Application of soybean MYC2-like transcription factor gene GmMYC3 in soybean resistance to soybean mosaic virus disease

Abstract

The application discloses application of a soybean MYC2-like transcription factor gene GmMYC3 in soybean resistance to soybean mosaic virus disease. The application of a soybean MYC2-like transcription factor gene GmMYC3 shown in SEQ ID NO. 1 and SEQ ID NO. 2 in genetic engineering modification of soybean mosaic virus disease resistance. Overexpression of the gene can significantly improve the resistance of soybean to soybean mosaic virus disease. The soybean MYC2-like transcription factor gene GmMYC3 can be transformed into soybean through genetic engineering, and finally regulate the resistance of soybean to soybean mosaic virus disease.

Description

TECHNICAL FIELD

[0001] The application relates to application of a soybean MYC2-like transcription factor gene GmMYC3 in soybean resistance to soybean mosaic virus, and belongs to the field of genetic engineering. BACKGROUND

[0002] Soybean is the most important legume crop in the world and also the main source of edible vegetable oil and plant protein. During its growth and development, soybean is affected by various environmental stresses and diseases. Among them, soybean mosaic virus disease is a global soybean disease caused by soybean mosaic virus (SMV) and occurs in almost all soybean production areas. Soybean plants infected with SMV exhibit symptoms such as leaf mosaic and crinkling, which are often accompanied by plant dwarfing characteristics, resulting in severe yield and quality losses. The annual yield loss of soybean caused by SMV is about 10%, but in some severe years, the loss can be as high as 35% to 50%. Due to the wide distribution, serious damage and difficulty in controlling SMV with chemical agents, breeding of excellent varieties resistant to SMV has become one of the most economical and effective methods to control the disease.

[0003] The soybean GmMYC3 gene belongs to the basic helix-loop-helix (bHLH) transcription factor family and is a core transcription factor in the jasmonic acid signaling pathway in plants, widely involved in the regulation of various physiological processes such as plant growth and development, stress response and defense response. In biological stress, for example, in Arabidopsis thaliana, MYC2-like transcription factor is a key factor in the jasmonic acid signaling pathway, which responds to insect feeding induction, promotes the expression of downstream defense genes and proteins, reduces insect body weight and enhances insect resistance. When tomato is infected with pathogenic fungi such as Botrytis cinerea, MYC2-like transcription factor regulates its immune response, up-regulates the expression of disease resistance genes such as PR-1, promotes the production of disease-related proteins, inhibits the growth and spread of pathogenic fungi, and regulates cell wall thickening and lignification to block the invasion of pathogenic fungi. In abiotic stress, MYC2-like transcription factors in plants such as rice play a role in response to drought stress, regulate the expression of drought response genes, participate in the synthesis of osmotic regulators such as proline, increase the water retention of cell osmotic potential, and regulate the opening and closing of stomata to reduce water loss. For example, in Arabidopsis thaliana, MYC2-like transcription factor up-regulates Na + efflux proteins and K + / Na +The expression of the transporter-encoding gene maintains ion balance and reduces salt damage. In summary, MYC2-like transcription factors act as plant guards and coordinate multiple defense mechanisms in different stress environments. In the previous study, the applicant analyzed the soybean transcriptome induced by SMV and found that GmMYC3 strongly responded to the induction of SMV-SC7 strain, but whether the gene plays a role in soybean resistance to SMV has not been reported. SUMMARY

[0004] The application aims to disclose the disease resistance genetic engineering application of soybean MYC2-like transcription factor gene GmMYC3. The GmMYC3 gene can quickly respond to soybean SMV induction, and overexpression of the GmMYC3 gene in soybean can reduce the expression amount of the virus CP protein gene and enhance the resistance of soybean to SMV.

[0005] The GmMYC3 gene can be introduced into soybean as a target gene to regulate the resistance of soybean to SMV.

[0006] The object of the application can be achieved by the following technical solutions:

[0007] The application of soybean MYC2-like transcription factor gene GmMYC3 in improving the resistance of soybean to soybean mosaic virus, wherein the coding region sequence of the soybean MYC2-like transcription factor gene GmMYC3 is selected from the sequences shown in SEQ ID NO. 1 or SEQ ID NO. 2. The nucleotide sequences in the resistant soybean Gengyihao and the susceptible soybean Nannong1138-2 are SEQ ID NO. 1 and SEQ ID NO. 2, and the amino acid sequences are SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0008] Overexpression of the soybean GmMYC3 gene can reduce the expression amount of the soybean mosaic virus CP protein gene and improve the resistance of soybean to soybean mosaic virus disease.

[0009] The application of the recombinant expression vector overexpressing the soybean MYC2-like transcription factor gene GmMYC3 in improving the resistance of soybean to soybean mosaic virus disease.

[0010] The application of the recombinant expression vector overexpressing the soybean MYC2-like transcription factor gene GmMYC3 in constructing soybean varieties resistant to soybean mosaic virus disease.

[0011] The application preferably enhances the resistance of soybean to SMV by overexpressing GmMYC3 gene in soybean. In constructing the plant overexpression vector, any one of the enhanced or inducible promoters can be added in front of the GmMYC3 gene transcription initiation nucleotide. In order to quickly identify and screen the transgenic plants, the plant expression vector used can be processed accordingly, such as introducing a selective marker gene such as GFP in the expression vector. From the safety point of view of the transgenic plants, the transformed plants can be screened by stress instead of using a selective marker gene.

[0012] The soybean MYC2-like transcription factor gene GmMYC3 in the application can reduce the expression amount of the viral CP protein gene, reduce the SMV content in soybean, and enhance the resistance of soybean to SMV after the gene is transformed into soybean by genetic engineering and overexpressed.

[0013] The plant overexpression vector carrying the GmMYC3 in the application can be used to transform plant cells or tissues by conventional biological methods, including using Ti plasmid, Ri plasmid, DNA direct transformation, plant virus vector, Agrobacterium-mediated, microinjection, electric conduction, etc. Subsequently, the transformed plant tissues are cultivated into complete plants by using plant tissue culture technology.

[0014] Beneficial effects:

[0015] The soybean MYC2-like transcription factor gene GmMYC3 is a bHLH class transcription factor coding gene. The expression level of GmMYC3 in soybean is induced by SMV infection, and the up-regulation multiple in the resistant soybean Gefeng No. 1 is greater than that in the susceptible soybean Nannong 1138-2. Overexpression of GmMYC3 gene in soybean can enhance the resistance of transgenic soybean to SMV. Therefore, GmMYC3 can be used to modify the resistance of soybean to SMV, and used for breeding soybean varieties resistant to SMV. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 Expression pattern of GmMYC3 gene in resistant soybean Gefeng No. 1 (A) and susceptible soybean Nannong 1138-2 (B) after induction of Soybean Mosaic Virus SMV-SC7 strain (n=3). Two-tailed t test: *, P<0.05; **, P<0.01; ***, P<0.001; ns, not significant. Error bars indicate ±SE.

[0017] Figure 2 Bar test strip detection results of GmMYC3 overexpression soybean. P3 is a wild type receptor control, OE-17 and OE-28 are 35S:GmMYC3 南农1138-2 strains and 35S:GmMYC3 科丰一号 strains.

[0018] Figure 3 Relative expression level of GmMYC3 in GmMYC3 overexpression soybean (n=3). P3 is wild type receptor control, OE-17 and OE-28 are 35S:GmMYC3 overexpression lines, respectively. 南农1138-2 Lines and 35S:GmMYC3 科丰一号 Lines. Two-tailed t test: *, P < 0.05; ****, P < 0.0001. Error bars indicate ± SE.

[0019] Figure 4 Phenotype of GmMYC3 overexpression soybean after inoculation with SMV-SC7 strain for 21 days. SMV represents inoculation with SC7 virus, PBS represents negative control with 0.01 mol / L phosphate buffer, scale bar = 1 cm. P3 is wild type receptor control, OE-17 and OE-28 are 35S:GmMYC3 overexpression lines, respectively. 南农1138-2 Lines and 35S:GmMYC3 科丰一号 Lines.

[0020] Figure 5 Relative expression level of virus CP protein gene in GmMYC3 overexpression soybean (n=3). Two-tailed t test: *, P < 0.05. Error bars indicate ± SE. P3 is wild type receptor control, OE-17 and OE-28 are 35S:GmMYC3 overexpression lines, respectively. 南农1138-2 Lines and 35S:GmMYC3 科丰一号 Lines. DETAILED DESCRIPTION

[0021] The application will be further described below in conjunction with the accompanying drawings and examples.

[0022] The methods used in the following examples are conventional methods unless otherwise specified.

[0023] Example 1 Induced expression of GmMYC3 gene by SMV-SC7 strain

[0024] Resistant soybean Gengyihao and susceptible soybean Nannong 1138-2 were planted, and at the true leaf stage, SMV-SC7 strain was inoculated, and soybean leaves at 0, 2, 8, and 24 hours after inoculation were collected, ground with a mortar, added to a 1.5 mL EP tube containing lysis solution, shaken thoroughly, and then transferred to a 1.5 mL EP tube. Total RNA was extracted using a total RNA extraction kit (RNAsimple Total RNA Kit, Tiangen, Beijing). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was measured using a spectrophotometer. Reverse transcription kit (TaKaRa Primer Script RT Kit, TaKaRa, Dalian) was used to synthesize cDNA, and the cDNA was used as a template for quantitative real-time PCR (qRT-PCR) to determine the expression level of GmMYC3 gene. TMUsing the RT reagent kit (TaKaRa, Japan), 1 μg of RNA was synthesized into cDNA, which was then diluted 10-fold as a template for quantitative real-time PCR. The PCR reaction was performed in a total volume of 20 μL, containing 10 μl of 2×ChamQ™ SYBR qPCRMaster Mix (Vazyme, Nanjing), 5 μl of 1.2 μM primer pairs, and 5 μl of cDNA template. The PCR program was as follows: a pre-incubation at 95°C for 30 seconds, followed by a primer extension reaction at 95°C for 10 seconds and then at 60°C for 30 seconds, for a total of 40 cycles. The GmMYC3 quantitative real-time primers were F: tggtctcgaggtcgatgtgaa and R: gacatgctagcgtgatgaacc. Using the soybean Tubulin gene as an internal reference, the quantitative real-time primer sequences were F: ggagttcacagaggcagag and R: cacttacgcatcacatagca.

[0025] The GmMYC3 gene can respond rapidly to soybean SMV induction, and the upregulation fold in the resistant soybean Kefeng No. 1 is greater than that in the susceptible soybean Nannong 1138-2. Figure 1 ).

[0026] Example 2: Genetic Engineering Application of Soybean MYC2-like Transcription Factor Gene GmMYC3

[0027] 1) Cloning of soybean GmMYC3

[0028] Specific amplification primers were designed using the coding sequence of GmMYC3 (Glyma.07G051500) from the public database Phytozome v13 as a template. The primer sequences were F: atggaggatttaatcatatctcc and R: tcactgatccaacctcatcag. The GmMYC3 gene was amplified from the cDNA of resistant soybean Kefeng No. 1 and susceptible soybean Nannong 1138-2, respectively. The PCR program was set as follows: 95℃ pre-denaturation for 3 minutes, followed by 35 cycles of denaturation at 95℃ for 15 seconds, annealing at 58℃ for 15 seconds, extension at 72℃ for 40 seconds, and a final extension at 72℃ for 5 minutes. The PCR product was inserted into the T vector to construct T-GmMYC3. 科丰一号 and T-GmMYC3 南农1138-2The recombinant vector was sequenced to obtain the complete CDS sequence of the GmMYC3 gene. The size of the GmMYC3 gene fragment in Kefeng No. 1 was 1401 bp, and the size of the GmMYC3 gene fragment in Nannong 1138-2 was 1395 bp. The coding sequences are SEQ ID NO. 1 and SEQ ID NO. 2, respectively, and the corresponding amino acid sequences are SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0029] 2) Construction of a plant overexpression vector of soybean GmMYC3 gene

[0030] The amplification primers of the GmMYC3 gene in step 1 of Example 2 were used to amplify the coding sequence of the GmMYC3 gene containing the complete open reading frame from the T-GmMYC3 科丰一号 and T-GmMYC3 南农1138-2 recombinant vectors by PCR reaction. Subsequently, under the drive of the 35S promoter, it was inserted into the plant overexpression vector pBA002 to obtain the recombinant vectors pBA002-GmMYC3 科丰一号 and pBA002-CmMYC3 南农1138-2 . The constructed vectors were introduced into Agrobacterium tumefaciens EHA105 strain, and soybean variety P3 was genetically transformed by cotyledon node method.

[0031] 3) SMV phenotype identification of GmMYC3 overexpression soybean

[0032] The stable transformed overexpression soybean 35S:GmMYC3 南农1138-2 line OE-17 and 35S:GmMYC3 科丰一号 line OE-28 were obtained by soybean tissue culture method. The T7 generation GmMYC3 overexpression soybean was planted in a light incubator, and after 7 days of growth, soybean leaves were collected for Bar test paper detection and GmMYC3 gene expression detection. The Bar test paper detection results of the two lines were both positive Figure 2 . Subsequently, the leaves were quickly frozen with liquid nitrogen and stored at -80°C. The total RNA extraction, reverse transcription, fluorescence quantitative PCR reaction and GmMYC3 primers were carried out according to Example 1. Compared with the wild type receptor control P3, the expression of GmMYC3 in the 35S:GmMYC3 南农1138-2 line OE-17 and 35S:GmMYC3 科丰一号 line OE-28 was significantly improved Figure 3 .

[0033] After the first pair of true leaves unfolded, the wild type receptor control P3, 35S:GmMYC3 南农1138-2 line OE-17 and 35S:GmMYC3科丰一号 Strain OE-28 was inoculated with SMV-SC7 virus, and the disease was observed 21 days after inoculation, and the expression of virus CP gene in leaves was detected. The overexpression of soybean showed disease resistance Figure 4 ), and the expression of virus CP protein gene in leaves was analyzed, and it was found that the expression of SMV-CP protein gene in two overexpression strains was significantly lower than that in control plants P3 Figure 5 ). The above results showed that overexpression of GmMYC3 gene reduced the accumulation of SMV virus in soybean and improved the resistance of soybean to SMV-SC7. The primer sequence of virus CP protein gene was F: cagatgggcgtggttatga and R: acaatgggtttcagcggata.

Claims

1. Application of soybean MYC2-like transcription factor gene GmMYC3 in improving soybean resistance to soybean mosaic virus, characterized in that, The coding region sequence of the soybean MYC2-like transcription factor gene GmMYC3 is selected from the sequence shown in SEQ ID NO. 1 or SEQ ID NO.

2.

2. Use according to claim 1, characterized in that, Overexpression of the soybean GmMYC3 gene as claimed in claim 1 can reduce the accumulation of soybean mosaic virus and improve the resistance of soybean to soybean mosaic virus.

3. Use of a recombinant expression vector overexpressing the soybean MYC2-like transcription factor gene GmMYC3 as claimed in claim 1 in improving the resistance of soybean to soybean mosaic virus.

4. Use of a recombinant expression vector overexpressing the soybean MYC2-like transcription factor gene GmMYC3 as claimed in claim 1 in constructing soybean varieties resistant to soybean mosaic virus.

Images