New monascus purpureus strain and application thereof

Abstract

The invention belongs to the technical field of brewing microbial fermentation, and particularly relates to a new monascus purpureus strain and application thereof. In order to further enrich beneficial microorganisms in a white spirit brewing environment, the invention provides a new Monascus purpureus strain capable of producing protease and hydrolase at high yield, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.41533. The strain is used for preparing mouldy bran, yeast for making hard liquor and strengthened yeast for making hard liquor, and various hydrolases for brewing can be produced at high yield; and various flavor substances such as phenethyl alcohol, isoamyl alcohol and phenylacetaldehyde can be produced under the simulated pit fermentation condition, so that the requirements of brewing of multi-grain Luzhou-flavor liquor are met, a new choice is provided for improving the flavor of liquor in liquor brewing, and the method has wide application prospects and great application value.

Description

Technical Field

[0001] The invention belongs to the technical field of brewing microbial fermentation, and in particular relates to a new strain of Monascus purpureus and a use thereof. Background Art

[0002] The molds in Daqu mainly come from natural enrichment and have high universality. They mainly include Aspergillus niger, Aspergillus oryzae, Monascus purpureus, Rhizopus oryzae, etc. Under suitable culture conditions, molds can produce a large amount of starch, cellulose, hemicellulose and other hydrolases, and are the main saccharifying microorganisms in the winemaking process.

[0003] Monascus is a beneficial bacterium traditionally used by humans. It can not only produce natural pigments, but also has a strong ability to produce enzymes. Monascus can produce a variety of enzymes during its growth, such as amylase, saccharifying enzyme, protease, lipase, etc., which can catalyze the decomposition of fermentation substrates and the generation of various metabolites, and promote the improvement of fermentation quality. Therefore, it is widely used in the brewing industry. Two strains of Monascus with high esterase activity have been screened from the fragrant Daqu of Fenjiu. The esterase activity reached 2.46U / mL by optimizing the culture conditions. There is also an improvement in the saccharifying enzyme activity of purple Monascus liquid fermentation to 1652.36U / mL by optimizing the culture medium and fermentation conditions. However, most of the current research on Monascus is on saccharifying enzymes and esterifying enzymes, while there is little research on its production of proteases and glycosidases. Summary of the invention

[0004] In order to further enrich the beneficial microorganisms in the liquor brewing environment, the present invention provides a new strain of Monascus purpureus which can produce high amounts of protease and hydrolase.

[0005] In order to achieve the above application purpose, the technical solution adopted by the present invention is as follows:

[0006] In the first aspect, the present invention provides a new strain of Monascus purpureus, with a deposit number of CGMCC No. 41533. The strain was deposited on October 11, 2024; the deposit location is: China General Microbiological Culture Collection Center (CGMCC), address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101. The classification name is Monascus purpureus.

[0007] The nucleotide sequence of ITS rRNA of the above-mentioned Monascus purpurogenum strain is shown in SEQ ID NO:1.

[0008] SEQ ID NO:1 Nucleotide sequence of ITS rRNA of Monascus purpurogenus strain

[0009] Acccgtgattattgtacctcctgttgcttcggcgcggccccccggggcccgccggagacatcttctcgaacgctgtctttgaaaaggattgctgtctgagtaaacataccaaatcggttaaaact ttcaacaacggatctcttggttccggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccccctggtattcc gggggcatgcctgtccgagcgtcattactgcccctcaagcgcggcttgtgtgttgggccgccgtcccctgcgcctccgggcaagggggacgggcccgaaaggcagtggcggcgccgcgtccggt cctcgagcgtatggggctttgtcacccgctcagtaggtcgggccggggcctttgccctctccaaccttttttccttaggttgacctcggatcaggtagggatacccgctgaacttaagcatatc.

[0010] Among them, the morphological characteristics of the above-mentioned Monascus purpurogenus are: the mycelium is smooth, transparent and colorless, with septa, and the conidia are spherical or inverted pear-shaped; the front of the colony is pink, the back is red, and there are white aerial hyphae, and the hyphae are dense.

[0011] Among them, the enzyme production characteristics of the bran prepared by the above-mentioned Monascus purpurogenus are: at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0012] Among them, the enzyme production characteristics of the Daqu prepared by the above-mentioned Monascus purpurogenus are: at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0013] Among them, the enzyme production characteristics of the enhanced Daqu prepared by the above-mentioned Monascus purpurogenus are: at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0014] In a second aspect, the present invention provides a microbial agent containing the above-mentioned Monascus purpurogenus.

[0015] In a third aspect, the present invention provides use of the above-mentioned Monascus purpurogenus or microbial agent in liquor brewing.

[0016] Wherein, the liquor is at least one of sauce-flavor type, strong-flavor type, light-flavor type or rice-flavor type.

[0017] In a fourth aspect, the present invention provides the use of the above-mentioned Monascus purpurogenus or microbial agent in the preparation of bran koji, Daqu, fortified Daqu or fermented grains.

[0018] Wherein, the Monascus purpurogenum strain or microbial agent can metabolize to produce hydrolase, and the hydrolase is at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG or AAT.

[0019] In a fifth aspect, the present invention provides the use of the above-mentioned Monascus purpurogenus or microbial agent in producing wine flavor substances.

[0020] The flavor substances include at least one of phenylethyl alcohol, isopentanol, methyl palmitate, phenylacetaldehyde, isobutanol, 2,4-di-tert-butylphenol, diisobutyl phthalate, isobutyric acid, n-pentanol, methyl butyrate, n-valeric acid, ethyl acetate, methyl myristate, n-hexanol, 2-methylpyrazine, 3-acetylpyrrole, benzaldehyde, γ-nonalactone, 2-acetylfuran, 2,5-dimethylpyrazine, ethyl hexanoate or isovaleraldehyde.

[0021] Wherein, the flavor substance is obtained by fermenting the above-mentioned Monascus purpurogenus or microbial agent in a potato glucose liquid culture medium or five-grain flour.

[0022] Beneficial effects: The present invention isolates and screens a new strain of Monascus purpureus from the pit mud of a Luzhou-flavor liquor pit, and the deposit number is CGMCC No. 41533. The strain is used to prepare bran koji, Daqu and enhanced Daqu, and can produce a variety of brewing hydrolases at a high yield; moreover, it can produce a variety of flavor substances such as phenylethanol, isopentanol, phenylacetaldehyde, etc. under simulated pit fermentation conditions, meeting the needs of brewing multi-grain Luzhou-flavor liquor, providing a new choice for improving the flavor of liquor in liquor brewing, and has broad application prospects and great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 A phylogenetic tree constructed based on the Neighbor-Joining method of the ITS sequence of the Monascus purpurogenus strain WLY-WMCC30114 of the present invention;

[0024] Figure 2 This is a microscopic morphology diagram of the Monascus purpurogenum strain WLY-WMCC30114 of the present invention;

[0025] Figure 3 This is a colony morphology diagram of the Monascus purpurogenum strain WLY-WMCC30114 of the present invention;

[0026] Figure 4 This is a diagram showing the results of enzyme production in bran koji prepared on bran culture medium of Monascus purpurogenus strain WLY-WMCC30114 of the present invention;

[0027] Figure 5 This is a diagram showing the results of enzyme production by preparing Daqu on pure wheat culture medium by the Monascus purpurogenus strain WLY-WMCC30114 of the present invention;

[0028] Figure 6 This is a diagram showing the results of simulating enhanced Daqu enzyme production by the Monascus purpurogenus strain WLY-WMCC30114 of the present invention.

[0029] The present invention discloses a new strain of Monascus purpureus, with a deposit number of CGMCC No. 41533. The strain was deposited on October 11, 2024; the deposit location is: China General Microbiological Culture Collection Center (CGMCC), address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101. The classification name is Monascus purpureus. DETAILED DESCRIPTION

[0030] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clear, the present application is further described in detail below in combination with the implementation methods. Unless otherwise defined, all scientific and technological terms used herein have the same meanings as understood by ordinary technicians in the field.

[0031] The enzymes and abbreviations appearing in the present invention are as follows: α-glucosidase (EC 3.2.1.20 abbreviated as α-GC), β-glucosidase (EC 3.2.1.21 abbreviated as β-GC), α-galactosidase (EC 3.2.1.22 abbreviated as α-GAL), β-galactosidase (EC 3.2.1.23 abbreviated as β-GAL), N-acetyl-β-glucosidase (EC 3.2.1.52 abbreviated as NAG), carboxylesterase (EC 3.1.1.1 abbreviated as CarE), alkaline protease (EC 3.4.4.16 abbreviated as AKP), acid protease (EC3.4.23.18 abbreviated as ACP), neutral protease (abbreviated as NP), lipase (EC 3.1.1.3 abbreviated as LPS), β-glucuronidase (EC 3.2.1.31 abbreviated as β-GD), saccharifying enzyme (EC 3.2.1.52 abbreviated as NAG), 3.2.1.3), exo-β-1,4-glucanase / cellobiosidase (EC 3.2.1.91 abbreviated as C1), α-L-arabinofuranosidase (EC 3.2.1.55 abbreviated as α-L-Af), β-xylosidase (EC 3.2.1.37), cellulase (EC 3.2.1.4 abbreviated as CL), α-amylase (EC 3.2.1.1 abbreviated as α-AL), β-amylase (EC 3.2.1.2 abbreviated as β-AL), pectinase, plant sucrase (EC 3.2.1.26 abbreviated as P-SC), polygalacturonase (EC 3.2.1.15 abbreviated as PG), acyltransferase (EC 2.3.1.- abbreviated as AAT).

[0032] In one embodiment of the present invention, a Monascus purpureus is provided, and the deposit number is CGMCC No.41533. The strain was deposited on October 11, 2024; the deposit location is: General Microbiological Center (CGMCC), China Microbiological Culture Collection Administration Committee, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101. The classification name is Monascus purpureus. It was screened and separated from the pit mud of Wuliangye Co., Ltd. in Yibin, and its biological characteristics are: the mycelium is smooth, transparent and colorless, with septa, and the conidia are spherical or inverted pear-shaped; the front of the colony is pink, the back is red, and it has white aerial hyphae and dense hyphae.

[0033] The nucleotide sequence of the ITS rRNA of the Monascus purpurogenum is shown in SEQ ID NO:1.

[0034] In one embodiment of the present invention, the Monascus purpurogenum is used to prepare bran on a bran culture medium, which can produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0035] In one embodiment of the present invention, the Monascus purpurogenum is used to prepare Daqu to produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0036] In one embodiment of the present invention, the Monascus purpurogenum is used to prepare the enhanced Daqu to produce at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

[0037] In one embodiment of the present invention, the Monascus purpurogenus is subjected to liquid static fermentation with potato glucose and five-grain flour to simulate cellar fermentation, and various flavor substances such as phenylethanol, isopentanol, and phenylacetaldehyde can be produced under fermentation conditions, meeting the needs of multi-grain Luzhou-flavor liquor brewing, increasing the flavor substance composition and content in liquor brewing, and providing a basis for improving the flavor of liquor.

[0038] Specific examples will be listed below to explain the scheme of the present invention. It will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in this area or the product instructions are used. Reagents or instruments used that do not indicate manufacturers are all conventional products that can be obtained commercially.

[0039] Example 1 Strain Screening

[0040] 1. Initial screening of strains

[0041] Materials: Cellar mud from the workshop of Wuliangye Yibin Co., Ltd.

[0042] Culture medium: Potato dextrose agar (PDA): a commercial synthetic culture medium purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021052. Potato dextrose liquid culture medium: a commercial synthetic culture medium purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053.

[0043] 2. Test methods:

[0044] Take 1g of pit mud from the workshop of Wuliangye Co., Ltd. in Yibin, add 99mL of normal saline and dilute to 10 -3 、 10 -4 、 10 -5 After the colonies grow, select the mold colonies with different colony morphology in PDA medium, number them and purify them by streaking, repeat the purification 2-3 times until the colonies on the plate are all of the same morphology. Pick a single colony to make a water-immersion slide, observe the bacterial cell morphology under a microscope, and the separation and purification is completed. The inclined test tube is stored in a 4°C refrigerator.

[0045] Example 2 Morphological identification of Monascus purpurogenum of the present invention

[0046] Newly activated bacteria were used in each of the following tests. A small amount of bacteria was inoculated into PDA medium and cultured at 28°C for 3-5 days.

[0047] Colony and bacterial morphology observation:

[0048] The activated Monascus purpurogenum was inoculated on the PDA medium with an inoculation loop, cultured at 28°C for 5-7 days, and the colony morphology was observed; a small amount of bacteria was picked up with an inoculation needle and the bacterial morphology was observed under a microscope.

[0049] Observation results of the fungus: The mycelium is smooth, transparent and colorless, with septa, and the conidia are spherical or inverted pear-shaped. Figure 2 shown.

[0050] Colony observation results: The front of the colony is pink, the back is red, and there are white aerial hyphae, and the hyphae are dense. Figure 3 shown.

[0051] Example 3 Identification of the Molecular Biology of Monascus purpurogenum of the Present Invention

[0052] The genomic DNA of the strain was extracted and amplified with the forward primer ITS1, SEQ ID NO:2: TCCGTAGGTGAACCTGCGG and ITS4, SEQ ID NO:3: TCCTCCGCTTATTGATATGC using the ITS universal primer pair. The reaction conditions were as follows: 94℃ pre-denaturation for 4min followed by the following cycle: 94℃ denaturation for 45s, 55℃ annealing for 45s, 72℃ extension for 60s, 30 cycles; 72℃ extension for 10min. The results of 2% agarose gel electrophoresis were good. The PCR amplification product was sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing results were compared with the BLAST sequence on the NCBI database. Combined with the analysis of colony morphology, bacterial characteristics, and ITS rDNA gene sequence, it was determined to be Monascus purpurogenus in the genus Monascus and named WLY-WMCC30114. The strain was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 11, 2024, with the deposit number CGMCC No.41533, and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0053] Its biological characteristics are: the mycelium is smooth, transparent and colorless, with septa, and the conidia are spherical or inverted pear-shaped; the front of the colony is pink, the back is red, and it has white aerial hyphae and dense hyphae.

[0054] Example 4 Enzyme production properties of strain WLY-WMCC30114 of the present invention

[0055] Culture medium: Activated culture medium: Commercial synthetic culture medium, purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053;

[0056] Bran medium: 10 g bran, 8 mL distilled water, stir to mix, and sterilize at 121°C for 20 min;

[0057] Preparation of Daqu: Pure wheat is moistened with hot water and then crushed according to the existing conventional koji making process requirements, mixed with water to form koji embryo, and sterilized at 121℃ for 20 minutes;

[0058] Strengthened Daqu: Pure wheat is moistened with hot water and then crushed according to the existing preparation process requirements of Luzhou-flavor liquor Daqu, and water is added to mix it into qu embryo.

[0059] Enzymatic property analysis: The present invention detected 22 kinds of hydrolases, namely α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT. The detection of these 22 enzyme activities was carried out with reference to the quantitative kit (Beijing Box Biotechnology Co., Ltd.).

[0060] The standard curve of α-GC is y=0.032x+0.0068, R 2 =0.9999; the standard curve of β-GC is y=0.0033x+0.0045, R 2 =0.9999; the standard curve of α-GAL is y=0.0034x-0.0008, R 2 =0.9996; the standard curve of β-GAL is y=0.0036x+0.0142, R 2 =0.9994; the standard curve of saccharifying enzyme is y=0.2954x-0.1997, R 2 =0.9933; the standard curve of α-L-Af is y=0.0073x+0.0195, R 2 =0.9997; the standard curve of β-xylosidase is y=1.5042x-0.0768, R 2 =0.9959; the standard curve of CL is y=0.3758x-0.0636, R 2 =0.9999; the standard curves of α-AL and β-AL are y=1.991x-0.1095, R 2 =0.9999; the standard curve of pectinase is y=0.1042x-0.1389, R 2 =0.9931; the standard curve of P-SC is y=0.3398x-0.06, R 2 =0.9993; the standard curve of PG is y=0.1983x+0.0741, R 2 =0.9972; LPS standard curve is y=0.0067x+0.1531, R 2 =0.9952; the standard value of NAG is 0.285; the standard value of CarE is 0.004, the standard value of ACP is 0.753, the standard value of AKP is 0.696, the standard value of NP is 0.753; the standard value of β-GD is 0.001; in all standard curves, "y" is the absorbance value and "x" is the concentration of the standard.

[0061] Among them, the corresponding substrate generation amount is calculated based on the absorbance value combined with the standard curve or standard value.

[0062] The definition of α-GC enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of β-GC enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of α-GAL enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of β-GAL enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system; the definition of NAG enzyme activity unit is: one unit of enzyme activity is defined as 1 nmol of p-nitrophenol produced per minute per gram of Daqu in each mL of system l p-nitrophenol is defined as one unit of enzyme activity; CarE enzyme activity unit definition: under the condition of 37℃, the catalytic absorbance value increase of 0.5 per g of Daqu per minute is defined as one unit of enzyme activity; AKP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; ACP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; NP enzyme activity unit definition: at 30℃, per mL of liquid sample, catalyzes the generation of 1μmol of tyrosine per minute, which is defined as one unit of enzyme activity; LPS enzyme activity unit definition: at 37℃, per g of Daqu, oxidizes 1nmol per minute NADPH is defined as one unit of enzyme activity; β-GD enzyme activity unit definition: the amount of enzyme required to generate 1μmol phenolphthalein per g Daqu per hour is defined as one unit of enzyme activity; saccharifying enzyme activity unit definition: 1mg glucose is generated per g Daqu per hour is defined as one unit of enzyme activity; C1 enzyme activity unit definition: 1nmol p-nitrophenol is generated per g Daqu per hour is defined as one unit of enzyme activity; α-L-Af enzyme activity unit definition: 1nmol p-nitrophenol is generated per g Daqu per minute is defined as one unit of enzyme activity; β-xylosidase enzyme activity unit definition: 1μmol p-nitrophenol is generated per g Daqu per minute is defined as one unit of enzyme activity; CL enzyme activity unit definition: 1μg glucose is catalyzed per g Daqu per minute is defined as one unit of enzyme activity; α-AL and β-AL enzyme activity units definition: 1mg glucose is generated per g Daqu per minute is defined as one unit of enzyme activity; pectinase enzyme activity unit definition: 50℃ pH Under the conditions of 3.5, one unit of enzyme activity is defined as 1 μmol of galacturonic acid produced per gram of Daqu per hour; the definition of P-SC enzyme activity unit is: one unit of enzyme activity is defined as one gram of Daqu catalyzing the hydrolysis of 1 μg of sucrose per minute; the definition of PG enzyme activity unit is: under the conditions of 40℃ and pH 6.0, one unit of enzyme activity is defined as the decomposition of polygalacturonic acid per gram of Daqu per hour to produce 1 mg of galacturonic acid; the definition of AAT enzyme activity unit is: under the conditions of 37℃, the catalytic absorbance change of 0.0005 per gram of Daqu per mL of the system per minute is defined as one unit of enzyme activity.

[0063] (1) The target strain WLY-WMCC30114 was activated with an activation medium. After confirming that there was no contamination, it was inoculated into a bran medium at a 10% inoculum and cultured at 28°C for 5 days. The hydrolase activity after culture was detected. Compared with the blank control group, the strain WLY-WMCC30114 was able to metabolize and produce a variety of hydrolases such as AKP, β-GAL, NAG, β-GC, α-GAL, AAT, saccharifying enzyme, C1, CL, α-GC and α-L-Af on the bran medium. Among them, the high yield of AKP (EC 3.4.4.16) reached 1676.61U / g dry koji, β-GAL (EC 3.2.1.23) reached 1546.12U / g dry koji, NAG (EC 3.2.1.52) reached 1322.89U / g dry koji, β-GC (EC 3.2.1.21) reached 1037.24U / g dry koji, α-GAL (EC 3.2.1.22) reached 1017.28U / g dry koji, AAT (EC2.3.1.-) reached 633.33U / g dry koji, saccharifying enzyme (EC 3.2.1.3) reached 282.69U / g dry koji, C1 (EC 3.2.1.91) reached 223.35U / g dry koji, α-GC (EC 3.2.1.23) reached 1322.89U / g dry koji 3.2.1.20) up to 191.86U / g dry yeast and α-L-Af (EC 3.2.1.55) up to 150.30U / g dry yeast, such as Figure 4 shown.

[0064] (2) The target strain WLY-WMCC30114 was activated with an activation medium. After confirming that there was no contamination, it was inoculated in a pure wheat medium at a 10% inoculation rate and cultured at 28°C for 5 days. The hydrolase activity after culture was detected. Compared with the blank control group, the strain WLY-WMCC30114 was able to metabolize and produce a variety of hydrolases such as NAG, saccharifying enzyme, β-GAL, α-GAL, AAT, AKP, C1, α-L-Af and α-GC on pure wheat medium. Among them, the production of NAG (EC3.2.1.52) reached 350.09U / g dry yeast, saccharifying enzyme (EC 3.2.1.3) reached 272.49U / g dry yeast, β-GAL (EC 3.2.1.23) reached 260.35U / g dry yeast, α-GAL (EC3.2.1.22) reached 203.51U / g dry yeast, AAT (EC 2.3.1.-) reached 133.33U / g dry yeast, AKP (EC 3.4.4.16) reached 75.09U / g dry yeast, C1 (EC 3.2.1.91) reached 36.34U / g dry yeast, α-L-Af (EC 3.2.1.55) reached 23.14U / g dry yeast, α-GC (EC 3.2.1.20) reached 19.53U / g dry koji. Figure 5 shown.

[0065] (3) The target strain WLY-WMCC30114 was activated with an activation medium, and after confirming that there was no contamination, it was inoculated into fresh koji embryos at a 10% inoculum and cultured at 28° C. for 5 days. The hydrolase activity after culture was detected. Compared with the unfortified group, the fortified Daqu prepared by strain WLY-WMCC30114 can metabolize saccharifying enzyme (EC 3.2.1.3) up to 1622.45U / g dry qu, β-GC (EC 3.2.1.21) up to 1602.94U / g dry qu, α-GAL (EC 3.2.1.22) up to 1134.05U / g dry qu, β-GAL (EC3.2.1.23) up to 825.45U / g dry qu, AKP (EC 3.4.4.16) up to 456.42U / g dry qu, α-GC (EC 3.2.1.20) up to 359.33U / g dry qu. Figure 6 shown.

[0066] Example 5 Analysis of main flavor components in the fermentation broth of strain WLY-WMCC30114 of the present invention

[0067] Culture medium: Potato dextrose liquid medium. Commercial synthetic culture medium, purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product model 021053.

[0068] Culture medium: five-grain flour. Five grains (36% sorghum, 22% rice, 18% glutinous rice, 16% wheat, 8% corn) are ground into fine powder, and boiled with tap water at a ratio of 1:10. Add fine five-grain flour and cook for about 40 minutes (into a porridge-like state), cool to about 60°C, add liquefaction enzyme (5g / 3L) and saccharification enzyme (5g / 3L) at the same time, keep at 62°C for liquefaction and saccharification for 4 hours, stir every 1 hour, place in a 4°C refrigerator overnight, filter through 8 layers of gauze, replenish water, add glucose to make the sugar content reach about 12°Bé, pH about 6.8, and sterilize for later use.

[0069] Pretreatment method of flavor substances in fermentation broth: Accurately pipette 1.0 mL of fermentation broth into a headspace bottle, then add 0.3 g of sodium chloride and 6 μL of 4-ol (concentration is 2 ppb), insert the headspace bottle filled with the sample into the extraction column, place it in a 50°C water bath for equilibration for 15 minutes, extract for 45 minutes, and then put it on the machine for testing.

[0070] After the flavor compounds in the fermentation broth were extracted by pretreatment, they were subsequently analyzed by HS-SPME. The separation was performed according to the following procedure: GC conditions: DB-WAX capillary column (30m×250μm×0.25μm); carrier gas was helium (purity ≥99.999%), flow rate 1mL / min; injection mode: splitless injection; column temperature: starting temperature 60℃, maintained for 1min, increased to 200℃ at 8℃ / min, maintained for 1min, increased to 280℃ at 30℃ / min, maintained for 2min; injection port temperature: 250℃; auxiliary heating temperature 280℃.

[0071] Semi-quantitative analysis was performed using 4-octanol (12.0 ppb) as the internal standard and peak area normalization method. The peak area of ​​each compound was calculated using selected ion spectrometry (SIM), and the concentration of each compound was calculated based on the ratio of the peak area of ​​the internal standard substance.

[0072] The results are shown in Table 1. The strain WLY-WMCC30114 produced high levels of flavor substances such as phenylethanol, isopentanol, and phenylacetaldehyde in both PDA medium and five-grain flour.

[0073] Table 1: Main flavor substances produced by WLY-WMCC30114 strain on different culture media

[0074]

[0075]

[0076] It can be seen from the above examples that the WLY-WMCC30114 strain of the present invention can be used to ferment and produce a variety of flavor substances. Using it in liquor brewing can enhance the flavor of liquor and brew liquor with better flavor, and has great application value.

Claims

1. A new strain of Monascus purpureus, characterized in that: The deposit number is CGMCC No.41533.

2. A microbial agent, characterized in that: Contains the Monascus purpurogenum according to claim 1.

3. Use of the Monascus purpurogenum described in claim 1 or the microbial agent described in claim 2 in liquor brewing.

4. The use according to claim 3, characterized in that: The liquor is at least one of sauce-flavor type, strong-flavor type, light-flavor type or rice-flavor type.

5. Use of the Monascus purpurogenum according to claim 1 or the microbial agent according to claim 2 in preparing bran koji, daqu, fortified daqu or fermented grains.

6. The use according to claim 5, characterized in that: The Monascus purpurogenum or microbial agent can metabolize to produce hydrolase, and the hydrolase is at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

7. Use of the Monascus purpurogenus described in claim 1 or the microbial agent described in claim 2 in producing wine flavor substances.

8. The use according to claim 7, characterized in that: The flavor substances include at least one of phenylethyl alcohol, isopentanol, methyl palmitate, phenylacetaldehyde, isobutyl alcohol, 2,4-di-tert-butylphenol, diisobutyl phthalate, isobutyric acid, n-pentanol, methyl butyrate, n-valeric acid, ethyl acetate, methyl myristate, n-hexanol, 2-methylpyrazine, 3-acetylpyrrole, benzaldehyde, γ-nonalactone, 2-acetylfuran, 2,5-dimethylpyrazine, ethyl hexanoate or isovaleraldehyde.

9. The use according to claim 8, characterized in that: The flavor substance is obtained by fermenting the Monascus purpurogenum described in claim 1 or the microbial agent described in claim 2 in a potato glucose liquid culture medium or five-grain flour.

Images