Applications of silencing, suppressing, or knocking out the SlSnRK1.1 gene and SlSnRK1.1 gene mutants and their applications

Abstract

This invention discloses silencing, suppression, or knockout. SlSnRK1.1 The application of genes and SlSnRK1.1 Gene mutants and their applications belong to the field of plant genetic engineering technology. This invention has discovered that tomato... SlSnRK1.1 The gene (NCBI gene ID: 778276) regulates the accumulation of lycopene in its fruit. The tomato SlSnRK1.1 mutant was obtained using CRISPR-Cas9 technology. Slsnrk1.1 It was found that the lycopene content in the mutant was higher. Slsnrk1.1 Significantly increased in tomatoes. This invention provides a reference for subsequent efforts to increase lycopene content in tomato fruits, as well as for breeding and variety improvement.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the tomato SlSnRK1.1 gene in regulating lycopene synthesis in tomato fruit; particularly silencing, inhibiting, or knocking out the gene. SlSnRK1.1 The application of genes and SlSnRK1.1 Gene mutants and their applications. Background Technology

[0002] Tomato (Solanum lycopersicum L.) belongs to the Solanaceae family and the Solanum genus. Native to South America, it is one of the world's most produced and consumed vegetables and an important economic crop globally. According to FAOSTAT, in 2022, the world's top five tomato producing countries were China, India, Turkey, the United States, and Egypt, with a global fruit production of 186 million tons. Tomatoes are highly nutritious, containing many compounds beneficial to human health, such as ascorbic acid and carotenoids. Sucrose non-fermentative protein kinase SnRK1 is a key component in sensing and regulating cellular energy homeostasis. It is widely distributed in eukaryotes and its functions are highly conserved, regulating biological processes such as plant growth, development, senescence, and metabolism by coordinating nutrient availability, energy status, and hormonal signaling. Tomatoes are rich in lycopene, which has strong antioxidant capabilities and has been widely used in the production of antioxidant skincare products in recent years. However, tomatoes... SlSnRK1.1 Whether the gene (NCBI gene number: 778276) is involved in the synthesis of lycopene is currently unknown. This invention obtained the tomato SlSnRK1.1 mutant using CRISPR-Cas9 technology. Slsnrk1.1 Studies have found that SlSnRK1.1 in tomatoes affects the accumulation of lycopene in their fruits. Experimental results show that the lycopene content in mutants... Slsnrk1.1 Significantly increased in tomatoes. Summary of the Invention

[0003] The primary objective of this invention is to provide the application of silencing, inhibiting, or knocking out the SlSnRK1.1 gene in increasing lycopene content in plants. It has been discovered that knocking out the SlSnRK1.1 gene can increase lycopene content in plants.

[0004] The SlSnRK1.1 gene includes the tomato SlSnRK1.1 gene; the mRNA sequence is shown in SEQ ID No:1, and the protein sequence is shown in SEQ ID No:2.

[0005] The plant mentioned includes tomatoes.

[0006] The second aspect of this invention aims to provide a mutant with the SlSnRK1.1 gene knocked out.

[0007] The mutants mentioned include cells, tissues, or plants.

[0008] The mutant described is a mutant obtained through CRISPR-Cas9 technology.

[0009] The mutant in question is a tomato mutant.

[0010] A third objective of this invention is to provide the application of the mutant in increasing the lycopene content of plants or in their breeding.

[0011] Specifically, it involves increasing the lycopene content in tomato plants or its application in breeding.

[0012] This invention is the first to discover that the SlSnRK1.1 gene regulates the accumulation of lycopene in tomato fruit. Furthermore, a tomato SlSnRK1.1 mutant was obtained using CRISPR-Cas9 technology. Slsnrk1.1 The experimental results show that lycopene accumulates in the mutant Slsnrk1.1 tomato. This provides a reference for further improving the lycopene content in tomato fruits and for breeding and variety improvement. Attached Figure Description

[0013] Figure 1 CRISPR-Cas9 vector map.

[0014] Figure 2 Mutation sites and sequencing identification of the SlSnRK1.1 gene in tomato.

[0015] Figure 3 Tomato SlSnRK1.1 gene knockout mutant ( Slsnrk1.1 Fruit phenotypes of 1,000 and wild-type (WT).

[0016] Figure 4 Tomato SlSnRK1.1 gene knockout mutant ( Slsnrk1.1 The lycopene content of lycopene in fruit of the wild type (WT) and wild type (WT) at the ripening stage. Detailed Implementation

[0017] The following examples are intended to further illustrate the present invention, but not to limit it.

[0018] Example 1

[0019] Materials and Cultivation: Tomato seeds (Solanum lycopersicum L. 'Micro-Tom') were stored at 4°C. Plump seeds were selected and placed in petri dishes containing moistened filter paper, and germinated at 25°C in the dark for 2-3 days. Seeds showing signs of germination were sown in 72-well seedling trays filled with a mixture of humus and vermiculite (2:1 v / v). When the plants reached the three-leaf stage, they were transferred to pots containing the same substrate. Growing conditions: 25°C, 16 hours of light (10000 Lx), 8 hours of darkness, and 60% relative humidity.

[0020] 1. Obtaining mutants using CRISPR technology

[0021] Using the CRISPR-Cas9 system in tomatoes ( Solanum lycopersicum The SlSnRK1.1 mutant was obtained in the L.'Micro-Tom' background.

[0022] (1) Knockout target sites were designed based on the cDNA of the target gene SlSnRK1.1. The website used was:

[0023] https: / / crispr.dbcls.jp /

[0024] The target site sequence is as follows:

[0025] target 1 CATAAAGCCGTATAATATG (reverse);

[0026] target 2 GTTGAGAAGGGCAGATTGC (positive).

[0027] (2) Constructing a carrier

[0028] 20 μl PCR reaction system:

[0029] 2 μl 10× buffer

[0030] 2 μl 2mM dNTPs

[0031] 2 μl DNA template (CR-PCR plasmid)

[0032] 1 μl DMSO

[0033] 0.8 μl of 10 pmol / ml forward and reverse primers

[0034] 0.5 U kod DNA polymerase (KOD-401, TOYOBO)

[0035] Add water to make up to 20 μl.

[0036] PCR amplification procedure:

[0037] Pre-denaturation at 94℃ for 4 min;

[0038] Denaturation at 94℃ for 30 s, annealing at 50–64℃ for 30 s, extension at 68℃ for 30 s, 40 cycles;

[0039] Keep warm at 68℃ for 8 minutes.

[0040] Enzyme digestion:

[0041] 40 μl enzyme digestion system:

[0042] PCR product / CR empty vector

[0043] 4 μl 10× enzyme digestion buffer

[0044] 4μl 10×BSA

[0045] 6 U BsaI restriction endonuclease (NEB)

[0046] Add water to make up to 40 μl

[0047] Incubate in a 37°C water bath for approximately 1 hour for enzyme digestion.

[0048] Plasmid construction steps:

[0049] The enzyme-digested PCR fragments and the enzyme-digested empty CR vector (M2CRISPR, abbreviated as CR vector, Shanghai Pujie Biotechnology Co., Ltd.) were recovered by agarose gel electrophoresis and ligated using DNA ligase (#M0202M, NEB). The ligation system is as follows:

[0050] 2ul 10× Ligation Buffer

[0051] 2ul of enzyme digestion vector DNA

[0052] 8ul DNA fragment

[0053] 1ul DNA ligase

[0054] Replenish with 20ul of water

[0055] The reaction mixture was added to a 250 μL EP tube, placed in a 16°C water bath for 30 minutes, and then transformed into E. coli and plated. The plates were incubated at 37°C for 16 hours, and then bacteria were picked and sequenced.

[0056] The above process was completed by Shanghai Pujie Biotechnology Co., Ltd.

[0057] 2. Agrobacterium-mediated genetic transformation of tomato

[0058] (1) Agrobacterium transformation

[0059] Take Agrobacterium competent cells stored at -80℃ and let them partially thaw at room temperature or in your palm for a moment. When they are in an ice-water mixture, insert them into ice. Add 0.1 μg (volume not exceeding 10 μl) of plasmid DNA to every 100 μl of competent cells, stir the bottom of the tube by hand to mix well, and incubate on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37℃ water bath for 5 minutes, and in an ice bath for 5 minutes in sequence.

[0060] Add 700 μl of antibiotic-free LB broth and incubate at 28°C with shaking at 200 rpm for 2–3 h. Centrifuge at 6000 rpm for one minute to collect the bacteria. Retain approximately 100 μl of the supernatant, gently pipette to resuspend the bacterial block, and spread it onto an LB agar plate containing the appropriate antibiotic. Invert the plate and incubate at 28°C for 2–3 days. Randomly select 2–3 single colonies for colony PCR. Identify the correctly identified Agrobacterium single clones and label them for later use.

[0061] Using a sterile pipette tip, pick up a labeled Agrobacterium monoclonal sample and inoculate it into 5 ml of LB liquid medium containing the appropriate antibiotic (using a 50 ml blue cap centrifuge tube). Incubate at 28°C and 200 rpm for 24 hours with shaking.

[0062] Centrifuge at 20℃, 4,000 rpm for 15 min and collect the bacterial cells; resuspend the bacterial cells in transformation buffer until OD600=0.5.

[0063] (2) Agrobacterium inoculation and co-culture of explants

[0064] Sterile true leaves, cotyledons, and hypocotyls were selected as explants for transformation. The tips and petioles of the true leaves and cotyledons were removed, and the remaining parts were cut into leaf pieces of 0.5 cm × 0.5 cm. The hypocotyls were cut into segments approximately 0.5-0.6 mm in length and placed horizontally on pre-medium medium, 15-20 segments per dish. Culture conditions were the same as above, with pre-culture for 1 day. The explants were then removed from the pre-medium medium and placed in a culture dish containing Agrobacterium tumefaciens diluted with transformation buffer to approximately OD600 = 0.5. Transformation was performed for 30 min. The explants were then removed, blotted dry on sterile paper, and returned to the pre-medium medium for further culture for 1-2 days.

[0065] (3) Selection of culture

[0066] The co-cultured explants were transferred to a selection medium for selective culture. After a few days of selection culture, the cotyledons began to thicken, and the hypocotyls began to thicken. The transformed explants will form callus and adventitious buds on the selection medium. Subculture was performed every two weeks until regenerated seedlings emerged.

[0067] 3. Sequencing to identify whether the target mutation region has mutated.

[0068] (1) PCR identification reaction system and conditions

[0069] Design upstream and downstream primers 120-200 bp on either side of the target region selected by the CRISPR mutation, named F: GATATACCTTGATGGAGGATG and R: GGTCTCTATGAACCACCATG. Amplify the genomic DNA of all genetically transformed seedlings using a common Taq polymerase or a high-fidelity PCR enzyme (KOD FX DNA polymerase from TOYOBO is recommended).

[0070]

[0071] (2) Sequencing

[0072] The PCR products were analyzed by electrophoresis and gel extraction to recover the target band, which was then sent to a sequencing company for sequencing. Positive plants were obtained based on the sequencing results. The sequencing results showed that we obtained a homozygous mutant with a 104bp deletion. Slsnrk1.1 ( Figure 2 ).

[0073] 3. Lycopene determination

[0074] The watering frequency, watering amount, fertilization frequency, and fertilization amount were kept consistent between the control and experimental groups of tomatoes. Tomato redness was measured after the fruit was fully ripe. The tomato was washed with ethanol, extracted with petroleum ether, and the filtrate was measured using a UV spectrophotometer (Zhang Lianfu and Ding Xiaolin, 2001). Fully ripe tomatoes... Figure 3 As shown, the content determination results are as follows: Figure 4 As shown.

Claims

1. silencing SlSnRK1.1 application of a gene in increasing the lycopene content of a plant, characterized in that, SlSnRK1.1 The sequence of the protein encoded by the gene is as set forth in SEQ ID No: 2, and the plant is Solanum lycopersicum.

2. Inhibition SlSnRK1.1 Use of the gene for increasing the content of phytoene in plants, characterized in that, SlSnRK1.1 The sequence of the protein encoded by the gene is as set forth in SEQ ID No: 2, and the plant is Solanum lycopersicum.

3. Knockout SlSnRK1.1 Use of a gene for increasing the content of phytoene in plants, characterized in that, SlSnRK1.1 The sequence of the protein encoded by the gene is as set forth in SEQ ID No: 2, and the plant is Solanum lycopersicum.

4. Knockout SlSnRK1.1 Tomato mutants of the gene characterized in that, SlSnRK1.1 The sequence of the protein encoded by the gene is as SEQ ID No:

2.

5. The tomato mutant according to claim 4, characterized in that, are tomato mutants obtained by CRISPR-Cas9 technology.

Images