Preparation method and application of caper squalene synthase knockout mutant material

The knockout of the squalene synthase gene through gene editing technology solved the problem of low yield of macrocyclic diterpenes in the squalene, and achieved the production of high-yield macrocyclic diterpenes, reducing production costs.

CN119530281BActive Publication Date: 2025-08-22INST OF BOTANY JIANGSU PROVINCE & CHINESE ACADEMY OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411663350.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-20
Publication Date
2025-08-22
Estimated Expiration
2044-11-20

AI Technical Summary

Technical Problem

The content of macrocyclic diterpenes in the Suspension Sequoia is low and the chemical synthesis cost is high, resulting in limited application. The existing gene editing system is immature and cannot achieve high yield production.

Method used

By designing specific targets targeting the squalene synthase gene, the pNK2-Cas9-U6 recombinant vector was constructed using gene editing technology, and the squalene synthase gene was knocked out in the squalene to obtain the squalene hairy root material with high yield of macrocyclic diterpenes.

Benefits of technology

The yield of macrocyclic diterpenes in the successive sequel has been significantly improved, the production cost has been reduced, and the efficient production of macrocyclic diterpenes has been achieved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention discloses a method for preparing and using a squalene synthase knockout mutant material from caper berries, belonging to the field of plant genetic engineering. The present invention uses the squalene synthase gene of caper berries as a target gene and, for the first time, applies the CRISPR / Cas9 gene editing system to knock out the squalene synthase gene in caper berries, thereby obtaining a squalene synthase knockout mutant material from caper berries. The squalene synthase knockout mutant material from caper berries created by this method significantly increases the yield of macrocyclic diterpenes, can reduce the production cost of macrocyclic diterpenes, and has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering, and in particular relates to a preparation method and application of a caper squalene synthase (SS) knockout mutant material. Background Art

[0002] Xu Suizi ( Euphorbia lathyris Caper fruit (Euphorbia oleracea L.) is a biennial medicinal herb distributed and cultivated in many countries worldwide. It contains macrocyclic diterpenoids, important functional compounds with unique skeletons. These compounds have attracted the attention of numerous pharmacologists due to their remarkable pharmacological activities, such as ingenol methylbutyrate (FDA-approved for the treatment of actinic keratosis) and Euphorbia factor L3 (reversing multidrug resistance in tumors) (Abramovits et al., 2013; Zhu et al., 2018). Despite the enormous potential for application of macrocyclic diterpenes in caper fruit, their low concentrations in the fruit, with extraction and isolation yields typically below 0.1%, severely hinders its comprehensive development and utilization. Furthermore, the chemical synthesis of macrocyclic diterpenes is complex and requires long and tedious steps, resulting in yields below 1.0%. This results in high costs and prohibits industrial production of these compounds (Asaba et al., 2015; Nickel et al., 2004; Hashimoto et al., 2017; Tong et al., 2018). Therefore, there is an urgent need to create new sources of caper fruit that produce high-yield macrocyclic diterpenes.

[0003] Studies have shown that there is competition between triterpenes and macrocyclic diterpenes in the biosynthesis pathway, so it is possible to increase macrocyclic diterpenes by inhibiting triterpenoid biosynthesis genes. Squalene synthase is a key upstream enzyme in the triterpene biosynthesis pathway of caper, so it is feasible to increase macrocyclic diterpene production in caper by knocking out the squalene synthase gene. Gene editing technology has been successfully applied to the genetic modification of various plants and is characterized by precision and efficiency. However, the current gene editing system for caper is still immature. Summary of the Invention

[0004] In view of the above shortcomings, the present invention provides a preparation method and use of a squalene synthase knockout mutant material of Caper squalene.

[0005] The present invention is achieved through the following technical solutions.

[0006] Using gene editing technology to knock out the squalene synthase gene increases the production of macrocyclic diterpenes in the hairy roots of Caper vine.

[0007] The method comprises the following steps: designing a specific target site for the squalene synthase gene of caper, constructing a pNK2-Cas9-U6 gene editing recombinant vector containing the specific target site by gene editing technology, infecting caper hypocotyl explants with Agrobacterium rhizogenes, transferring the recombinant vector into the caper, specifically knocking out the squalene synthase gene, obtaining squalene synthase knockout mutant hairy roots, and obtaining caper hairy root materials with high macrocyclic diterpenoid yields through LC-MS detection.

[0008] The target fragment connected to the pNK2-Cas9-U6 vector backbone is the target sequence of the squalene synthase gene.

[0009] The specific target sequence of the squalene synthase gene is obtained from the first exon of the squalene synthase gene, and the target sequence is (5'-3') GGGAGCAATTCTGAAGCATC.

[0010] The squalene synthase gene CDS sequence is as follows Figure 1 shown.

[0011] The caper macrocyclic diterpene high-yield material is obtained through a hairy root transformation system.

[0012] The gene editing material is identified as a caper mutant material by DNA sequencing of the target sequence.

[0013] The use is to block the triterpene synthesis pathway in the terpene synthesis process by knocking out the squalene synthase gene, a key enzyme gene in triterpene biosynthesis, thereby increasing the yield of macrocyclic diterpenes and reducing production costs.

[0014] The increased production of macrocyclic diterpenes was confirmed by LC-MS analysis of the gene-edited knockout material of Caper.

[0015] This study, published in the journal Nature Communications, successfully constructed a gene editing system for caper fruit, creating a knockout mutant targeting the squalene synthase gene. LC-MS analysis revealed significantly increased macrocyclic diterpenoid production. This caper fruit squalene synthase knockout mutant exhibits high macrocyclic diterpene production, potentially reducing production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the CDS sequence of the squalene synthase gene from Capilla spp. The underlined sequence is the target sequence for gene editing.

[0017] Figure 2 This is the sequencing result of the squalene synthase gene editing knockout. The mutation is located at position 30 of the squalene synthase gene CDS, is a homozygous mutation, and is an A insertion mutation.

[0018] Figure 3 The hairy roots of the squalene synthase knockout mutant of Caper.

[0019] Figure 4 This is the LC-MS analysis result of ingenol.

[0020] Figure 5 These are the results of LC-MS analysis of diterpenoid alcohols in Leptochloa chinensis. DETAILED DESCRIPTION

[0021] The specific embodiments of the present invention are described in further detail below, but the content of the present invention is not limited to the content contained in the following embodiments.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0023] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0024] Example 1: Construction of gene editing system.

[0025] According to CRISPR target design principles, the CDS sequence of the squalene synthase gene was first aligned with the genomic sequence using snapgene 4.1.9 software to identify exons. A PAM sequence was selected for the first exon; the characteristic PAM sequence was NGG or CCN, where N is any nucleotide. Exon sequences within 20 bases upstream of the NGG or downstream of the CCN were screened. Candidate target sequences with a GC content of 50–65% were selected, and multiple consecutive A or C sequences were avoided. The specific target sequence used in this experiment was (5'-3') GGGAGCAATTCTGAAGCATC.

[0026] The two primers used to synthesize the target sequence, SST1F and SST1R (Table 1), were synthesized by Beijing Qingke Biotechnology Co., Ltd. The two primers were denatured, annealed, and extended to form a double-stranded structure. The reaction system consisted of 10 µL of 2× BioRunPfu PCR Mix, 1 µL of SST1F, 1 µL of SST1R, and 8 µL of ddH2O. PCR reaction conditions were: 98°C for 3 min, followed by 25 cycles of 98°C for 15 s, 55°C for 15 s, and 72°C for 30 s, and finally 72°C for 5 min.

[0027] Golden Gate seamless cloning technology was used to generate the pNK2-Cas9-U6 recombinant vector containing the editing target. The pNK2-Cas9-U6 vector was purchased from Wuhan Boyuan Biotechnology Co., Ltd. This vector uses the pNK2-Cas9 backbone and contains the dicotyledonous U6 promoter. The ligation reaction system consisted of: 10× Reaction Buffer: 2 µL, pNK2-Cas9-U6 (50 ng / µL): 2 µL, target product: 1 µL, BioRun Eco31Ⅰ: 1 µL, T4 DNA Ligase: 1 µL, and ddH2O: 8 µL. The system was mixed, centrifuged briefly, and incubated at 37°C for 30 min. The system was then heated to 65°C and placed on ice until ready to use.

[0028] Table 1 Amplification primer sequences for target sequences

[0029] Primer name Primer sequence (5'-3') SST1F cagt GGTCTCA TGCA GGGAGCAATTCTGAAGCATC SST1R cagt GGTCTCA AAAC GATGCTTCAGAATTGCTCCC

[0030] The ligation product was transformed into Escherichia coli as follows: E. coli competent cells DH5α were taken out of -80°C and thawed on ice. The gene editing vector ligation product was added to the E. coli competent cells in an ice-water mixture state. The cells were incubated on ice for 30 minutes, heat-shocked at 42°C for 45 seconds, and then incubated on ice for 2 minutes. 700 μL of antibiotic-free LB liquid medium was added to the centrifuge tube. The cells were revived on a shaker at 37°C for 1 hour, spread on an LB plate containing kanamycin, and incubated inverted at 37°C for 12 hours. Single clones were picked, expanded, and sequenced. The sequencing primer was U6cef (5'-3'): TACAGCTAGAGTCGAAGTAG.

[0031] Sequencing results revealed the squalene synthase target sequence. The successfully constructed pNK2-Cas9-U6 gene-editing recombinant vector was then transformed into Agrobacterium rhizogenes MSU440 cells using the heat shock method. The competent cells were thawed on ice, the gene-editing recombinant vector was added, and the cells were placed in an ice bath for 5 minutes, in liquid nitrogen for 5 minutes, and then heat-shocked at 37°C for 5 minutes. After a 5-minute ice bath, 700 µL of antibiotic-free LB medium was added to the competent cells. The cells were shaken at 28°C for 2 hours, spread onto LB plates containing kanamycin and streptomycin, and incubated upside down at 28°C for 48-72 hours. Positive colonies were picked from the plates and cultured in 15 mL shaker tubes in LB medium (50 mg / L kanamycin and 50 mg / L streptomycin) at 28°C and 200 rpm.

[0032] Select plump caper seeds. Rinse with running water for 20 minutes, then soak in 75% ethanol for 45 seconds, then soak in 0.1% mercuric chloride solution for 2 minutes. Repeat the rinse with sterile water for at least five times. Place the seeds on 1 / 2 MS medium. After three days of incubation at 25°C with a 16 / 8 hour light / dark cycle for approximately 15 days, remove the hypocotyls and culture for 5-7 days as explants.

[0033] The Agrobacterium rhizogenes containing the gene editing recombinant vector was expanded to 30 mL, and the OD 600 The cells were collected by centrifugation at 4000 rpm for 10 minutes at a pH of 0.5-0.8. The cells were resuspended and diluted to 50 mL in 1 / 2 MS liquid medium. 5 µL of 0.1 M acetosyringone was added and the cells were allowed to stand on ice for 1 hour. Hypocotyl explants of the radix serrata were placed in the prepared bacterial solution for 5 minutes. Excess liquid was removed using sterile filter paper. After drying the surface of the bacterial solution in a clean hood, the hypocotyls were placed on 1 / 2 MS solid medium for co-culture. After 3 days of co-culture, the hypocotyls were transferred to solid medium containing 200 mg / L cephalosporin for subculture. Hairy roots developed after approximately 2 weeks, and multiple subcultures were performed.

[0034] Example 2: Identification of gene-edited mutants by DNA sequencing.

[0035] Mutant verification primers were designed approximately 200 bp above and below the target site for editing the squalene synthase gene in Caper (Table 2). DNA from Caper hairy roots was extracted using the CTAB method. PCR amplification was performed using the SS cxf and SS cxr primers, using the DNA as a template. The PCR products were sequenced. Sequencing results were analyzed using snapgene 4.1.9 to determine the mutation type. The results showed that the gene-edited homozygous knockout mutant was an A-base insertion knockout mutation ( Figure 2 ).

[0036] Table 2 Primer sequences for mutant verification

[0037] Primer name Primer sequence (5'-3') SS cxf TGGACTCAATCCGTCGTTTTCG SS cxr TGGTTCTTCGAGCCCTTGATACTG

[0038] Example 3: LC-MS analysis of macrocyclic diterpene production in gene-edited knockout mutant materials.

[0039] The knockout hairy roots and blank hairy roots were placed in 40 mL of 1 / 2 MS medium for culture at 25°C and 120 rpm. After 15 days, the hairy root materials were collected ( Figure 3 ) Freeze-dried for later use.

[0040] A 20 mg sample of freeze-dried hairy roots was ultrasonically extracted with 10 mL of methanol, and the extract was collected. 1 mL of the extract was added with 5% KOH and adjusted to pH 13 using pH paper. The extract was then hydrolyzed at 40°C for 30 min. After hydrolysis, 0.2 M acetic acid was added to adjust the pH to 7, and the volume was adjusted to 5 mL with water. The hairy root extract was passed through an SPE column, eluted with 5 mL of water and 5 mL of methanol, respectively, and centrifuged. The supernatant was analyzed by LC-MS.

[0041] LC-MS analysis was performed on an Agilent HPLC-Q-TOF-MS / MS (1260HPLC+6530 Q-TOF) instrument using an Agilent Poroshell column (4.6 mm × 100 mm, 2.7 µm). The column temperature was 30°C, and the mobile phase consisted of water (containing 0.1% formic acid) and methanol. The analysis time for each sample was 50 minutes, the flow rate was 0.5 mL / min, and the injection volume was 5 µL. Analysis using Agilent MassHunter Qualitative Analysis 10.0 software revealed a significant increase in the production of macrocyclic diterpenoids such as ingenol (a precursor for the synthesis of ingenol methylbutyrate) and euphorbia cerifera diterpenoids (the parent nucleus of Euphorbia factor L3) in the hairy roots of the knockout strains ( Figure 4 and Figure 5 ).

Claims

1. Application of a caper squalene synthase knockout mutant material in the preparation of macrocyclic diterpenoids; the caper squalene synthase knockout mutant material is prepared by the following method: 1) The pNK2-Cas9-U6 recombinant vector containing the editing target was obtained using seamless cloning Golden Gate technology. The specific ligation reaction system was as follows: 10× Reaction Buffer: 2 µL, 50 ng / µL pNK2-Cas9-U6: 2 µL, target product: 1 µL, BioRun Eco31Ⅰ: 1 µL, T4 DNA Ligase: 1 µL, dd H2O: 8 µL. The above system was mixed and centrifuged briefly and incubated at 37°C for 30 min, then heated at 65°C and placed on ice until ready to use. The target sequence amplification primer sequence is SST1F: 5'-cagt GGTCTCA TGCA GGGAGCAATTCTGAAGCATC-3', SST1R: 5'-cagt GGTCTCA AAAC GATGCTTCAGAATTGCTCCC-3', The specific target sequence is: 5'-GGGAGCAATTCTGAAGCATC-3', The ligation product was transformed into Escherichia coli, and the squalene synthase target sequence was detected by sequencing. The successfully constructed pNK2-Cas9-U6 gene editing recombinant vector was transformed into Agrobacterium rhizogenes MSU440 by heat shock method, and positive clones were screened and set aside. Select the hypocotyl explants of the genus Caper and soak them in a culture medium containing the gene-editing recombinant vector containing Agrobacterium rhizogenes for 5 minutes. Remove the excess culture medium with sterile filter paper. After drying the surface culture medium with a clean bench, place the hypocotyls on 1 / 2 MS solid medium for co-culture for 3 days. Then, transfer the hypocotyls to a solid medium containing 200 mg / L cephalosporin for subculture to grow hairy roots. Repeat the subculture multiple times. 2) DNA from the hairy roots of Caper spp. was extracted using the CTAB method. PCR amplification was performed using the hairy root DNA as a template and primers SS cxf and SS cxr. The PCR products were sequenced. Sequencing results were analyzed using snapgene 4.1.9 to confirm the homozygous knockout mutant obtained. The knockout type was an A-base insertion knockout mutation. The mutant verification primer sequences were: SS cxf: 5'-TGGACTCAATCCGTCGTTTTCG-3', SS cxr: 5'-TGGTTCTTCGAGCCCTTGATACTG-3'; The application is as follows: the knockout hairy roots are placed in a 1 / 2 MS liquid culture medium for cultivation at 25°C and 120 rpm, and after 15 days, the hairy root materials are collected to extract macrocyclic diterpenoids and identify the components and yields; The macrocyclic diterpenoid substances include ingenol and euphorbia pulegoneia diterpenoid alcohol.