thermoascomycete strain capable of producing high-yield enzyme and producing various flavor substances and application of the novel orange thermoascomycete strain. In order to further enrich beneficial microorganisms in a white spirit brewing environment, the invention provides a novel orange thermoascus aurantiacus strain, and the preservation number of the novel orange thermoascus aurantiacus strain is CGMCC (China General Microbiological Culture Collection Center) No.41578. When the strain is used for preparing mouldy bran and yeast for making hard liquor, various hydrolases can be produced through metabolism; the prepared and produced enhanced yeast for making hard liquor can produce various hydrolases such as AAT, beta-GC and NAG, various flavor substances such as gamma-nonanolactone, gamma-butyrolactone and gamma-caprolactone can be produced under the fermentation condition, the requirement for brewing multi-grain Luzhou-flavor liquor is met, a new choice is provided for improving the flavor of the liquor in the liquor brewing process, and the application prospect is wide. The method has a wide application prospect and a great application value.

Description

Technical Field

[0001] The invention belongs to the technical field of brewing microbial fermentation, and in particular relates to a new strain of Thermoascus aurantiacus capable of producing high enzyme and multiple flavor substances and a use thereof. Background Art

[0002] The production of Daqu is carried out in an open, natural environment, and microorganisms are widely distributed in the air, water, raw materials, utensils, and the environment of the koji room. During the koji making process, these natural environment microorganisms settle and enrich on the koji made from starchy raw materials such as wheat. Through temperature and humidity control, they form various beneficial brewing microbial strains and enzyme systems, which are then stored to become brewing Daqu, which is a saccharifying agent and fermentation agent for brewing.

[0003] Thermoascus aurantiacus belongs to the kingdom Fungi, phylum Ascomycota, class Eurotiales, order Eurotiales, family Thermoascus, genus Thermoascus, and is a type of thermophilic fungi, that is, a special fungus group with a minimum growth temperature of 20 or above and a maximum growth temperature of 50 or above. Studies have shown that thermophilic ascomycetes are mostly found in natural environments with high temperatures, such as compost, haystacks, plant seed piles, deserts, and hot springs. They can produce a variety of heat-resistant biomacromolecule hydrolases, especially cellulases, hemicellulases, and ligninases. In recent years, a large number of thermophilic ascomycetes have also been found in the Daqu and fermented grains of Chinese liquor brewing. For example, in the process of making the middle-temperature Daqu of Luzhou-flavor liquor, it was found that the genus Thermoascus was the dominant bacteria, with a proportion of up to 77.1% on the 10th day, and then remained above 40%. Thermoascus may be a functional bacteria for Chinese liquor brewing, but the growth characteristics of pure strains are still unclear. There are very few studies on the enzyme production characteristics of Thermoascus aurantiacus. Reports are limited to the production of cellulase (enzyme activity of 12-25U / mL) and xylanase (enzyme activity of 50-280U / mL) by Thermoascus aurantiacus. There are no reports on the production of other enzymes and flavor substances by Thermoascus aurantiacus, and there are no reports on its related functions in liquor, especially in Daqu production. Summary of the invention

[0004] In order to further enrich the beneficial microorganisms in the liquor brewing environment, the present invention provides a new strain of Thermoascus aurantiacus which can produce high enzyme and multiple flavor substances.

[0005] In order to achieve the above application purpose, the technical solution adopted by the present invention is as follows:

[0006] In the first aspect, the present invention provides a new strain of Thermoascus aurantiacus, with a deposit number of CGMCC No. 41578. The strain was deposited on October 21, 2024; the deposit location is: General Microbiology Center of China Microbiological Culture Collection Administration (CGMCC), address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101. The classification name is Thermoascus aurantiacus.

[0007] Among them, the nucleotide sequence of ITS rRNA of the above-mentioned Thermoascus aurantiacus is shown in SEQ ID NO:1.

[0008] SEQ ID NO: 1 Nucleotide sequence of ITS rRNA of Thermoascus aurantiacus

[0009] .

[0010] Among them, the morphological characteristics of the above-mentioned orange thermophilic ascomycete are: cultured on PDA medium at 50°C, a layer of white aerial hyphae appears at the beginning of the culture, and after 3 days, white particles appear on the surface of the colony, gradually turning to golden yellow to rusty brown, and yellow or brown water droplet-like secretions are produced after 5 to 6 days. The hyphae are branched and septate, the conidia are located at the end of the hyphae, and closed thecae are produced, which are spherical or irregular.

[0011] Among them, the enzyme production characteristics of the above-mentioned orange thermophilic ascomycetes on bran culture medium are: at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0012] Among them, the enzyme production characteristics of the above-mentioned orange thermophilic ascomycetes on pure wheat culture medium are: at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0013] Among them, the enhanced enzyme production characteristics of the above-mentioned orange Thermoascus fungus are: at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0014] In a second aspect, the present invention provides a microbial agent containing the above-mentioned Thermoascus aurantiacus.

[0015] In a third aspect, the present invention provides use of the above-mentioned Thermoascus aurantiacus or microbial agent in liquor brewing.

[0016] Wherein, the liquor is at least one of sauce-flavor type, strong-flavor type, light-flavor type or rice-flavor type.

[0017] In a fourth aspect, the present invention provides use of the above-mentioned Thermoascus aurantiacus or microbial agent in preparing bran koji, Daqu, fortified Daqu or fermented grains.

[0018] Wherein, the orange thermophilic ascomycetes or microbial agent can metabolize to produce hydrolase, and the hydrolase is at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0019] In a fifth aspect, the present invention provides use of the above-mentioned Thermoascus aurantiacus or microbial agent in producing wine-making flavor substances.

[0020] The flavor substances include at least one of γ-nonalactone, γ-butyrolactone, guaiacol, phenol, isobutanol, 4-vinyl-2-methoxyphenol, n-propanol, γ-caprolactone, ethyl palmitate, 4-methyl-1-pentanol, isophthalic acid dialdehyde, ethyl elaidate, phenylethyl alcohol, palmitic acid, octyl propionate, ethyl acetate, isopentanol, phenylacetaldehyde, methyl oleate, methyl palmitate, ethyl isovalerate, butyric acid, ethyl butyrate, phenylacetic acid or ethyl phenylacetate.

[0021] Wherein, the flavor substance is obtained by fermenting the above-mentioned orange thermophilic ascomycetes or microbial agents in potato glucose liquid culture medium or five-grain flour.

[0022] Beneficial effects: The present invention isolates and screens a new strain of orange thermophilic ascus (Thermoascus aurantiacus) from the medium- and high-temperature Daqu of the Luzhou-flavor type, and the deposit number is CGMCC No. 41578. The strain is used to prepare bran koji and Daqu, and can metabolize and produce a variety of hydrolases; the preparation and production of enhanced Daqu can produce a variety of hydrolases such as AAT, β-GC, NAG, etc., and can produce a variety of flavor substances such as γ-nonalactone, γ-butyrolactone, γ-caprolactone, etc. under fermentation conditions, which meets the needs of brewing multi-grain Luzhou-flavor liquor, provides a new choice for improving the flavor of liquor in liquor brewing, and has broad application prospects and great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 A phylogenetic tree constructed based on the Neighbor-Joining method of the ITS sequence of the Thermoascus aurantiacus WLY-WMCC30125 of the present invention;

[0024] Figure 2 This is a microscopic morphology of the orange thermophilic ascomycete WLY-WMCC30125 of the present invention;

[0025] Figure 3 This is a colony morphology diagram of Thermoascus aurantiacus WLY-WMCC30125 of the present invention;

[0026] Figure 4This is a diagram showing the results of enzyme production in bran koji prepared on the bran culture medium of Thermoascus aurantiacus WLY-WMCC30125 of the present invention;

[0027] Figure 5 This is a diagram showing the results of enzyme production by preparing Daqu on pure wheat culture medium with the orange thermophilic ascomycete WLY-WMCC30125 of the present invention;

[0028] Figure 6 This is a diagram showing the results of the enzyme production enhancement of the orange thermophilic ascomycete WLY-WMCC30125 of the present invention.

[0029] The new strain of Thermoascus aurantiacus of the present invention has a deposit number of CGMCC No. 41578. The strain was deposited on October 21, 2024; the deposit location is: General Microbiology Center of China Microbiological Culture Collection Administration (CGMCC), address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101. The classification name is Thermoascus aurantiacus. DETAILED DESCRIPTION

[0030] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clear, the present application is further described in detail below in combination with the implementation methods. Unless otherwise defined, all scientific and technological terms used herein have the same meanings as understood by ordinary technicians in the field.

[0031] The enzymes and abbreviations appearing in the present invention are as follows: The enzymes and abbreviations appearing in the present invention are as follows: α-glucosidase (EC 3.2.1.20 abbreviated as α-GC), β-glucosidase (EC 3.2.1.21 abbreviated as β-GC), α-galactosidase (EC 3.2.1.22 abbreviated as α-GAL), β-galactosidase (EC 3.2.1.23 abbreviated as β-GAL), N-acetyl-β-glucosidase (EC 3.2.1.52 abbreviated as NAG), carboxylesterase (EC 3.1.1.1 abbreviated as CarE), alkaline protease (EC 3.4.4.16 abbreviated as AKP), acid protease (EC 3.4.23.18 abbreviated as ACP), neutral protease (abbreviated as NP), lipase (EC 3.1.1.3 abbreviated as LPS), β-glucuronidase (EC 3.2.1.52 abbreviated as NAG), 3.2.1.31 abbreviated as β-GD), saccharifying enzyme (EC3.2.1.3), exo-β-1,4-glucanase / cellobiosidase (EC 3.2.1.91 abbreviated as C1), α-L-arabinofuranosidase (EC 3.2.1.55 abbreviated as α-L-Af), β-xylosidase (EC 3.2.1.37), cellulase (EC 3.2.1.4 abbreviated as CL), α-amylase (EC 3.2.1.1 abbreviated as α-AL), β-amylase (EC 3.2.1.2 abbreviated as β-AL), pectinase, plant sucrase (EC 3.2.1.26 abbreviated as P-SC), polygalacturonase (EC 3.2.1.15 abbreviated as PG), acyltransferase (EC 2.3.1.- abbreviated as AAT).

[0032] There are very few studies on the enzyme production characteristics of orange Thermoascus, and the reports are limited to the production of cellulase (enzyme activity of 12-25U / mL) and xylanase (enzyme activity of 50-912U / mL, the highest enzyme activity of 4625.4U / g (dry culture medium)) by orange Thermoascus. There are no reports of the production of other enzymes by orange Thermoascus. In one embodiment of the present invention, a new enzyme production type and spectrum of orange Thermoascus are proposed for the first time. The strain deposit number is CGMCC No.41578. The deposit time is October 21, 2024; the deposit center is: General Microbiological Center of China Microbiological Culture Collection Administration, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101. The classification name is Thermoascus aurantiacus. It was screened and isolated from the medium-high temperature Daqu of Wuliangye Co., Ltd. in Yibin. Its biological characteristics are: cultured on PDA medium at 50°C, with a layer of white aerial hyphae at the beginning of culture. After 3 days, white particles appeared on the surface of the colony, gradually turning to golden yellow to rust brown, and yellow or brown water droplet-like secretions were produced after 5 to 6 days. The hyphae are branched and septate, and the conidia are located at the end of the hyphae, producing closed thecae, spherical or irregular.

[0033] Among them, the nucleotide sequence of ITS rRNA of Thermoascus aurantiacus described in the present invention is shown in SEQ ID NO:1.

[0034] In one embodiment of the present invention, the strain is used to prepare bran koji on bran culture medium to produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0035] In one embodiment of the present invention, the strain is used to prepare Daqu on pure wheat culture medium to produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0036] In one embodiment of the present invention, the strain is used to prepare enhanced Daqu capable of producing at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0037] In one embodiment of the present invention, the orange thermophilic ascomycete is subjected to liquid static fermentation with potato glucose and five-grain flour to simulate pit fermentation, and various flavor substances such as γ-nonalactone, γ-butyrolactone, γ-caprolactone, phenol, guaiacol, etc. can be produced under fermentation conditions, meeting the needs of multi-grain Luzhou-flavor liquor brewing, increasing the flavor substance composition and content in liquor brewing, and providing a basis for improving the flavor of liquor.

[0038] Specific examples will be listed below to explain the scheme of the present invention. It will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in this area or the product instructions are used. Reagents or instruments used that do not indicate manufacturers are all conventional products that can be obtained commercially.

[0039] Example 1 Strain Screening

[0040] 1. Initial screening of strains

[0041] Ingredients: Medium-high temperature Daqu from Wuliangye Yibin Co., Ltd.

[0042] Culture medium: Potato dextrose agar (PDA): a commercial synthetic culture medium purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021052. Potato dextrose liquid culture medium: a commercial synthetic culture medium purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053.

[0043] 2. Test methods:

[0044] Select the medium-high temperature Daqu of Yibin Wuliangye Co., Ltd., crush it, weigh 20g in 180mL sterile water, and enrich it on a shaker for 30min. Then dilute it 10 times in a gradient, select 3 gradients with appropriate dilutions to coat the PDA plate, and then invert the plate in a 50℃ incubator for 3-4d; after the colonies grow, select single mold colonies with different colony morphology in the PDA medium, number them and purify them by streaking, and repeat the purification 2-3 times until the colonies on the plate are all in the same morphology. Pick a single colony to make a water-immersion slide, observe the bacterial cell morphology under a microscope, and the separation and purification are completed. The inclined test tube is stored in a 4℃ refrigerator.

[0045] Example 2 Morphological characteristics of the orange thermophilic ascomycetes of the present invention

[0046] Newly activated bacteria were used in each of the following tests. A small amount of bacteria was inoculated into PDA medium and cultured at 50°C for 5-7 days.

[0047] Colony and bacterial morphology observation:

[0048] The activated orange thermophilic ascomycetes were inoculated on the PDA medium by streaking with an inoculation loop, cultured at 50°C for 5-7 days, and the colony morphology was observed; a small amount of bacteria were picked up with an inoculation needle, and the bacterial morphology was observed under a microscope.

[0049] Observation results of the fungus: The hyphae are branched and septate, the conidia are located at the ends of the hyphae, and the closed thecae are spherical or irregular in shape. Figure 2 shown.

[0050] Colony observation results: Cultivated on PD medium at 50°C, a layer of white aerial hyphae appeared at the beginning of the culture. After 3 days, white particles appeared on the surface of the colony, gradually turning to golden yellow to rust brown. After 5 to 6 days, yellow or brown water droplet-like secretions were produced. Figure 3 shown.

[0051] Example 3 Identification of strains by molecular biology

[0052] The genomic DNA of the strain was extracted and amplified with the forward primer ITS1, SEQ ID NO:2: TCCGTAGGTGAACCTGCGG and ITS4, SEQ ID NO:3: TCCTCCGCTTATTGATATGC using the ITS universal primer pair. The reaction conditions were: 94°C pre-denaturation for 4 min followed by the following cycle: 94°C denaturation for 45 s, 55°C annealing for 45 s, 72°C extension for 60 s, 30 cycles; 72°C extension for 10 min. The results of 2% agarose gel electrophoresis were good. The PCR amplification product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the sequencing results were compared by BLAST sequence comparison on the NCBI database. Through ITS sequence comparison, the homology with Thermoascus aurantiacus was 100%, and the ITS sequence phylogenetic tree of the strain showed homology with Thermoascus aurantiacus. Combined with the colony morphology, bacterial characteristics, and ITS rDNA gene sequence analysis, it was determined to be a thermophilic ascomycete of orange and named WLY-WMCC30125. The strain was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on October 21, 2024, with the deposit number CGMCCNo.41578, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0053] Its biological characteristics are: cultured on PDA medium at 50℃, with a layer of white aerial hyphae at the beginning of the culture, and after 3 days, white particles appear on the surface of the colony, gradually turning golden yellow to rust brown, and yellow or brown water droplet-like secretions are produced after 5-6 days. The hyphae are branched and septate, and the conidia are located at the end of the hyphae, producing closed thecae, which are spherical or irregular.

[0054] Example 4 Enzyme production properties of strain WLY-WMCC30125 of the present invention

[0055] Culture medium: Activated culture medium: Commercial synthetic culture medium, purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053;

[0056] Bran medium: 10 g bran, 8 mL distilled water, stir to mix, and sterilize at 121°C for 20 min;

[0057] Pure wheat culture medium: Pure wheat is moistened with hot water and then crushed according to the existing conventional koji making process requirements, mixed with water to form koji embryo, and sterilized at 121℃ for 20 minutes;

[0058] Strengthened Daqu: Pure wheat is moistened with hot water and then crushed according to the preparation process requirements of Luzhou-flavor liquor Daqu, and water is added to mix it into qu embryo.

[0059] Enzymatic property analysis: The present invention detected 22 kinds of hydrolases, namely α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT. The detection of these 22 enzyme activities was carried out with reference to the quantitative kit (Beijing Box Biotechnology Co., Ltd.).

[0060] The standard curve of α-GC is y=0.032x+0.0068, R 2 =0.9999; the standard curve of β-GC is y=0.0033x+0.0045, R 2 =0.9999; the standard curve of α-GAL is y=0.0034x-0.0008, R 2 =0.9996; the standard curve of β-GAL is y=0.0036x+0.0142, R 2 =0.9994; the standard curve of saccharifying enzyme is y=0.2954x-0.1997, R 2 =0.9933; the standard curve of α-L-Af is y=0.0073x+0.0195, R 2 =0.9997; the standard curve of β-xylosidase is y=1.5042x-0.0768, R 2 =0.9959; the standard curve of CL is y=0.3758x-0.0636, R 2 =0.9999; the standard curves of α-AL and β-AL are y=1.991x-0.1095, R 2=0.9999; the standard curve of pectinase is y=0.1042x-0.1389, R 2 =0.9931; the standard curve of P-SC is y=0.3398x-0.06, R 2 =0.9993; the standard curve of PG is y=0.1983x+0.0741, R2=0.9972; the standard curve of LPS is y=0.0067x+0.1531, R 2 =0.9952; the standard value of NAG is 0.285; the standard value of CarE is 0.004, the standard value of ACP is 0.753, the standard value of AKP is 0.696, the standard value of NP is 0.753; the standard value of β-GD is 0.001; in all standard curves, "y" is the absorbance value and "x" is the concentration of the standard.

[0061] Among them, the corresponding substrate generation amount is calculated based on the absorbance value combined with the standard curve.

[0062] The definition of α-GC enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of β-GC enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of α-GAL enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of β-GAL enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of NAG enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system l p-nitrophenol is defined as one unit of enzyme activity; CarE enzyme activity unit definition: under the condition of 37℃, the catalytic absorbance value increase of 0.5 per g of Daqu per minute is defined as one unit of enzyme activity; AKP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; ACP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; NP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; LPS enzyme activity unit definition: at 37℃, per g of Daqu, oxidizes 1nmol per minute NADPH is defined as one unit of enzyme activity; β-GD enzyme activity unit definition: the amount of enzyme required to generate 1μmol phenolphthalein per g Daqu per hour is defined as one unit of enzyme activity; saccharifying enzyme activity unit definition: 1mg glucose is generated per g Daqu per hour is defined as one unit of enzyme activity; C1 enzyme activity unit definition: 1nmol p-nitrophenol is generated per g Daqu per hour is defined as one unit of enzyme activity; α-L-Af enzyme activity unit definition: 1nmol p-nitrophenol is generated per g Daqu per minute is defined as one unit of enzyme activity; β-xylosidase enzyme activity unit definition: 1μmol p-nitrophenol is generated per g Daqu per minute is defined as one unit of enzyme activity; CL enzyme activity unit definition: 1μg glucose is catalyzed per g Daqu per minute is defined as one unit of enzyme activity; α-AL and β-AL enzyme activity units definition: 1mg glucose is generated per g Daqu per minute is defined as one unit of enzyme activity; pectinase enzyme activity unit definition: 50℃ pH Under the conditions of 3.5, one unit of enzyme activity is defined as 1 μmol of galacturonic acid produced per gram of Daqu per hour; the definition of P-SC enzyme activity unit is: one unit of enzyme activity is defined as one gram of Daqu catalyzing the hydrolysis of 1 μg of sucrose per minute; the definition of PG enzyme activity unit is: under the conditions of 40℃ and pH 6.0, one unit of enzyme activity is defined as the decomposition of polygalacturonic acid per gram of Daqu per hour to produce 1 mg of galacturonic acid; the definition of AAT enzyme activity unit is: under the conditions of 37℃, the catalytic absorbance change of 0.0005 per gram of Daqu per mL of the system per minute is defined as one unit of enzyme activity.

[0063] (1) The target strain WLY-WMCC30125 was activated with an activation medium. After confirming that there was no contamination, it was inoculated into a bran medium at a 10% inoculum and cultured at 50°C for 7 days. The hydrolase activity after culture was detected. Compared with the blank control group, the strain WLY-WMCC30125 was able to metabolize and produce a variety of hydrolases such as AAT, β-GC, α-GAL, saccharifying enzyme, β-GAL, NAG, CL, C1, α-GC, α-L-Af, β-AL, α-AL and β-GD on the bran medium. Among them, the high-yield AAT (EC 2.3.1.-) reached 4900U / g dry koji, β-GC (EC 3.2.1.21) reached 3117.35U / g dry koji, α-GAL (EC 3.2.1.22) reached 2256.41U / g dry koji, saccharifying enzyme (EC 3.2.1.3) reached 1918.80U / g dry koji, β-GAL (EC 3.2.1.23) reached 1736.03U / g dry koji, NAG (EC 3.2.1.52) reached 1357.24U / g dry koji, CL (EC 3.2.1.4) reached 398.6192U / g dry koji, C1 (EC3.2.1.91) reached 398.62U / g dry koji, α-GC (EC 3.2.1.20) reached 131.03U / g dry, α-L-Af (EC 3.2.1.55) reached 104.50U / g dry, β-AL (EC 3.2.1.2) 27.77U / g dry, α-AL (EC 3.2.1.1) 20.22U / g dry, β-GD (EC 3.2.1.31) 5.85U / g dry. Figure 4 shown.

[0064] (2) The target strain WLY-WMCC30125 was activated with an activation medium. After confirming that there was no contamination, it was inoculated into a pure wheat medium at a 10% inoculation rate to prepare Daqu and cultured at 50°C for 7 days. The hydrolase activity after culture was detected. Compared with the blank control group, the strain WLY-WMCC30125 was able to metabolize and produce a variety of hydrolases such as AAT, NAG, β-GC, saccharifying enzyme, C1, α-GAL, β-GAL and α-L-Af on the pure wheat medium.

[0065] Among them, AAT (EC 2.3.1.-) reached 2093.33U / g dry yeast, NAG (EC 3.2.1.52) reached 550.80U / g dry yeast, β-GC (EC 3.2.1.21) reached 369.77U / g dry yeast, saccharifying enzyme (EC 3.2.1.3) reached 92.70U / g dry yeast, C1 (EC3.2.1.91) reached 87.11U / g dry yeast, α-GAL (EC 3.2.1.22) reached 53.36U / g dry yeast, β-GAL (EC 3.2.1.23) reached 39.57U / g dry yeast, α-L-Af (EC 3.2.1.55) reached 9.30U / g dry yeast. Figure 5 shown.

[0066] (3) The target strain WLY-WMCC30125 was activated with an activation medium. After confirming that there was no contamination, it was inoculated into fresh koji embryos at a 10% inoculation rate and cultured at 50°C for 7 days. The hydrolase activity after culture was detected. Compared with the unenhanced group, the enhanced Daqu prepared by strain WLY-WMCC30125 can metabolize and produce multiple hydrolases such as AAT, β-GC, NAG, AKP, α-GAL, β-GAL, C1 and α-GC.

[0067] AAT (EC 2.3.1.-) reached 1720U / g dry, β-GC (EC 3.2.1.21) reached 1420.56U / g dry, NAG (EC3.2.1.52) reached 696.32U / g dry, AKP (EC 3.4.4.16) reached 511.37U / g dry, α-GAL (EC 3.2.1.22) reached 298.11U / g dry, β-GAL (EC 3.2.1.23) reached 289.90U / g dry, C1 (EC 3.2.1.91) reached 178.97U / g dry. Figure 6 shown.

[0068] Example 5 Analysis of main flavor components in the fermentation broth of strain WLY-WMCC30125 of the present invention

[0069] Culture medium: Potato dextrose liquid medium. Commercial synthetic culture medium, purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053.

[0070] Culture medium: five-grain powder. Five grains (36% sorghum, 22% rice, 18% glutinous rice, 16% wheat, 8% corn) are ground into fine powder, and boiled with tap water at a ratio of 1:10. Add fine five-grain powder and cook for about 40 minutes (into a porridge-like state), cool to about 60°C, add liquefaction enzyme (5g / 3L) and saccharification enzyme (5g / 3L) at the same time, keep at 62°C for liquefaction and saccharification for 4 hours, stir every 1 hour, place in a 4°C refrigerator overnight, filter through 8 layers of gauze, replenish water, add glucose to make the sugar content reach about 12°Bé, pH about 6.8, and sterilize for later use.

[0071] Pretreatment method of flavor substances in fermentation broth: Accurately pipette 1.0 mL of fermentation broth into a headspace bottle, then add 0.3 g of sodium chloride and 6 μL of 4-octanol (concentration is 2 ppm), insert the headspace bottle filled with the sample into the extraction column, place it in a 50°C water bath for equilibration for 15 minutes, extract for 45 minutes, and then put it on the machine for testing.

[0072] After the flavor compounds in the fermentation broth were extracted by pretreatment, they were subsequently analyzed by HS-SPME. The separation was performed according to the following procedure: GC conditions: DB-WAX capillary column (30m×250μm×0.25μm); carrier gas was helium (purity ≥99.999%), flow rate 1mL / min; injection method: splitless injection; column temperature: starting temperature 60℃, maintained for 1min, increased to 200℃ at 8℃ / min, maintained for 1min, increased to 280℃ at 30℃ / min, maintained for 2min; injection port temperature: 250℃; auxiliary heating temperature 280℃. As shown in Table 1, unit: ug / L.

[0073] Table 1 Main flavor substances of strain WLY-WMCC30125 in potato glucose and five-grain flour fermentation broth

[0074]

[0075]

[0076] It can be seen from the above embodiments that the WLY-WMCC30125 strain of the present invention can be used to ferment and produce a variety of flavor substances, especially ester substances, among which γ-nonalactone, γ-butyrolactone, γ-caprolactone, phenol, guaiacol, etc. are important trace components of aroma and flavor in liquor. Using them in liquor brewing can enhance the flavor of liquor and brew liquor with better flavor, which has great application value.

Claims

1. A new strain of Thermoascus aurantiacus, characterized in that: The deposit number is CGMCC No.41578.

2. A microbial agent, characterized in that: Contains the Thermoascus aurantiacus according to claim 1.

3. Use of the Thermoascus aurantiacus described in claim 1 or the microbial agent described in claim 2 in liquor brewing.

4. The use according to claim 3, characterized in that: The liquor is at least one of sauce-flavor type, strong-flavor type, light-flavor type or rice-flavor type.

5. Use of the Thermoascus aurantiacus according to claim 1 or the microbial agent according to claim 2 in preparing bran koji, daqu, fortified daqu or fermented grains.

6. The use according to claim 5, characterized in that: The orange thermophilic ascomycetes or microbial agent can metabolize to produce hydrolases, and the hydrolases are at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

7. Use of the Thermoascus aurantiacus described in claim 1 or the microbial agent described in claim 2 in producing wine flavor substances.

8. The use according to claim 7, characterized in that: The flavor substances include at least one of γ-nonalactone, γ-butyrolactone, guaiacol, phenol, isobutanol, 4-vinyl-2-methoxyphenol, n-propanol, γ-caprolactone, ethyl palmitate, 4-methyl-1-pentanol, isophthalic acid dialdehyde, ethyl elaidate, phenylethyl alcohol, palmitic acid, octyl propionate, ethyl acetate, isopentanol, phenylacetaldehyde, methyl oleate, methyl palmitate, ethyl isovalerate, butyric acid, ethyl butyrate, phenylacetic acid or ethyl phenylacetate.

9. The use according to claim 8, characterized in that: The flavor substance is obtained by fermenting the orange thermophilic ascomycetes described in claim 1 or the microbial agent described in claim 2 in a potato glucose liquid culture medium or five-grain flour.

Images