Application of soybean GmCLO1 encoding gene in regulating soybean resistance to soybean mosaic virus disease

Abstract

The application discloses application of a soybean GmCLO1 coding gene in regulating resistance of soybean to soybean mosaic virus disease. The application of a soybean GmCLO1 gene shown in SEQ ID NO. 1 in genetically engineering soybean mosaic virus disease resistance. Overexpression of the gene can significantly improve the resistance of soybean to soybean mosaic virus disease, and gene editing knockout of the gene can significantly reduce the resistance of soybean to soybean mosaic virus disease. The soybean coding gene GmCLO1 disclosed by the application can be transformed into soybean through genetic engineering, and finally regulate the resistance of soybean to soybean mosaic virus disease.

Description

TECHNICAL FIELD

[0001] The present application relates to the application of a soybean oil-body calcium-binding protein GmCLO1 encoding gene, and belongs to the field of genetic engineering, in particular to overexpressing a soybean oil-body calcium-binding protein GmCLO1 gene in soybean to increase the resistance to soybean mosaic virus. BACKGROUND

[0002] Soybean mosaic virus disease is a serious disease caused by soybean mosaic virus (SMV). Soybean infected with SMV shows symptoms such as leaf mosaic, leaf curling, leaf malformation and crinkling, brown mottling of seeds, pod malformation, reduced number of pods per plant, reduced plant height, reduced branching, and growth retardation. The resistance of soybean to SMV is divided into two types: resistance to infection and resistance to spread. Resistance to infection belongs to qualitative resistance or vertical resistance, which is an extreme resistance, and the pathogen cannot infect the host. If a single resistant material is planted for a long time, the physiological race of the pathogen will change after a period of time, and more and more dominant races will be produced, so that the originally resistant material becomes a susceptible material, and there is no resistant material to the new variant race or strain, resulting in the loss of field resistance. Resistance to spread belongs to quantitative resistance or horizontal resistance, which means that the pathogen can successfully infect the host and establish a parasitic relationship, but the host can produce a defense response to the pathogen, secrete antitoxin, or inhibit the replication and spread of the pathogen, thereby reducing the reproduction of the pathogen and reducing the damage. Varieties with quantitative resistance do not cause selection pressure on the pathogen, and do not suffer a total loss of resistance, and can achieve satisfactory yield in the case of a large outbreak of disease. At present, it is crucial to explore disease resistance genes related to the two resistance mechanisms to improve the resistance of soybean to SMV and to breed disease-resistant varieties.

[0003] In the previous study, GmCLO1 was found to be strongly responsive to SMV SC7 strain induction by analyzing the soybean transcriptome induced by SMV. GmCLO1 belongs to the soybean caleosins gene family, and the encoded amino acid sequence contains a caleosin conserved domain. Caleosin is an oil body-associated protein that can be detected in plant seeds and vegetative tissues. Caleosin affects lipid metabolism and oil body stability. Reducing the content of a 24-kDa oil body protein in soybean seed oil bodies using RNA interference technology leads to an increase in the content of other caleosins. The storage lipids in Arabidopsis AtCLO1 mutant seeds are delayed in decomposition, the vacuole morphology is changed, the vacuole membrane is abnormal, and the interaction between vacuoles is reduced. AtCLO3 is a leaf oil body caleosin subtype with calcium-dependent protein kinase activity, which is strongly induced by abiotic stresses such as drought, high salinity, and ABA, suggesting that AtCLO3 may be involved in the signal transduction of these abiotic stresses. Rice oil body caleosin gene OsCLO5 negatively regulates cold tolerance through the JA signaling pathway. Whether GmCLO1 in soybeans has resistance to soybean mosaic virus has not been reported. SUMMARY

[0004] The purpose of the present application is to disclose the disease resistance genetic engineering application of soybean caleosin GmCLO1. GmCLO1 gene responds to SMV induction and overexpression in soybeans to increase the resistance of soybeans to SMV.

[0005] GmCLO1 gene can be introduced into soybeans as a target gene to regulate the resistance of soybeans to SMV.

[0006] The purpose of the present application can be achieved by the following technical solutions:

[0007] The application of soybean caleosin gene GmCLO1 in regulating the resistance of soybeans to SMV, wherein the nucleotide sequence of the soybean caleosin gene GmCLO1 is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2.

[0008] The application preferably overexpresses GmCLO1 in soybeans to reduce the accumulation of SMV in soybeans. When constructing a plant overexpression vector or an interference vector using GmCLO1, any enhanced promoter or inducible promoter can be added before the transcription initiation nucleotide. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a selective marker gene (GUS gene, luciferase gene, etc.) in plants. From the safety point of view of transgenic plants, no selective marker gene can be added, and the transformed plants can be screened by stress.

[0009] The soybean oil body calcium protein gene GmCLO1 in the application can reduce the content of SMV in soybean after being transformed into soybean by genetic engineering, and the biomass of SMV increases after the gene is knocked out by CRISPR.

[0010] The plant overexpression vector and knockout vector carrying the GmCLO1 in the application can be used to transform plant cells or tissues by using Ti plasmid, Ri plasmid, plant virus vector, DNA direct transformation, microinjection, electroporation, Agrobacterium-mediated transformation, and the like, and the transformed plant tissues are cultivated into plants.

[0011] Beneficial effects

[0012] The soybean GmCLO1 is a gene encoding oil body calcium protein, contains a Caleosin conserved domain, and belongs to the members of the soybean oil body calcium protein (caleosins) gene family. It is found that the expression amount of GmCLO1 is induced by SMV infection in soybean, the expression amount of GmCLO1 in the overexpression material is significantly increased, the resistance of the transgenic soybean to SMV is increased, and the coding sequence of the GmCLO1 gene is deleted by 41 bases in the knockout mutant, thereby reducing the resistance of the transgenic soybean to SMV. Therefore, GmCLO1 can be used to modify the resistance of soybean to SMV. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 The GmCLO1 gene responds to the induction of soybean mosaic virus SC7. *, **, *** represent significant at 0.05, 0.01 and 0.001 levels, respectively

[0014] Figure 2 The relative expression amount of the GmCLO1 gene in the overexpression transgenic soybean. Jack is the wild type, OE-5 and OE-22 represent two GmCLO1 overexpression transgenic soybean lines, three biological mean values ± standard errors (SE), and ** represents significant at 0.01 level.

[0015] Figure 3 The detection results of the GmCLO1 overexpression transgenic soybean Bar test strip. A. The detection results of the GmCLO1 overexpression transgenic soybean line OE-5, B. The detection results of the GmCLO1 overexpression transgenic soybean line OE-22. The first on the left of the two groups of figures is the control Jack, and the rest are GmCLO1 overexpression transgenic soybean lines.

[0016] Figure 4 The DNA sequencing results of the GmCLO1 knockout transgenic soybean target. Jack is the wild type, KO-2 is the GmCLO1 knockout transgenic soybean, and the sequencing peak is a single peak.

[0017] Figure 5 Leaf of GmCLOl overexpression transgenic soybean 21 days after inoculation with SMV-SC7 strain. PBS is control, 0.01 mol / L phosphate buffer solution was smeared, SC7 is inoculated with SMV SC7 strain, and the legend is 1 cm.

[0018] Figure 6 SMV virus CP protein gene expression determination of GmCLOl overexpression strain and knock-out strain. Jack is wild type, OE-5 and OE-22 represent two GmCLOl overexpression transgenic soybean strains. qRT-PCR detects the expression of SMV virus CP gene. Three biological mean values ± standard error (SE), * and ** represent significant at 0.05 and 0.01 levels, respectively. DETAILED DESCRIPTION

[0019] The application will be further described below in conjunction with the drawings and examples.

[0020] The methods used in the following examples are conventional methods unless otherwise specified.

[0021] Example 1 GmCLOl gene responds to the induced expression of soybean mosaic virus SC7 strain

[0022] The susceptible variety Nannong 1138-2 and the resistant variety KeFeng No. 1 were planted, and the soybean mosaic virus SC7 strain was inoculated at the true leaf stage. The soybean leaf tissue was taken at 0h, 2h, 8h, 24h after inoculation, ground with a mortar, added to a 1.5 mL EP tube containing lysis solution, shaken thoroughly, and then transferred to a new 1.5 mL EP tube. Total RNA was extracted from the leaf using a total RNA extraction kit (Tiangen Biotech Co., Ltd.). The quality of the total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by spectrophotometer. The soybean constitutive expression GmTubulin was used as an internal reference, and the obtained total RNA was used as a template to perform reverse transcription according to the instructions of the reverse transcription kit provided by Japan TaKaRa Company (TaKaRa Primer Script RT reagent kit, Japan). After obtaining the first strand of cDNA, Real-time RT-PCR was performed to detect the expression changes of GmCLOl gene at different time points after inoculation in two varieties. It was found that GmCLOl gene strongly responded to the induction of soybean mosaic virus SC7 strain at each time point in two varieties, and the response was stronger in KeFeng No. 1 TM RT reagent kit, Japan). After obtaining the first strand of cDNA, Real-time RT-PCR was performed to detect the expression changes of GmCLOl gene at different time points after inoculation in two varieties. It was found that GmCLOl gene strongly responded to the induction of soybean mosaic virus SC7 strain at each time point in two varieties, and the response was stronger in KeFeng No. 1 Figure 1The primer sequences for GmTubulin are F: ggagttcacagaggcagag and R: cacttacgcatcacatagc, and the primer sequences for the GmCLO1 gene are F: ttttgctgtccgttggaggt and R: tgtttgccgcgttggatatt.

[0023] Example 2: Genetic Engineering Application of Gene GmCLO1

[0024] 1) Cloning of soybean GmCLO1

[0025] Using Glyma.09g123800 from the soybean reference genome Wm82.a2.v1 in the Phytozome v13 database

[0026] Using the (GmCLO1) gene mRNA sequence as a template, specific primers were designed, and PCR amplification was performed using the obtained cDNA as a template. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 40 seconds, for a total of 35 cycles, and finally incubation at 72℃ for 5 minutes. The PCR product was cloned into the PUC19-T vector, and the CDS sequence of the soybean GmCLO1 gene with a complete coding region of 615 bp was obtained after sequencing. The coding region sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. The primer sequences for gene amplification were F: atggcttcttcaccttcctcag and R: ctacttctctttgcctgaagagtg.

[0027] 2) Construction of plant expression vectors

[0028] The GmCLO1 gene sequence was amplified by PCR from the PUC19-T recombinant vector. GmCLO1 was then ligated into the pBA002 vector using recombination to obtain the pBA002-CLO1 plant overexpression vector. The primer sequences were F: ccgggcccaggcctacgcgtatggcttcttcaccttcctcag and R: cgatcggggaaattcgagctcctacttctctttgcctgaagagtg. The plant transformation vector pBA002 contains a 2×35S strong promoter, which strongly initiates the expression of the target gene GmCLO1 in the recipient. The pBA002-GmCLO1 vector was then transformed into Agrobacterium tumefaciens strain EHA105 using a freeze-thaw method, and soybeans were transformed using the Agrobacterium tumefaciens-mediated soybean cotyledon node transformation method.

[0029] According to the website CRISPR-P (http: / / cbi.hzau.edu.cn / crispr / ), two sgRNAs for GmCLO1 gene were designed, sgRNA1: ggagagaaacccattccact and sgRNA2: gttgcgtgaaatcgggactg. The two sgRNAs were ligated into pSC-M vector, and the recombinant vector was transformed into E. coli, and single colony was picked for bacterial test and sequencing verification. The correct two sgRNA sequences were obtained, indicating that the recombinant vector pSC-M-CLO1 was successfully constructed. Then the vector was transformed into Agrobacterium tumefaciens strain EHA105 by freeze-thaw method, and soybean was transformed by Agrobacterium tumefaciens-mediated soybean cotyledon node transformation method.

[0030] 3) Phenotype identification

[0031] Two GmCLO1 overexpression transgenic soybean lines were obtained, named OE-5 and OE-22, and one GmCLO1 knockout line KO2 was obtained.

[0032] The GmCLO1 overexpression transgenic soybean was planted in a constant temperature and light incubator, and the leaves were taken after 20 days, frozen in liquid nitrogen and stored at -80°C. The total RNA extraction, reverse transcription and fluorescence quantitative PCR reaction were the same as 1). The expression amount of GmCLO1 gene in transgenic soybean was detected. It can be seen from Figure 2 that the expression amount of GmCLO1 in the overexpression transgenic soybean was significantly higher than that of the wild type (JACK). The expression amount of GmCLO1 gene was detected by Bar test paper, and the results are shown in Figure 3 .

[0033] The GmCLO1 gene cloning primer in 1) was used to detect the positive seedlings of GmCLO1 knockout transgenic soybean by PCR product sequencing. The sequencing results of all KO2 plants were single peak, indicating that the material was homozygous. Compared with the wild type Jack, KO2 strain had a 1-base deletion at the first target site and a 40-base deletion at the second target site Figure 4 .

[0034] After the first pair of true leaves unfolded, the wild type Jack, overexpression lines (OE-5 and OE-22) and knockout KO2 lines were inoculated with SMV-SC7 virus. After 21 days of virus inoculation, the disease was observed. The leaves of the control plants WT showed obvious shrinkage, and the leaves of the overexpression lines showed slight mosaic symptoms. Compared with the wild type WT, the inoculated leaves of KO2 showed more severe curling and mosaic symptoms Figure 5). The expression of SMV-CP gene was significantly lower in two over-expression lines than in wild type, and the expression of SMV-CP gene was significantly higher in KO2 mutant than in wild type ( Figure 6 ). The above results showed that KO2 mutant was more susceptible to SMV-SC7 than wild type, and over-expression of GmCLO1 gene reduced the accumulation of SMV-SC7 and improved the resistance of soybean to SMV-SC7. The primer sequences of CP gene were F: cagatgggcgtggttatga and R: acaatgggtttcagcggata.

Claims

1. Use of a soybean gene overexpressed in the construction of soybean varieties with resistance to Soybean Mosaic Virus, said soybean gene GmCLO1 having the sequence shown in SEQ ID NO.

1. GmCLO1 ， coding region sequence as shown in SEQ ID NO. 1.​

Images