Application of gene GmISO5 in regulating soybean seed isoflavone composition and resistance to soybean mosaic virus

By regulating the GmISO5 gene and using gene editing technology, the problem of the difficulty in synergistically improving soybean seed quality and disease resistance has been solved, resulting in a significant increase in soybean seed isoflavone content and resistance, and providing a breeding pathway for new soybean varieties with high nutritional value and virus resistance.

CN122168634AActive Publication Date: 2026-06-09INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-12
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

In existing technologies, there are limited key gene resources that combine soybean grain quality improvement and soybean mosaic virus resistance traits, making it difficult to achieve synergistic improvement in quality and resistance through single gene manipulation.

Method used

By utilizing the gene GmISO5 for regulation, the isoflavone content and resistance of soybean seeds can be controlled by knocking out or overexpressing this gene. Combined with gene editing technology, sgRNA and gene editing vectors targeting the soybean gene GmISO5 are constructed for soybean breeding to obtain new soybean varieties with high isoflavone content and high resistance.

Benefits of technology

This study achieved targeted improvement of functional components in soybean seeds, significantly increasing isoflavone content and resistance to soybean mosaic virus, solving technical challenges in quality improvement and disease resistance enhancement, and providing a new molecular breeding pathway.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

This invention discloses genes GmISO5 Application of the gene in regulating the isoflavone composition of soybean seeds and its resistance to soybean mosaic virus. GmISO5 The nucleotide sequence is shown in SEQ ID NO: 1. This invention, through genetic analysis of isoflavone-related traits in soybean seed populations, identified candidate genes significantly associated with isoflavone content. GmISO5 Furthermore, expression analysis and functional verification clarified the close association between this gene and the isoflavone trait in soybean seeds. The study showed that... GmISO5 It can positively regulate the content and composition ratio of isoflavones in soybean seeds. This is achieved using genetic engineering techniques. GmISO5 GmISO5 Regulation can significantly alter the content of isoflavones and their components in soybean seeds, enabling targeted improvement of the functional components of soybean seeds. This provides important genetic resources and effective technical means for cultivating new soybean varieties with high isoflavone content and high nutritional value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to genes. GmISO5 Application in regulating the isoflavone composition of soybean seeds and its resistance to soybean mosaic virus. Background Technology

[0002] Soybeans Glycine max Soybeans are an important dual-purpose crop for both food and oil production globally, playing a central role in ensuring national food security and vegetable oil supply. Soybean seeds are rich in protein, oil, and various functional components such as isoflavones. Among these, soy isoflavones, as an important secondary metabolite, not only possess significant health benefits such as antioxidant and hormone level regulation, but are also key indicators determining the nutritional quality and commercial value of soybeans. Therefore, elucidating the regulatory mechanisms of soy isoflavone synthesis and accumulation, and optimizing the composition and content of isoflavones in seeds through genetic improvement, has always been an important goal in high-quality soybean breeding.

[0003] However, soybeans face various biological stresses during field production, among which soybean mosaic virus (SMV) is one of the most widespread and damaging viral diseases. When soybean plants are infected with SMV, they typically exhibit leaf wrinkling, mosaic patterns, stunted growth, and reduced pod formation in severe cases, leading to brown spots on the seeds (seed coat mottling), resulting in significant yield losses and deterioration in appearance and quality. Developing broad-spectrum, durable resistant varieties is the most economical and effective measure for controlling SMV, but currently, high-quality resistant germplasm resources are relatively scarce in production.

[0004] In existing soybean breeding practices and basic research, grain quality traits (such as isoflavone content and composition) and disease resistance traits (such as SMV resistance) are generally considered to be regulated independently by different genetic pathways or genes. This makes it difficult to achieve synergistic improvement in quality and resistance through manipulation of a single gene during the breeding process, and the resources of key pleiotropic genes that can simultaneously improve isoflavone quality and SMV resistance are extremely limited. Therefore, discovering and identifying key genes with both quality regulation and antiviral functions, and elucidating their mechanisms of action, is of significant theoretical and practical value for breeding new soybean varieties with high nutritional value and high disease resistance through molecular breeding methods. Summary of the Invention

[0005] The main objective of this invention is to propose a gene GmISO5 The application of this technology in regulating the isoflavone composition of soybean seeds and resistance to soybean mosaic virus aims to address the problem of limited key gene resources that combine soybean seed quality improvement and SMV resistance in existing technologies.

[0006] To achieve the above objectives, this invention proposes a gene... GmISO5Application of the gene in regulating the isoflavone composition of soybean seeds and its resistance to soybean mosaic virus. GmISO5 The nucleotide sequence is shown in SEQ ID NO: 1.

[0007] Preferably, the GmISO5 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2.

[0008] Preferably, the application includes knocking out or knocking down genes. GmISO5 Reduce the isoflavone content in soybean seeds.

[0009] Preferably, the application includes overexpression of genes. GmISO5 Increase the isoflavone content of soybean seeds and / or enhance the resistance of soybeans to soybean mosaic virus.

[0010] This invention also proposes a method for targeting soybean genes. GmISO5 The sgRNA, wherein the target site sequence of the sgRNA is shown in SEQ ID NO: 5, and the target site is located in the gene GmISO5 The first exon region.

[0011] The present invention also proposes a gene editing vector comprising a Cas9 protein expression unit, a selection marker gene, and an sgRNA expression unit, wherein the sgRNA expression unit is capable of expressing the sgRNA as described above.

[0012] The present invention also proposes a method for obtaining GmISO5 A method for gene-editing plants, wherein the gene-editing vector described above is introduced into soybean recipient material and transformed plants are obtained.

[0013] This invention also proposes a method for improving the functional quality of soybean seeds, the method comprising molecular breeding of soybeans, wherein the molecular breeding is based on... GmISO5 The genetic material from which the genes are regulated is either parental or donor material, and the genetic material is obtained through genetic engineering and its... GmISO5 Materials in which gene expression levels and / or functional activity are altered, thereby obtaining soybean plants or their offspring with improved grain functional quality.

[0014] This invention also proposes a soybean gene. GmISO5 A method for improving soybean resistance to soybean mosaic virus, the method comprising the following steps: (1) Cloning the gene as shown in SEQ ID NO: 1 GmISO5 ; (2) Constructing a plant expression vector, wherein the plant expression vector comprises the one shown in SEQ ID NO: 1 GmISO5 Gene sequence; (3) Genetically modified soybean plants were obtained by culturing and testing using Agrobacterium-mediated stable genetic transformation.

[0015] Gene GmISO5 Applications in plant breeding, including those containing genes GmISO5 Soybean plants, plant tissues or seeds are used as parent materials or breeding materials, and breeding is carried out by means of hybridization, backcrossing, self-pollination and / or asexual reproduction to obtain new soybean lines with improved target traits.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention identifies candidate genes that are significantly associated with isoflavone content by conducting genetic analysis on isoflavone-related traits in soybean seed populations. GmISO5 Furthermore, expression analysis and functional verification clarified the close association between this gene and the isoflavone trait in soybean seeds. The study showed that... GmISO5 It can positively regulate the content and composition ratio of isoflavones in soybean seeds. This is achieved using genetic engineering techniques. GmISO5 Regulation can significantly alter the content of isoflavones and their components in soybean seeds, enabling targeted improvement of the functional components of soybean seeds. This provides important genetic resources and effective technical means for cultivating new soybean varieties with high isoflavone content and high nutritional value.

[0017] (2) This invention discloses for the first time GmISO5 Genes have a dual function of simultaneously regulating soybean seed quality and disease resistance. Research has found that... GmISO5 This study not only significantly affects the composition of isoflavones in soybean seeds but also significantly improves the resistance of soybeans to soybean mosaic virus (SMV). This discovery effectively solves the technical challenge in traditional soybean breeding where quality improvement and disease resistance enhancement are often independently regulated by different genes or pathways, making synergistic improvement difficult. Through research on... GmISO5 The application of genes can simultaneously improve soybean seed quality and SMV resistance at the single gene level, providing new gene resources and technical pathways for breeding high-quality and disease-resistant soybean varieties, and has important application value for soybean molecular breeding. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 Provided by the present invention GmISO5The results of the association analysis between genes and soybean seed isoflavone content, and the candidate gene localization analysis diagram; where, A: Manhattan diagram of the association results of soybean seed isoflavone content obtained based on genome-wide association analysis (GWAS); B: Distribution diagram of the association effect between gene expression level and soybean seed isoflavone content obtained based on transcriptome association analysis (TWAS); C: Local association analysis and linkage disequilibrium (LD) structure diagram of candidate segments related to seed isoflavone content on soybean chromosome 5 (Gm05); D: GmISO5 Figure showing the results of relative gene expression analysis in different soybean tissues or developmental stages.

[0020] Figure 2 Provided by the present invention GmISO5 Analysis of the effects of gene regulation on the content and composition of isoflavones in soybean seeds (Figure) GmISO5 Figure showing the effect of gene regulation on soybean resistance to soybean mosaic virus (SMV); where A: GmISO5 Figure B: Comparison of total isoflavones and their components in soybean seeds of mutant and wild-type soybeans; GmISO5 Figure C: Comparison of isoflavone content in soybean seedlings of mutant and wild-type lines; Figure D: Detection results of SMV virus accumulation levels in soybean materials under different treatments; Figure D: Wild-type and wild-type soybeans under SMV inoculation conditions. GmISO5 Comparison of overall phenotypic characteristics of mutant soybean plants; E: Wild type and... under SMV inoculation conditions GmISO5 Comparison of the trifoliate compound leaf phenotype of mutant soybean; F: Comparison of single leaf lesion manifestations of soybean materials under different treatments under SMV inoculation conditions.

[0021] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0022] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially. Furthermore, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0024] Example 1: GmISO5 Gene screening and localization analysis 1. Genome-wide association analysis and candidate region localization Based on the phenotypic data of isoflavone content in soybean population materials, genome-wide SNP marker association analysis was performed to identify association sites related to isoflavone content in soybean seeds. The analysis results are as follows: Figure 1 As shown in Figure A, a significantly associated region with seed isoflavone content was detected on soybean chromosome 5 (Gm05). qISO.Gm05 .

[0025] 2. Fine-grained location of candidate segments and chain imbalance analysis against qISO.Gm05 The associated region was analyzed to examine the association signals and linkage disequilibrium relationships between markers, reflecting the association signals and linkage relationships between multiple isoflavone components within the region. Results are as follows: Figure 1 As shown in C, multiple associated sites related to different isoflavone components are spatially clustered within this segment, and there is a strong linkage between the sites, further supporting the possibility that this segment is a segment related to the regulation of seed isoflavones.

[0026] 3. Screening candidate genes using transcriptome association analysis Based on the aforementioned associated regions, further transcriptomic data were used to perform a transcriptome association analysis (TWAS) on gene expression levels and seed isoflavone content. The results are as follows: Figure 1 As shown in B, on chromosome Gm05... Glyma.05G244100 The gene showed a strong correlation with isoflavone content in grains at the transcriptional level and was selected as a candidate gene, named [gene name missing]. GmISO5 .

[0027] 4. GmISO5 Gene expression characterization analysis right GmISO5 The expression levels of genes in different soybean tissues or developmental stages were analyzed, and the results are as follows: Figure 1 As shown in D, GmISO5 It has a high expression level in tissues related to grain development.

[0028] Example 2: GmISO5 Construction of gene editing vectors 1. Soybeans GmISO5 Cloning of genes Total RNA was extracted from 20-day embryos of the soybean variety Williams82. RNA integrity was assessed by 1% agarose gel electrophoresis, and the extracted RNA was then reverse transcribed into cDNA using a reverse transcription kit. GmISO5 Design primers for full-length sequences GmISO5 -F: GCAACCACCAGAAACTCTCACTA (SEQ ID NO: 3) and GmISO5 -R:TAAGGATAAATTGGAAGGATAA (SEQ ID NO: 4), PCR amplification was performed using primers and the obtained cDNA template. The amplification reaction system is shown in Table 1 below.

[0029] Table 1 PCR amplification reaction system The PCR reaction program was as follows: 95℃ for 4 min; 94℃ for 30 s, 57℃ for 50 s, 72℃ for 90 s, 30 cycles; extension at 72℃ for 10 min. The PCR amplification yielded... GmISO5 The gene was sequenced to obtain the nucleotide sequence shown in SEQ ID NO: 1, which encodes a sequence of 190 amino acids, as shown in SEQ ID NO: 2.

[0030] 2. Design and synthesis of sgRNA Using the CRISPR-P platform, and utilizing the CRISPR-P online web tool (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), GmISO5 Selection of sgRNA target site sequences. Target sites are located at... GmISO5 After selecting the target site in the first exon region of the gene, it needs to be integrated into the vector. First, the target site primers for synthesizing sgRNA are added to a 25uL reaction system. GmISO5 -F and GmISO5 -R primer 5uL, water 15μL, anneal at 95℃ for 3min, anneal at 0.1℃ / s to 16℃, hold at 16℃ for 10min to complete annealing, and obtain gRNA annealed product with sticky ends.

[0031] The target site sgRNA sequence is as follows: 5'-TGTGGTCATGGCAGCCTCCG-3' (SEQ ID NO: 5); 3. Preparation of vectors for expressing sgRNA Take 1 μL of the gRNA annealing product with sticky ends obtained above and perform homologous recombination ligation with the cas9 / gRNA vector (which contains the Cas9 protein expression unit and the glufosinate resistance gene Bar as a selection marker) to obtain the recombinant vector Cas9-sgRNA, which expresses sgRNA.

[0032] 4. Transformation and Identification of Escherichia coli The recombinant vector Cas9-sgRNA prepared above was transformed into Escherichia coli DH5α competent cells, plated on LB+Kan (LB medium + 50 mg / L kanamycin) solid medium, and cultured overnight at 37°C. Then, single clones were picked for bacterial PCR verification.

[0033] Positive clones were sent for Sanger sequencing, which confirmed that the sgRNA sequence was correctly inserted and without mutation. Plasmids were extracted and named... GmISO5 -sgRNA.

[0034] Example 3: Obtaining transgenic soybean plants 1. Obtaining soybean explants Select smooth, crack-free, disease-free, and mold-free mature Williams 82 soybean seeds and sterilize them with chlorine for 12 hours. Soak the sterilized seeds in sterile water in the dark for 16 hours. After germination, cut the two cotyledons along the midline on a clean bench, remove the two original leaf buds, and create a 3mm long wound at the junction of the cotyledon and hypocotyl.

[0035] 2. Genetic transformation of soybean cotyledonary nodes Genetic transformation mediated by Agrobacterium EHA101 strain was used to transform the above-mentioned strains. GmISO5 -sgRNA plasmid was introduced into soybean callus tissue to obtain plants transformed from the callus tissue. T0 generation transgenic positive plants were screened with glufosinate (160 mg / L). T0 generation plants were self-pollinated to obtain T1 generation seeds, and T1 generation plants were self-pollinated to obtain T2 generation seeds. Homozygous stable genetic lines were obtained through continuous self-pollination and selection.

[0036] Example 4: Identification of transgenic positive lines 1. PCR identification of transgenic elements Genomic DNA was extracted from surviving plants after resistance selection, and transgenic vector elements (such as the Cas9 gene, sgRNA expression cassette, and selection marker genes) were amplified and identified using PCR to confirm successful integration of exogenous elements into the soybean genome. T1 generation seeds were obtained by self-pollination of PCR-positive plants.

[0037] 2. Identification of homozygous edited strains T1 generation plants were planted and self-pollinated to obtain T2 generation seeds. Genomic DNA was extracted from the leaves of homozygous T2 generation transgenic plants for analysis. GmISO5 The gene's target site was amplified by PCR and sequenced for verification.

[0038] The primer sequences used are: Upstream primer QF: GCAACCACCAGAAACTCTC (SEQ ID NO: 6); Downstream primer QR: ACCAATGTATCCACTCGCGC (SEQ ID NO: 7).

[0039] Through sequencing and alignment analysis, the results were successfully obtained in GmISO5 Mutant lines in which the gene target site has been knocked out and are homozygous are named as follows: iso5_L4 and iso5_L5 These homozygous lines can be stably inherited and used for subsequent phenotypic identification experiments.

[0040] Example 5: Analysis of isoflavone properties in seeds 1. Planting of materials and collection of seeds The homozygous mutant lines obtained above ( iso5_L4 , iso5_L5 Both the wild-type control plant (Williams82) and the wild-type control plant were planted in the field or greenhouse under conventional cultivation and management until maturity. Mature seeds were harvested, air-dried naturally, and then used for isoflavone content determination.

[0041] 2. Isoflavone content determination The total isoflavone content and the content of its main components (such as genistein, daidzein, and genistein) in the seeds were determined by high performance liquid chromatography (HPLC). At least three biological replicates were set up for each line.

[0042] 3. Results Analysis The measurement results are as follows Figure 2 As shown in A, compared to the wild type... iso5_L4 and iso5_L5 The total isoflavone and the contents of each major component in the mutant grains were significantly reduced, and the differences were statistically significant (P<0.05 or P<0.01).

[0043] Further analysis of isoflavone content in seedlings of different mutant lines and wild types yielded the following results: Figure 2 As shown in B, the total isoflavone and the contents of each major component in the mutant seedlings were also significantly lower than those in the wild type.

[0044] The above results indicate that GmISO5 This gene positively regulates the biosynthesis and accumulation of isoflavones in soybean seeds and plant tissues; knocking out this gene can lead to a significant decrease in soybean isoflavone content.

[0045] Example 6: Analysis of traits against soybean mosaic virus (SMV) 1. Virus inoculation treatment Select those with consistent growth status GmISO5 homozygous mutant ( iso5_L4 , iso5_L5 Both wild-type and control plants were inoculated with soybean mosaic virus (SMV) via friction during the seedling stage (V1-V2). During inoculation, phosphate-buffered saline containing SMV virus solution was applied to the surface of the primary leaf or the first true leaf of soybean, and then gently rubbed with carborundum to create micro-wounds. A phosphate-buffered saline control group was also included.

[0046] 2. Phenotypic observation and virus accumulation detection Observe and record plant symptoms regularly after inoculation. Collect newly unfolded upper leaves 14-21 days post-inoculation for virus content detection. Quantitative real-time PCR (qRT-PCR) was used to detect SMV virus accumulation levels in different materials.

[0047] 3. Results Analysis Virus accumulation test results as follows Figure 2 As shown in Figure C, there are significant differences in the accumulation level of SMV virus in materials treated differently.

[0048] Phenotypic observation results are as follows Figure 2 As shown in D, 2E, and 2F: Figure 2 D: Wild-type and SMV-inoculated conditions GmISO5 A comparison of the overall phenotypes of mutant soybean plants showed that the mutants exhibited more severe or varying degrees of disease symptoms. Figure 2 E: Wild-type and SMV-inoculated conditions GmISO5 Comparison of the trifoliate compound leaf phenotype of mutant soybeans showed that the mutant leaves exhibited more pronounced symptoms such as mosaic and wrinkling. Figure 2 F: Comparison of single-leaf lesion manifestations of soybean materials under different treatments under SMV inoculation conditions. The lesion area or severity of mutants differed significantly from that of wild-type.

[0049] The results showed that, GmISO5 Gene regulation can significantly affect the level of soybean resistance to SMV.

[0050] Example 7: Breeding Application Based on the functional verification results of the above embodiments, GmISO5 Genes can serve as important genetic improvement targets for soybean quality breeding and disease resistance breeding.

[0051] 1. Hybrid breeding strategy Will get GmISO5 homozygous mutant materials ( iso5_L4 , iso5_L5 Using superior germplasm resources with high isoflavone content as parents, hybridize with target recipient varieties, and select new soybean lines with suitable isoflavone content and excellent resistance to soybean mosaic virus through conventional breeding methods such as backcrossing and self-pollination, combined with field phenotypic identification (seed isoflavone content determination and SMV resistance identification).

[0052] 2. Targeted Improvement through Gene Editing For varieties that already possess excellent agronomic traits but lack sufficient isoflavone content or SMV resistance, gene editing technologies such as CRISPR / Cas9 can be used to... GmISO5 Targeted gene editing (such as overexpression, allelic variation creation, or knockout) can rapidly achieve synergistic improvement in grain quality and disease resistance traits.

[0053] By applying the above breeding strategies, new soybean lines with both excellent seed isoflavone quality and SMV resistance can be obtained, providing core germplasm resources and technical support for the development of functional soybean foods and antiviral breeding.

[0054] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.

Claims

1. Genes GmISO5 Application of the gene in regulating the isoflavone composition of soybean seeds and its resistance to soybean mosaic virus. GmISO5 The nucleotide sequence is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The GmISO5 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:

2.

3. The application according to claim 1, characterized in that, The applications include knocking out or knocking down genes. GmISO5 Reduce the isoflavone content in soybean seeds.

4. The application according to claim 1, characterized in that, The applications include overexpressing genes. GmISO5 Increase the isoflavone content of soybean seeds and / or enhance the resistance of soybeans to soybean mosaic virus.

5. A gene targeting soybean GmISO5 The sgRNA is characterized by, The target site sequence of the sgRNA is shown in SEQ ID NO: 5, and the target site is located in the gene. GmISO5 The first exon region.

6. A gene editing vector, characterized in that, The gene editing vector comprises a Cas9 protein expression unit, a selection marker gene, and an sgRNA expression unit, wherein the sgRNA expression unit is capable of expressing the sgRNA as described in claim 5.

7. A way to obtain GmISO5 The method for gene-editing plants is characterized by, The method includes introducing the gene-editing vector as described in claim 6 into soybean recipient material and obtaining transformed plants.

8. A method for improving the functional quality of soybean seeds, characterized in that, The method includes molecular breeding of soybeans, wherein the molecular breeding is based on... GmISO5 The genetic material from which the genes are regulated is either parental or donor material, and the genetic material is obtained through genetic engineering and its... GmISO5 Materials in which gene expression levels and / or functional activity are altered, thereby obtaining soybean plants or their offspring with improved grain functional quality.

9. A soybean gene GmISO5 A method for improving soybean resistance to soybean mosaic virus, characterized in that, The method includes the following steps: (1) Cloning the gene as shown in SEQ ID NO: 1 GmISO5 ; (2) Constructing a plant expression vector, wherein the plant expression vector comprises the one shown in SEQ ID NO: 1 GmISO5 Gene sequence; (3) Genetically modified soybean plants were obtained by culturing and testing using Agrobacterium-mediated stable genetic transformation.

10. Genes GmISO5 Its application in plant breeding is characterized by, Will contain genes GmISO5 Soybean plants, plant tissues or seeds are used as parent materials or breeding materials, and breeding is carried out by means of hybridization, backcrossing, self-pollination and / or asexual reproduction to obtain new soybean lines with improved target traits.

Citation Information

Patent Citations

  • Cloning and application of gene for regulating soybean grain size

    CN113512551A

  • Gene edited soybean plants with enhanced traits

    US20230279412A1