Grass carp TLR1 gene SNP sites, site combinations and their applications related to resistance to aquatic pathogens
By detecting the SNP sites of the grass carp TLR1 gene, disease-resistant grass carp were screened, solving the problem of multiple drug resistance of grass carp to Aeromonas hydrophila, realizing disease-resistant breeding of grass carp, and improving the disease resistance of grass carp.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2026-01-04
- Publication Date
- 2026-08-04
AI Technical Summary
Grass carp are susceptible to bacterial hemorrhagic disease caused by Aeromonas hydrophila during the breeding process, and multiple drug resistance is a prominent problem. Current technology lacks effective gene-related SNP loci for disease-resistant breeding.
By screening for SNP sites at bases 21444916 and 21444058 of the grass carp TLR1 gene, corresponding primers were developed for PCR detection. Combined with molecular marker-assisted selection breeding, disease-resistant grass carp varieties were screened out.
This study provides a rapid and accurate method for screening grass carp resistant to Aeromonas hydrophila, thereby improving the disease resistance of grass carp, reducing the side effects of antibiotic use, and has important breeding reference value.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of aquatic organism breeding, specifically involving the SNP sites, site combinations and their applications related to the grass carp TLR1 gene and resistance to aquatic pathogens. Background Technology
[0002] Grass carp (Ctenopharyngodon idella), belonging to the order Cypriniformes, family Cyprinidae, subfamily Leuciscinae, and genus Ctenopharyngodon, is also known as grass carp. In grass carp farming, bacterial hemorrhagic disease (septicemia) caused by Aeromonas hydrophila is a serious threat. When infected with Aeromonas hydrophila, the body surface shows severe congestion and hemorrhage, protruding eyeballs, and a swollen and protruding anus, sometimes accompanied by swelling or ulceration of the head and snout. The abdominal cavity contains ascites or pale yellow fluid; the liver, spleen, kidneys, and other internal organs are enlarged, pale in color, and mottled or congested with hemorrhage; the intestines are congested and inflamed, with a large amount of mucus. Pathological histological examination reveals severe necrosis, vacuolation, and hemorrhage in the liver tissue. The disease can occur in a wide range of water temperatures, from 9℃ to 36℃, with the highest morbidity and mortality rates at water temperatures of 25-30℃. The outbreak season is long, from March to November, with a peak from May to September. It is prone to outbreak when water quality deteriorates, fish are injured, or stress leads to decreased immunity, causing bacterial hemorrhagic disease (septicemia).
[0003] Currently, multidrug resistance in Aeromonas hydrophila is a significant problem, and treatment with antibiotics (such as enrofloxacin and sulfonamides) has side effects. Therefore, breeding disease-resistant grass carp is a more economical and effective approach.
[0004] SNPs (Single nucleotide polymorphisms) refer to variations in a single nucleotide in the genome and are one of the most common forms of genetic variation. Studying SNP loci can reveal genetic differences between individuals, providing an important foundation for the study of hereditary traits. In grass carp, investigating the correlation between SNP loci and resistance to Aeromonas hydrophila can provide important theoretical basis for disease-resistant breeding of grass carp. Therefore, identifying SNP loci associated with Aeromonas hydrophila resistance in grass carp is of great significance for grass carp farming and disease control. Currently, researchers have identified several SNP loci in grass carp associated with Aeromonas hydrophila resistance.
[0005] However, SNP sites related to the grass carp immune gene TLR1 have not yet been reported. Summary of the Invention
[0006] The purpose of this invention is to provide a reagent for detecting the 21444916th base of grass carp chromosome 14 in the screening and breeding of disease-resistant grass carp.
[0007] Another object of the present invention is to provide a reagent for detecting bases 21444058 and 21444916 of chromosome 14 of grass carp and its application in the screening and breeding of disease-resistant grass carp.
[0008] To achieve the above objectives, the present invention adopts the following technical measures:
[0009] The applicant collected unvaccinated grass carp from ponds at a grass carp farming base in Wuhan. Individuals artificially infected with Aeromonas hydrophila to induce an outbreak of bacterial hemorrhagic disease in grass carp were designated as the susceptible group, while those that survived after stabilization were designated as the resistant group. Different phenotypes were recorded, and combined with sequencing results, Graphpad software was used to perform genome-wide association analysis (GWAS) by combining SNP genotype and phenotype data. Ultimately, two SNPs associated with Aeromonas hydrophila resistance in the grass carp TLR1 gene were identified: SNP Chr14-21444058, located at base 21444058 on chromosome 14 of grass carp (A (adenine) or T (thymine); and SNP Chr14-21444916, located at base 21444916 on chromosome 14 of grass carp (C (cytosine) or T (thymine)).
[0010] The scope of protection of this invention includes:
[0011] Application of reagents for detecting base position 21444916 on chromosome 14 of grass carp in the selection and breeding of disease-resistant grass carp.
[0012] The above-described application uses the following method for determining the genotype: when the genotype at position 21444916 is detected as TT, it is determined to be a disease-resistant trait; when the genotype at position 21444916 is detected as CC, it is determined to be a susceptible trait.
[0013] Application of reagents for detecting bases at positions 21444058 and 21444916 of chromosome 14 in the selection and breeding of disease-resistant grass carp.
[0014] The above-described application uses the following criteria for determination: when the genotype at position 21444916 is TT, it is determined to be a disease-resistant trait; when the genotype at position 21444916 is CC, it is determined to be a susceptible trait; when the genotype at position 21444058 is TT, it is determined to be a disease-resistant trait; and when the genotype at position 21444058 is AA, it is determined to be a susceptible trait.
[0015] In the applications described above, primers are preferred as the reagents.
[0016] In the above-described applications, preferably, the primers are:
[0017] Detection primers for Chr14-21444058 site: upstream primer F: 5' GGCAGTTTCGGGACAGGTG 3', downstream primer R: 5' TGAGTTATTTACTCTGAGAGATGGAGC 3';
[0018] Detection primers for Chr14-21444916 site: upstream primer F: 5' TTGAACCAGGGATTCTGACGAT 3', downstream primer R: 5' CCTTTGGGCATCAGATTGTGTC 3'.
[0019] A method for screening and breeding disease-resistant grass carp includes detecting bases at positions 21444916 and / or 21444058 of chromosome 14 of grass carp using conventional methods in the art. These conventional methods include, but are not limited to, sequencing, TaqMan probe assay, AS-PCR, molecular beacon assay, high-resolution melting curve assay, CAPS assay, SNaPshot assay, KASP assay, PARMS assay, gene chip assay, or mass spectrometry.
[0020] The preferred method described above is PCR detection, using the following primers:
[0021] Detection primers for Chr14-21444058 site: upstream primer F: 5' GGCAGTTTCGGGACAGGTG 3', downstream primer R: 5' TGAGTTATTTACTCTGAGAGATGGAGC 3';
[0022] Detection primers for Chr14-21444916 site: upstream primer F: 5' TTGAACCAGGGATTCTGACGAT 3', downstream primer R: 5' CCTTTGGGCATCAGATTGTGTC 3'.
[0023] Preferably, the disease resistance described in the above-described applications or methods is against diseases caused by Aeromonas hydrophila infection.
[0024] The grass carp reference genome used in this invention is the publicly available version from NCBI, accessible at: https: / / ftp.ncbi.nlm.nih.gov / genomes / all / GCF / 019 / 924 / 925 / GCF_019924925.1_HZGC01 / GCF_019924925.1_HZGC01_genomic.fna.gz.
[0025] Compared with the prior art, the beneficial results of the present invention are as follows:
[0026] This invention screened two SNP molecular markers from the grass carp TLR1 gene that are significantly associated with resistance to Aeromonas hydrophila. These SNP molecular markers can be used for marker-assisted breeding of grass carp to accelerate the selection of disease-resistant grass carp varieties and provide a reference for disease-resistant breeding of grass carp or other farmed fish. Detailed Implementation
[0027] To enable those skilled in the art to better understand the technical content of this invention, the invention will be further described below with reference to specific embodiments and appendices. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial sources. The grass carp reference genome used in this invention is the publicly available version from NCBI (https: / / ftp.ncbi.nlm.nih.gov / genomes / all / GCF / 019 / 924 / 925 / GCF_019924925.1_HZGC01 / GCF_019924925.1_HZGC01_genomic.fna.gz).
[0028] Example 1:
[0029] Mining of SNPs related to resistance to Aeromonas hydrophila in grass carp:
[0030] 1) The applicant collected 76 grass carp individuals that were artificially infected with Aeromonas hydrophila and caused an outbreak of bacterial hemorrhagic disease in grass carp from ponds at a grass carp breeding base in Wuhan as the susceptible group. After the disease outbreak, 43 individuals that had stabilized and survived were collected as the disease-resistant group, for a total of 119 grass carp samples. After TLR1 amplification, the samples were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing assembly was performed using the software DNAstar, and the sequencing results were analyzed using Snapgene.
[0031] 2) Record different phenotypes, combine them with sequencing results, and use Graphpad software to combine SNP genotype and phenotype data for genome-wide association analysis.
[0032] The results showed that there were 13 SNP sites in the entire grass carp TLR1 gene. After secondary infection verification, two SNPs that may be related to Aeromonas hydrophila resistance were finally identified. Their physical locations and sequence information are shown in Table 1. In Table 1, SNP site Chr14-21444058 is located at position 21444058 on chromosome 14 of grass carp, which is position 412 of the corresponding sequence in Table 1. The base N at position 412 is either A (adenine) or T (thymine). SNP site Chr14-21444916 is located at position 21444916 on chromosome 14 of grass carp, which is position 213 of the corresponding sequence in Table 1. The base M at position 213 is either C (cytosine) or T (thymine).
[0033] These two SNP sites are associated with Aeromonas hydrophila resistance and can be used for the breeding of disease-resistant traits in grass carp. The results of the analysis of these sites are shown in Table 2.
[0034] Table 1. Information on SNPs related to resistance in Aeromonas hydrophila.
[0035]
[0036] Table 2. Statistical analysis of SNP loci in susceptible and resistant populations.
[0037]
[0038] Table 2 shows that the genotypes of the two SNP loci differed significantly between the resistant and susceptible groups (P < 0.05). The genotypes significantly associated with disease resistance at these two SNP loci were: Chr14-21444058: TT and Chr14-21444916: TT. The genotypes significantly associated with susceptibility were: Chr14-21444058: AA and Chr14-21444916: CC. Therefore, the SNP markers of this invention can be used for the breeding of grass carp resistant to Aeromonas hydrophila.
[0039] Example 2:
[0040] Application of Aeromonas hydrophila resistance-related SNP sites in grass carp breeding
[0041] Based on the two single nucleotide polymorphism sites located in Example 1 of this invention, corresponding primers were developed for molecular marker-assisted selection breeding of disease-resistant grass carp to obtain grass carp varieties resistant to Aeromonas hydrophila. Primer information is shown in Table 3.
[0042] Table 3. Primer nucleotide sequences for amplifying SNPs related to resistance to hemorrhagic disease in grass carp.
[0043]
[0044] Example 3:
[0045] Application of Aeromonas hydrophila resistance-related SNP sites in disease-resistant grass carp selection and breeding
[0046] In April-May 2025, healthy grass carp (8-10 cm in total length) were collected from ponds at a grass carp farming base in Wuhan. After artificially infecting them with Aeromonas hydrophila, 200 diseased individuals were collected. The genotypes of the two SNP loci located in Example 1 of the deceased individuals were detected to verify the correlation between genotype and Aeromonas hydrophila resistance. The specific steps included:
[0047] 1) DNA extraction and PCR amplification
[0048] DNA was extracted from 200 tail fin strips of the validation population using the isopropanol / ammonium acetate method and diluted to 100 ng / μL for later use. Grass carp genomic DNA was used as a template, and PCR amplification was performed using primers shown in Table 3.
[0049] PCR reaction conditions: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, Tm=60℃ annealing for 30 s, 72℃ extension for 15 s, 34 cycles; 72℃ extension for 10 min, storage at 4℃.
[0050] The PCR system is as follows: 0.25 μL each of upstream and downstream primers, 0.5 μL of DNA template, 5 μL of SuperLong Taq MasterMix (Mei5bio, Beijing, China), and ddH2O to a final volume of 10 μL.
[0051] 2) Genotype statistics
[0052] After PCR, the corresponding sample sequences were obtained using Sanger sequencing. The genotypes of the SNP sites described in this invention were read based on the sequencing peak diagram of each sample, and their survival and mortality rates were calculated. The statistical results are shown in Tables 4 and 5.
[0053] Table 4. Detection of two disease-resistant SNP genotypes in 100 diseased and deceased individuals.
[0054]
[0055] Table 5. Detection of the two disease-resistant SNP genotypes in 100 resistant surviving individuals.
[0056]
[0057] As shown in Tables 4 and 5, the molecular marker Chr14-21444916 exhibits higher accuracy in detecting disease resistance. Both markers can be used individually or simultaneously. When used together, specifically when the genotypes at the SNP locus Chr14-21444058 and Chr14-21444916 are TT and TT respectively, the survival rate is significantly higher than the mortality rate, indicating that the individual is a grass carp resistant to Aeromonas hydrophila.
[0058] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure. Any improvements and modifications made based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection is determined by the claims.
Claims
1. Application of a reagent for detecting the 21444916th base of grass carp chromosome 14 in the selection and breeding of disease-resistant grass carp, wherein the disease resistance refers to resistance to diseases caused by Aeromonas hydrophila infection, and the determination method is as follows: when the genotype of the 21444916th base is detected as TT, it is determined as a disease-resistant trait; when the genotype of the 21444916th base is detected as CC, it is determined as a susceptible trait; the reference genome of grass carp is GCF_019924925.1_HZGC01.
2. Application of reagents for detecting bases at positions 21444058 and 21444916 of chromosome 14 in the selection and breeding of disease-resistant grass carp, wherein the disease resistance refers to resistance to diseases caused by Aeromonas hydrophila infection. The determination method is as follows: when the genotype at position 21444916 is TT, it is determined to be a disease-resistant trait; when the genotype at position 21444916 is CC, it is determined to be a susceptible trait. Similarly, when the genotype at position 21444058 is TT, it is determined to be a disease-resistant trait; when the genotype at position 21444058 is AA, it is determined to be a susceptible trait. The reference genome for grass carp is GCF_019924925.1_HZGC01.
3. The application according to claim 1 or 2, wherein the reagent is a primer.
4. According to claim 1 or 2, the primers for detecting the 21444058th base of grass carp chromosome 14 are: upstream primer F: 5' GGCAGTTTCGGGACAGGTG 3', downstream primer R: 5'TGAGTTATTTACTCTGAGAGATGGAGC 3'; the primers for detecting the 21444916th base of grass carp chromosome 14 are: upstream primer F: 5' TTGAACCAGGGATTCTGACGAT 3', downstream primer R: 5' CCTTTGGGCATCAGATTGTGTC 3'.
5. A method for screening and breeding disease-resistant grass carp, comprising detecting base position 21444916 and / or base position 21444058 of grass carp chromosome 14, wherein the detection method is: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry; wherein the disease resistance is resistance to diseases caused by Aeromonas hydrophila infection, and the method... The determination method is as follows: when the genotype at position 21444916 is TT, it is determined to be a disease-resistant trait; when the genotype at position 21444916 is CC, it is determined to be a susceptible trait; when the genotype at position 21444058 is TT, it is determined to be a disease-resistant trait; when the genotype at position 21444058 is AA, it is determined to be a susceptible trait. The reference genome for grass carp is GCF_019924925.1_HZGC01.
6. The method according to claim 5, wherein the method is a PCR detection, and the primers used are: the primers for detecting the 21444058th base of grass carp chromosome 14 are: upstream primer F: 5' GGCAGTTTCGGGACAGGTG 3', downstream primer R: 5' TGAGTTATTTACTCTGAGAGATGGAGC 3'; the primers for detecting the 21444916th base of grass carp chromosome 14 are: upstream primer F: 5' TTGAACCAGGGATTCTGACGAT 3', downstream primer R: 5'CCTTTGGGCATCAGATTGTGTC 3'.