Primer pair for identifying ulmus pumila and ulmus parvifolia germplasm and application thereof

Abstract

The invention discloses a primer pair for identifying ulmus pumila and ulmus parvifolia germplasm and application of the primer pair, the primer pair comprises the following primer pairs Ulmusp104 or / and Ulmusp40, a fresh ulmus pumila or ulmus parvifolia tissue sample to be detected is collected, and DNA of the tissue sample is extracted; carrying out PCR (Polymerase Chain Reaction) amplification by using the primer pair by taking the DNA as a template; carrying out electrophoresis detection on an amplification product; judging whether the to-be-detected sample is ulmus pumila or ulmus parvifolia according to a detection result. The SSR molecular marker for transcriptome sequencing is used for identifying ulmus pumila and ulmus parvifolia germplasm resources, so that ulmus pumila and ulmus parvifolia improved variety breeding is promoted, and the utilization process of excellent germplasm is accelerated. The specific primers are respectively used for amplifying ulmus parvifolia and ulmus pumila tissues, and the length difference of the two products is obvious, so that the specific primers can be used for effectively identifying ulmus pumila and ulmus parvifolia germplasm.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, relates to a primer pair, and specifically relates to a primer pair for identifying Ulmus pumila and Ulmus chinensis germplasm. Background Art

[0002] Ulmus pumila L. and Ulmus parvifolia are trees of the genus Ulmus L., Ulmaceae family. They are widely distributed native broad-leaved tree species in China. There are more than 30 species in the genus Ulmus, native to the northern hemisphere. There are 25 species and 6 varieties in my country, distributed throughout the country, with more in the north of the Yangtze River Basin.

[0003] Both white elm and Chinese elm are light-loving species with well-developed root systems and strong resistance. They are excellent species for soil and sand fixation in areas with harsh ecological environments. Their winged fruits are edible (the oil content is 20% to 40%) and have excellent materials. They are important raw material species for medicine, light industry and chemical industry. Their branches and leaves are resistant to pruning and are highly ornamental, so they are widely used in garden plant shaping. Therefore, white elm and Chinese elm are multifunctional species that integrate ecological, economic and ornamental values.

[0004] In the process of implementing the present invention, the inventors found that the prior art has at least one of the following technical problems:

[0005] my country has abundant germplasm resources of Ulmus pumila and Ulmus tiliaceus. Except for the obvious difference in flowering time (Ulmus pumila blooms in spring and Ulmus tiliaceus blooms in autumn), their other phenotypic traits are similar and difficult to distinguish, which brings difficulties to the early identification of germplasm. Summary of the invention

[0006] In view of this, the object of the present invention is to provide an SSR molecular marker using transcriptome sequencing to quickly identify Ulmus pumila and Ulmus chinensis germplasm.

[0007] The inventors have continuously innovated and reformed through long-term exploration and attempts, as well as multiple experiments and efforts, to solve the above technical problems. The technical solution provided by the present invention is to provide a primer pair for identifying Ulmus pumila or Ulmus chinensis germplasm, wherein the primer pair is one or more of the following primer pairs:

[0008] Ulmus_p104:

[0009] Upstream primer: 5′-CCCCATCTGGATTGGCAGTT-3′;

[0010] Downstream primer: 5′-CGCCCTTTGACGGTTGGATA-3′;

[0011] Ulmus_p40:

[0012] Upstream primer: 5′-GCCAGTTGGGTGGATCAAGA-3′;

[0013] Downstream primer: 5′-GTGGGGATGCGAGAGAACAA-3′.

[0014] The present invention also provides an application of the primer pair for identifying Ulmus pumila or Ulmus truncatum germplasm;

[0015] The primer pair is Ulmus_p104:

[0016] The sample with an amplified product fragment size of 212 bp is Ulmus pumila;

[0017] The sample whose amplified product contained a fragment size of 209 bp was Ulmus pumila;

[0018] The primer pair is Ulmus_p40:

[0019] The sample with amplified product fragment size of 253 bp is Ulmus pumila;

[0020] The samples with amplified product fragment size of 241 to 251 bp belong to Ulmus pumila.

[0021] The present invention also discloses a method for identifying Ulmus pumila and Ulmus truncatum germplasm using the primer pair, and the identification steps are as follows:

[0022] Step S1: collecting fresh tissue samples of Ulmus pumila or Ulmus truncatum to be tested, and extracting DNA from the tissue samples;

[0023] Step S2: using the DNA extracted in step S1 as a template, and performing PCR amplification using the primer pair;

[0024] Step S3: electrophoresis to detect the amplified product;

[0025] Step S4: determining whether the sample to be tested is Ulmus pumila or Ulmus truncatum according to the test result;

[0026] The primer pair is Ulmus_p104:

[0027] The sample with an amplified product fragment size of 212 bp is Ulmus pumila;

[0028] The sample whose amplified product contained a fragment size of 209 bp was Ulmus pumila;

[0029] The primer pair is Ulmus_p40:

[0030] The sample with amplified product fragment size of 253 bp is Ulmus pumila;

[0031] The samples with amplified product fragment size of 241 to 251 bp belong to Ulmus pumila.

[0032] According to one embodiment of the method of the present invention, the tissue sample is a young leaf.

[0033] According to one embodiment of the method of the present invention, the electrophoresis is capillary electrophoresis or gel electrophoresis.

[0034] According to one embodiment of the method of the present invention, the capillary electrophoresis is specifically as follows: 0.1 μL of the PCR product in step S2 is diluted to 1 μL, mixed with 15 μL of a 100:1 mixture of formamide and molecular weight internal standard, added to a PCR plate, denatured at 95°C for 5 minutes, cooled at 4°C and centrifuged, and then tested on a machine.

[0035] According to one embodiment of the method of the present invention, in step S4: the raw data obtained in step S3 are analyzed, and the position of the molecular weight internal standard in each lane is compared with the position of each sample peak to obtain the fragment size.

[0036] According to one embodiment of the method of the present invention, step S4 further comprises calculating a genetic distance matrix based on the original site data, and constructing a phylogenetic tree using a similarity coefficient method based on the GS value matrix.

[0037] Compared with the prior art, one of the above technical solutions has the following advantages:

[0038] a) The present invention uses SSR molecular markers from transcriptome sequencing to identify the germplasm resources of Ulmus pumila and Ulmus tiliaceus, which is beneficial to promoting the breeding of improved varieties of Ulmus pumila and Ulmus tiliaceus and accelerating the utilization of improved germplasm.

[0039] b) The specific primers of the present invention were used to amplify Ulmus pumila and Ulmus pumila tissues, respectively, and the product lengths of the two were significantly different, indicating that these specific primers can effectively identify Ulmus pumila and Ulmus pumila germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0041] Figure 1 This is the electrophoresis diagram of Ulmus pumila and Ulmus truncatum germplasm after amplification with primer Ulmus_p104.

[0042] Figure 2 This is the electrophoresis diagram of Ulmus pumila and Ulmus truncatum germplasm after amplification with primer Ulmus_p40.

[0043] Figure 3 This is the phylogenetic tree constructed using primers specific to experimental group A.

[0044] Figure 4 It is the phylogenetic tree constructed by comparing group B specific primers. DETAILED DESCRIPTION

[0045] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the drawings is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention.

[0046] A large number of EST-SSR primer sequences were obtained by sequencing the transcriptome of Ulmus pumila.

[0047] 200 pairs of primers were selected for stability, specificity and polymorphism tests, and 16 pairs of primers were screened after the tests. After comparative analysis, 2 pairs of specific primers were finally screened out (Table 1) for germplasm identification of Ulmus pumila and Ulmus chinensis.

[0048] Table 1 Information of two pairs of specific EST-SSR primers screened

[0049] Primer name Ulms_p40 Ulms_p104 ID Cluster-23829.0 Cluster-32283.4 SSR nr. 2 1 SSR type c* p3 Repeating sequence (AG)11(AGAG)5* (CGC)5 size 20 15 Repeat sequence start 1465 117 Repeat sequence end point 1484 131 Upstream primer sequence gccagttgggtggatcaaga ccccatctggattggcagtt Upstream primer start 1348 83 Downstream primer sequence gtggggatgcgagagaacaa cgccctttgacggttggata Downstream primer start point 1597 292 .

[0050] The cDNA library of Ulmus pumila was constructed based on the transcriptome data of Ulmus pumila leaves. The site of primer Ulmus_p40 was a 1616 bp sequence, as shown in the sequence list SEQ ID NO.1, with a coding interval of 348-1394 (-), encoding a total of 348 amino acids, as shown in the sequence list SEQ ID NO.15. Primer Ulmus_p40 was designed based on the sequence shown in SEQ ID NO.1.

[0051] The elm cDNA library was constructed based on the transcriptome data of Ulmus pumila leaves. The site of the primer Ulmus_p104 was a 3133 bp sequence, as shown in the sequence table SEQ ID NO.2, with a coding interval of 1955-2944 (+), encoding a total of 329 amino acids, as shown in the sequence table SEQ ID NO.16. The primer Ulmus_p104 was set according to the sequence shown in SEQ ID NO.2.

[0052] The steps for identifying Ulmus pumila and Ulmus truncatum using EST-SSR molecular markers obtained by transcriptome sequencing are as follows:

[0053] 1) Collect fresh young leaf samples of Ulmus pumila or Ulmus pumila to be tested, and extract DNA from the leaf samples.

[0054] The DNA of young leaf samples of 26 Ulmus pumila and Ulmus truncatum germplasms (Table 2) was extracted using the Tiangen High-Efficiency Plant Genomic DNA Extraction Kit.

[0055] Table 2 Germplasm of Ulmus pumila and Ulmus truncatum

[0056] .

[0058] In this embodiment, two groups of EST-SSR specific primers are set for control. Experimental group A is the two pairs of EST-SSR specific primers described in Table 1, namely Ulmus_p104 and Ulmus_p40. Control group B is the other four pairs of EST-SSR specific primers randomly selected by the inventor from a large amount of experimental data in the process of completing the present invention, namely p20, p61, p141 and p148 (sequences are shown in Table 3). The upstream and downstream sequences of the two groups of specific primers are synthesized by Anhui General Biotechnology Co., Ltd.

[0059] Table 3 Group B specific EST-SSR primer information

[0060] .

[0062] 2) Amplification.

[0063] The DNA extracted in step 1) was used as a template, and PCR amplification was performed using the above-mentioned group A and group B specific primers, respectively. The PCR instrument model used was Hangzhou Jingge-K960 thermal cycler.

[0064] The PCR amplification uses a 20 μL reaction system, including: 14.8 μL ddH2O, 0.4 μL dNTP, 2 μL PCR Buffer, 0.3 μL upstream primer (20 μM), 0.3 μL downstream primer (μM), 2 μL DNA template, and 0.2 μL Taq;

[0065] The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 45 s, and extension at 72°C for 50 s, for a total of 35 cycles; and final extension at 72°C for 5 min.

[0066] 3) Detect the amplified product by capillary electrophoresis.

[0067] Take 0.1 μL of the PCR amplification product in step 2) and dilute it to 1 μL, mix it with 15 μL of a 100:1 mixture of formamide and molecular weight internal standard, add it to the PCR plate, denature it at 95°C for 5 min, cool it at 4°C and centrifuge it, then use the machine (genetic analyzer ABI 3730XL DNAanalyzer, capillary ABI 96×50cm 4331246) for detection. The specific parameters are shown in Table 4.

[0068] Table 4 Genetic analyzer parameter settings

[0069] .

[0071] After the electrophoresis, the original data obtained by the sequencer were analyzed using the Fragment (Plant) fragment analysis in the Genemarker V2.2.0 software to obtain the fragment size. Figure 1 The electrophoresis diagram of Ulmus pumila and Ulmus truncatum germplasm after amplification with Ulmus_p40 primer is shown in Figure 2 shown.

[0072] Table 5 Length of amplified products from primer group A of Ulmus pumila and Ulmus truncatum germplasm

[0073] .

[0075] Table 6 Length of amplified products from primer group B of Ulmus pumila and Ulmus truncatum germplasm

[0076]

[0077] .

[0079] The results are shown in Tables 5 and 6. In Group A, the products of Ulmus LY1-6 were 253bp and 253bp under Ulmus_P40 specific primer amplification, which were homozygous; under Ulmus_P104 specific primer amplification, they were 212bp and 212bp, which were homozygous, and the length difference with Ulmus pumila was significant. In Group B, the products amplified by the four pairs of SSR specific primers were different, and the differences between the germplasms were obvious, but it was impossible to effectively identify Ulmus pumila and Ulmus LY1-6. Although the products of Ulmus LY1-6 were 243bp and 243bp under P20 specific primer amplification, which were homozygous, Ul7 and Ul10 also detected homozygous of 243bp and 243bp.

[0080] The length of each amplified product was calculated using Popgen32 software, and the phylogenetic tree was constructed using the similarity coefficient method based on the GS value matrix. Figure 3 , Figure 4 As shown, Group A ( Figure 3 ) Two pairs of EST-SSR specific primers phylogenetic tree divided Ulmus pumila and Ulmus chinensis germplasms into two groups, the upper group included Ul3, 11, 6, 12, 13, 14, 15, 9, 1, 2, 4, 8, 10, 5, 7, all of which were Ulmus pumila, and the lower group included LY4, 1, 2, 3, 5, 6, all of which were Ulmus chinensis. Both pairs of EST-SSR specific primers could completely distinguish Ulmus pumila and Ulmus chinensis germplasms. Group B ( Figure 4 ) The phylogenetic tree of the four pairs of EST-SSR specific primers could not effectively distinguish and identify the germplasm of Ulmus pumila and Ulmus chinensis, and the two types of germplasm were mixed together, indicating that the four pairs of EST-SSR specific primers in group B could not effectively identify the germplasm of Ulmus pumila and Ulmus chinensis.

[0081] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A primer pair for identifying Ulmus pumila or Ulmus truncatum germplasm, characterized in that: The primer pairs are one or more of the following primer pairs: Ulmus_p104: Upstream primer: 5′-CCCCATCTGGATTGGCAGTT-3′; Downstream primer: 5′-CGCCCTTTGACGGTTGGATA-3′; Ulmus_p40: Upstream primer: 5′-GCCAGTTGGGTGGATCAAGA-3′; Downstream primer: 5′-GTGGGGATGCGAGAGAACAA-3′.

2. An application of the primer pair according to claim 1, characterized in that: Used to identify Ulmus pumila or Ulmus chinensis germplasm; The primer pair is Ulmus_p104: The sample with an amplified product fragment size of 212 bp is Ulmus pumila; The sample whose amplified product contained a fragment size of 209 bp was Ulmus pumila; The primer pair is Ulmus_p40: The sample with amplified product fragment size of 253 bp is Ulmus pumila; The samples with amplified product fragment size of 241 to 251 bp belong to Ulmus pumila.

3. A method for identifying Ulmus pumila and Ulmus truncatum germplasm using the primer pair of claim 1, characterized in that: The identification steps are as follows: Step S1: collecting fresh tissue samples of Ulmus pumila or Ulmus truncatum to be tested, and extracting DNA from the tissue samples; Step S2: using the DNA extracted in step S1 as a template, and performing PCR amplification using the primer pair; Step S3: electrophoresis to detect the amplified product; Step S4: determining whether the sample to be tested is Ulmus pumila or Ulmus truncatum according to the test result; The primer pair is Ulmus_p104: The sample with an amplified product fragment size of 212 bp is Ulmus pumila; The sample whose amplified product contained a fragment size of 209 bp was Ulmus pumila; The primer pair is Ulmus_p40: The sample with amplified product fragment size of 253 bp is Ulmus pumila; The samples with amplified product fragment size of 241 to 251 bp belong to Ulmus pumila.

4. The method according to claim 3, characterized in that The tissue samples are young leaves.

5. The method according to claim 3, characterized in that: The electrophoresis is capillary electrophoresis or gel electrophoresis.

6. The method according to claim 5, characterized in that The capillary electrophoresis is specifically as follows: 0.1 μL of the PCR product in step S2 is diluted to 1 μL, mixed with 15 μL of a 100:1 mixture of formamide and molecular weight internal standard, added to a PCR plate, denatured at 95° C. for 5 min, cooled at 4° C. and centrifuged, and then tested on a machine.

7. The method according to claim 3, characterized in that In the step S4: the original data obtained in step S3 are analyzed, and the position of the molecular weight internal standard in each lane is compared with the position of each sample peak to obtain the fragment size.

8. The method according to claim 3, characterized in that The step S4 also includes calculating a genetic distance matrix based on the original site data, and constructing a phylogenetic tree using a similarity coefficient method based on the GS value matrix.

Images