Primer pair for identifying ulmus pumila and ulmus macrocarpa germplasm and application thereof

By using transcriptome sequencing and designing specific primer pairs Ulmus_p104 and Ulmus_p40, the problem of germplasm identification of *Ulmus sylvestris* and *Ulmus parvifolia* was solved, enabling rapid and accurate germplasm identification and promoting the breeding of superior varieties of *Ulmus sylvestris* and *Ulmus parvifolia*.

CN119530433BActive Publication Date: 2026-05-05HEBEI ACAD OF FORESTRY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HEBEI ACAD OF FORESTRY SCI
Filing Date
2024-12-02
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively distinguish between white elm and Chinese elm germplasm, leading to difficulties in early germplasm identification.

Method used

Using SSR molecular markers derived from transcriptome sequencing, specific primer pairs Ulmus_p104 and Ulmus_p40 were designed, and germplasm of *Ulmus pumila* and *Ulmus chinensis* was identified by PCR amplification and electrophoresis.

Benefits of technology

This has enabled rapid and accurate identification of germplasm of white elm and Chinese elm, promoting the breeding of superior varieties and the utilization of excellent germplasm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119530433B_ABST
    Figure CN119530433B_ABST
Patent Text Reader

Abstract

This invention discloses a primer pair for identifying *Ulmus pumila* and *Ulmus chinensis* germplasm and its application. The primer pair is Ulmus_p104 or / and Ulmus_p40. Fresh tissue samples of *Ulmus pumila* or *Ulmus chinensis* to be tested are collected, and DNA is extracted from the tissue samples. Using this DNA as a template, PCR amplification is performed using the primer pair. The amplification products are detected by electrophoresis. Based on the detection results, the sample is determined to be either *Ulmus pumila* or *Ulmus chinensis*. This invention utilizes SSR molecular markers from transcriptome sequencing to identify *Ulmus pumila* and *Ulmus chinensis* germplasm resources, which is beneficial for promoting the breeding of superior varieties of *Ulmus pumila* and *Ulmus chinensis* and accelerating the utilization of superior germplasm. The specific primers of this invention amplify tissues of *Ulmus chinensis* and *Ulmus pumila* respectively, and the difference in product length between the two is significant, indicating that these specific primers can effectively identify *Ulmus pumila* and *Ulmus chinensis* germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to primer pairs, specifically primer pairs for identifying germplasm of Ulmus pumila and Ulmus parvifolia. Background Technology

[0002] White elm (Ulmus pumila L.) and Chinese elm (Ulmus parvifolia) are trees belonging to the genus Ulmus (Ulmus L.) of the family Ulmaceae. They are widely distributed native broad-leaved tree species in China. The genus Ulmus contains more than 30 species, native to the Northern Hemisphere. my country has 25 species and 6 varieties, distributed throughout the country, with a higher concentration north of the Yangtze River.

[0003] Both white elm and Chinese elm are light-loving tree species with well-developed root systems and strong resistance, making them excellent tree species for soil conservation and sand fixation in harsh ecological environments. Their winged fruits are edible (containing 20%–40% oil) and have excellent wood quality, making them important raw material species for the pharmaceutical, light, and chemical industries. Their branches and leaves tolerate pruning and are highly ornamental, widely used in landscaping. Therefore, white elm and Chinese elm are multifunctional tree species that integrate ecological, economic, and ornamental value.

[0004] In the process of realizing this invention, the inventors discovered that at least one of the following technical problems exists in the prior art:

[0005] my country has abundant germplasm resources of white elm and Chinese elm. Apart from the obvious difference in flowering time (white elm flowers in spring and Chinese elm flowers in autumn), white elm and Chinese elm have similar phenotypic traits and are difficult to distinguish, which brings difficulties to the early identification of germplasm. Summary of the Invention

[0006] Therefore, the purpose of this invention is to provide an SSR molecular marker using transcriptome sequencing for rapid identification of white elm and Chinese elm germplasm.

[0007] Through long-term exploration and experimentation, as well as numerous trials and efforts, the inventors have continuously reformed and innovated to solve the above-mentioned technical problems. The technical solution provided by this invention is to provide a primer pair for identifying *Ulmus pumila* or *Ulmus parvifolia* germplasm. The primer pair is one or more of the following primer pairs:

[0008] Ulmus_p104:

[0009] Upstream primer: 5'-CCCCATCTGGATTGGCAGTT-3';

[0010] Downstream primer: 5'-CGCCCTTTGACGGTTGGATA-3';

[0011] Ulmus_p40:

[0012] Upstream primer: 5'-GCCAGTTGGGTGGATCAAGA-3';

[0013] Downstream primer: 5'-GTGGGGATGCGAGAGAACAA-3'.

[0014] The present invention also provides an application of the primer pair for identifying germplasm of white elm or Chinese elm;

[0015] The primer pair is Ulmus_p104:

[0016] The sample with an amplified product fragment size of 212bp was Ulmus parvifolia;

[0017] The sample whose amplification product contains a fragment of 209 bp is white elm;

[0018] The primer pair is Ulmus_p40:

[0019] The sample with an amplified product fragment size of 253bp was Ulmus parvifolia;

[0020] The samples with amplified product fragment size of 241–251 bp were white elm.

[0021] This invention also discloses a method for identifying germplasm of *Ulmus pumila* and *Ulmus parvifolia* using the primer pair, the identification steps of which are as follows:

[0022] Step S1: Collect fresh tissue samples of the white elm or Chinese elm to be tested and extract DNA from the tissue samples;

[0023] Step S2: Using the DNA extracted in step S1 as a template, perform PCR amplification using the primer pair;

[0024] Step S3: Electrophoresis detection of amplification products;

[0025] Step S4: Determine whether the sample to be tested is white elm or Chinese elm based on the test results;

[0026] The primer pair is Ulmus_p104:

[0027] The sample with an amplified product fragment size of 212bp was Ulmus parvifolia;

[0028] The sample whose amplification product contains a fragment of 209 bp is white elm;

[0029] The primer pair is Ulmus_p40:

[0030] The sample with an amplified product fragment size of 253bp was Ulmus parvifolia;

[0031] The samples with amplified product fragment size of 241–251 bp were white elm.

[0032] According to one embodiment of the method of the present invention, the tissue sample is a young leaf.

[0033] According to one embodiment of the method of the present invention, the electrophoresis is capillary electrophoresis or gel electrophoresis.

[0034] According to one embodiment of the method of the present invention, the capillary electrophoresis is specifically performed as follows: 0.1 μL of the PCR product obtained in step S2 is diluted to 1 μL, mixed with 15 μL of a 100:1 mixture of formamide and molecular weight internal standard, and then added to a PCR plate. The mixture is denatured at 95°C for 5 min, cooled at 4°C, centrifuged, and then analyzed by the instrument.

[0035] According to one embodiment of the method of the present invention, in step S4: the raw data obtained in step S3 is analyzed, and the positions of the molecular weight internal standards in each lane are compared and analyzed with the positions of the peak values ​​of each sample to obtain the fragment size.

[0036] According to one embodiment of the method of the present invention, step S4 further includes calculating a genetic distance matrix based on the original locus data and constructing a phylogenetic tree using the similarity coefficient method based on the GS value matrix.

[0037] Compared with the prior art, one of the above technical solutions has the following advantages:

[0038] a) This invention utilizes SSR molecular markers from transcriptome sequencing to identify germplasm resources of *Ulmus pumila* and *Ulmus parvifolia*, which is beneficial for promoting the breeding of superior varieties of *Ulmus pumila* and *Ulmus parvifolia* and accelerating the utilization of excellent germplasm.

[0039] b) The specific primers of this invention were used to amplify the tissues of Ulmus parvifolia and Ulmus hainanensis, respectively. The difference in product length between the two was significant, indicating that these specific primers can effectively identify the germplasm of Ulmus parvifolia and Ulmus parvifolia. Attached Figure Description

[0040] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained from these drawings without creative effort.

[0041] Figure 1 This is an electrophoresis image of white elm and Chinese elm germplasm amplified using Ulmus_p104 primers.

[0042] Figure 2 This is an electrophoresis image of white elm and Chinese elm germplasm amplified using Ulmus_p40 primers.

[0043] Figure 3 This is a phylogenetic tree constructed using primers specific to experimental group A.

[0044] Figure 4 This is a phylogenetic tree constructed using primers specific to control group B. Detailed Implementation

[0045] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention.

[0046] A large number of EST-SSR primer sequences were obtained by transcriptome sequencing of elm trees.

[0047] 200 primer pairs were selected for stability, specificity and polymorphism tests. After testing, 16 primer pairs were selected, and after comparative analysis, 2 specific primer pairs were finally selected (Table 1) for germplasm identification of Ulmus pumila and Ulmus parvifolia.

[0048] Table 1. Information on the two pairs of specific EST-SSR primers obtained through screening.

[0049] Primer name Ulms_p40 Ulms_p104 ID Cluster-23829.0 Cluster-32283.4 SSR nr. 2 1 SSR type c* p3 Repeating sequence (AG)11(AGAG)5* (CGC)5 size 20 15 Starting point of repeating sequence 1465 117 End of repeat sequence 1484 131 Upstream primer sequence gccagttgggtggatcaaga ccccatctggattggcagtt upstream primer origin 1348 83 Downstream primer sequence gtggggatgcgagagaacaa cgccctttgacggttggata Downstream primer origin 1597 292

[0050] A *Ulmus* cDNA library was constructed based on transcriptome data from *Ulmus spp.* leaves. The primer Ulmus_p40 was located at a 1616 bp sequence, as shown in SEQ ID NO.1, with a coding interval of 348-1394(-), encoding 348 amino acids, as shown in SEQ ID NO.15. Primers Ulmus_p40 were designed based on the sequence shown in SEQ ID NO.1.

[0051] A *Ulmus* cDNA library was constructed based on transcriptome data from *Ulmus spp.* leaves. The primer Ulmus_p104 was located at a 3133 bp sequence, as shown in SEQ ID NO. 2, encoding the 1955-2944(+) amino acid range, totaling 329 amino acids, as shown in SEQ ID NO. 16. Primers Ulmus_p104 were prepared based on the sequence shown in SEQ ID NO. 2.

[0052] The steps for identifying *Ulmus pumila* and *Ulmus parvifolia* using EST-SSR molecular markers obtained from transcriptome sequencing are as follows:

[0053] 1) Collect fresh, young leaf samples of the white elm or Chinese elm to be tested and extract DNA from the leaf samples.

[0054] DNA was extracted from 26 young leaf samples of *Ulmus pumila* and *Ulmus parvifolia* germplasm (Table 2) using the Tiangen High-Efficiency Plant Genomic DNA Extraction Kit.

[0055] Table 2 Germplasm of *Ulmus pumila* and *Ulmus parvifolia*

[0056]

[0057] In this embodiment, two sets of EST-SSR specific primers were set up as controls. Experimental group A consisted of the two pairs of EST-SSR specific primers listed in Table 1, namely Ulmus_p104 and Ulmus_p40. Control group B consisted of four other pairs of EST-SSR specific primers randomly selected by the inventors from a large amount of experimental data during the completion of this invention, namely p20, p61, p141, and p148 (sequences shown in Table 3). The upstream and downstream sequences of both sets of specific primers were synthesized by Anhui General Biotechnology Co., Ltd.

[0058] Table 3. Information on Group B specific EST-SSR primers

[0059]

[0060] 2) Amplification.

[0061] Using the DNA extracted in step 1) as a template, PCR amplification was performed using the specific primers of group A and group B mentioned above. The PCR instrument used was a Hangzhou Jinglü-K960 thermal cycler.

[0062] The PCR amplification used a 20 μL reaction system, including: 14.8 μL ddH2O, 0.4 μL dNTP, 2 μL PCR Buffer, 0.3 μL (20 μM) upstream primer, 0.3 μL (μM) downstream primer, 2 μL DNA template, and 0.2 μL Taq.

[0063] The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 45 s, 72℃ extension for 50 s, for a total of 35 cycles; and finally 72℃ extension for 5 min.

[0064] 3) Capillary electrophoresis detection of amplification products.

[0065] Take 0.1 μL of the PCR amplification product from step 2), dilute it to 1 μL, mix it with 15 μL of a 100:1 mixture of formamide and molecular weight internal standard, add it to a PCR plate, denature at 95℃ for 5 min, cool at 4℃ and centrifuge, then analyze it using an ABI 3730XL DNAanalyzer and an ABI 96×50cm 4331246 capillary tube. See Table 4 for specific parameters.

[0066] Table 4 Gene Analyzer Parameter Settings

[0067]

[0068] After electrophoresis, the raw data obtained from the sequencer were analyzed using the Fragment (Plant) analysis function in Genemarker V2.2.0 software to determine the fragment sizes. The electrophoresis images of *Ulmus pumila* and *Ulmus chinensis* germplasms amplified with Ulmus_p104 primers are shown below. Figure 1 As shown; electrophoresis images of white elm and Chinese elm germplasm amplified using Ulmus_p40 primers are shown below. Figure 2 As shown.

[0069] Table 5. Length of primer amplification products from group A germplasm of *Ulmus pumila* and *Ulmus parvifolia*

[0070]

[0071] Table 6. Length of primer amplification products from Group B germplasm of *Ulmus pumila* and *Ulmus parvifolia*

[0072]

[0073]

[0074] The results are shown in Tables 5 and 6. In Group A, the products of *Ulmus parvifolia* germplasm LY1-6 under the specific primer Ulmus_P40 were both 253bp and 253bp, indicating homozygosity; under the specific primer Ulmus_P104, the products were both 212bp and 212bp, also indicating homozygosity, showing a significant difference in length compared to *Ulmus spp.*. In Group B, the products amplified by the four pairs of SSR specific primers showed differences, indicating significant differences among germplasms, but it was not possible to effectively distinguish between *Ulmus spp.* and *Ulmus parvifolia*. Although the products of *Ulmus parvifolia* germplasm LY1-6 under the specific primer P20 were both 243bp and 243bp, indicating homozygosity, homozygosity of 243bp and 243bp was also detected in Ul7 and Ul10.

[0075] The lengths of various amplification products were determined, and genetic distances were calculated using Popgen32 software. Based on the GS value matrix, a phylogenetic tree was constructed using the similarity coefficient method. The analysis results are as follows: Figure 3 , Figure 4 As shown, Group A ( Figure 3Phylogenetic trees using two pairs of EST-SSR specific primers divided the germplasm of *Ulmus pumila* and *Ulmus parvifolia* into two groups. The upper group, containing Ul3, 11, 6, 12, 13, 14, 15, 9, 1, 2, 4, 8, 10, 5, and 7, all of which are *Ulmus pumila*, and the lower group, containing LY4, 1, 2, 3, 5, and 6, all of which are *Ulmus parvifolia*, could be completely distinguished from *Ulmus parvifolia* using both pairs of EST-SSR specific primers. Group B ( Figure 4 The phylogenetic tree of the four EST-SSR specific primers could not effectively distinguish between the germplasm of *Ulmus pumila* and *Ulmus parvifolia*, and the two types of germplasm were mixed together, indicating that the four EST-SSR specific primers in group B could not effectively identify the germplasm of *Ulmus pumila* and *Ulmus parvifolia*.

[0076] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An application of a primer set, characterized in that, Used for identifying *Ulmus pumila* or *Ulmus parvifolia* germplasm in *Ulmus parvifolia* and *Ulmus parvifolia*; the primer set consists of the following primer pairs. composition: Ulmus_p104: Upstream primer: 5'- CCCCATCTGGATTGGCAGTT-3'; Downstream primer: 5'-CGCCCTTTGACGGTTGGATA-3'; Ulmus_p40: Upstream primer: 5'-GCCAGTTGGGTGGATCAAGA-3'; Downstream primer: 5'- GTGGGGATGCGAGAGAACAA-3'.

2. A method for identifying *Ulmus pumila* or *Ulmus parvifolia* germplasm in *Ulmus parvifolia* and *Ulmus parvifolia*, characterized in that, The identification steps are as follows: Step S1: Collect fresh tissue samples of the white elm or Chinese elm to be tested and extract DNA from the tissue samples; Step S2: Using the DNA extracted in step S1 as a template, perform PCR amplification using the primer set described in claim 1; Step S3: Electrophoresis detection of amplification products; Step S4: Determine whether the sample to be tested is white elm or Chinese elm based on the test results.

3. The method according to claim 2, characterized in that, The tissue sample was a young leaf.

4. The method according to claim 2, characterized in that, The electrophoresis is capillary electrophoresis or gel electrophoresis.

5. The method according to claim 4, characterized in that, The capillary electrophoresis is specifically performed as follows: 0.1 μL of the PCR product from step S2 is diluted to 1 μL, mixed with 15 μL of a 100:1 mixture of formamide and molecular weight internal standard, added to a PCR plate, denatured at 95°C for 5 min, cooled at 4°C and centrifuged, and then detected by the instrument.

6. The method according to claim 2, characterized in that, In step S4: the raw data obtained in step S3 is analyzed, and the positions of the molecular weight internal standards in each lane are compared and analyzed with the positions of the peak values ​​of each sample to obtain the fragment size.

7. The method according to claim 2, characterized in that, Step S4 further includes calculating the genetic distance matrix based on the original locus data, and constructing a phylogenetic tree using the similarity coefficient method based on the GS value matrix.

Citation Information

Patent Citations

  • Method for building an ISSR (inter-simple sequence repeat) fingerprint applicable to distinguishing and identification of Ulmus varieties

    CN102605061A

  • Method for identifying prunus persica plant species based on SSR molecular markers

    CN105512513A